• No results found

CHAPTER 3: Prostate specific transglutaminase TGM4 activity

3.2.6 Production/Purification of recombinant proteins

Our pFastBac1 constructs were sent to our collaborators to transfect in Sf9 insect cells. Media containing viral particles for human TGM4, chimpanzee KLK3, and human SEMG1 were received. Samples were heated at 95°C for 5 minutes, and amplified with GoTaq® (Promega) at the following conditions: (95°C, 30”)/(95°C, 10”/ 55°C, 15”/ 72°C, 1’)35 / (72°C, 10’) / 4°C, ∞)

using the primers listed in Table 3.8. PCR products were separated on a 0.8% agarose gel with 0.008% ethidium bromide and imaged under UV light.

Table 3.8: Primers used for viral particle amplification

Gene Primer Sequence

TGM4 F420: R720: 5’– CCCCCAATGCCATCCTGGGCAAGTACCAAC–3’ 5’– CACACATGGCCCTGCACACCAGCACGGGG–3’ R1020: 5’– TGGTGATTTTCTCGCCATTCTCATTCAC–3’ SEMG1 F450: R950: R1200: 5’– CATCTGGAAAGGGAATATCCAG–3’ 5’– GGGATACATCTTTCTGCACACC–3’ 5’– GCCATGGCTCTTGCTTAGGA–3’ KLK3 SeqInternal_Fwd: Block_B_F: His_Rev: 5’– CTCATCCTGTCTCGGATTG–3’ 5’– GATGCTGTGAAGGTCATGGA–3’ 5’– AATGGTGATGGTGATGGTG–3’

3.2.6.2 LNCaP cell culture

Androgen sensitive human metastatic prostate LNCaP cells were ordered from ATCC (Manassas, Virginia, lot number: 59410738). Cells were grown at 37°C with 5% CO2 in

Dulbeccos Modified Eagle’s Medium, DMEM (GE Healthcare, Little Chalfont, United Kingdom) with 10% FBS (Atlanta Biologicals, Flowery Branch, GA) and 1% penicillin streptomycin (Cellgro, Corning, New York). Cells were dispersed by Trypsin EDTA (Life

Technologies) every 3-4 days and transferred to a new 25cm2 flask (Sarstedt, Nümbrecht,

Germany) in a 1:4 dilution.

Endogenous Kallikrein 3 should be expressed from LNCaP cells (Väisänen et al, 1999). Approximately 3µg of protein from LNCaP media was separated in a 10% SDS-PAGE

(Invitrogen). An Immobilin®-FL PVDF (Millipore, Merck, Germany) was activated in methanol for one minute, and incubated in 1X NuPAGE (Invitrogen) transfer buffer with the separated gel and other cassette components for 10 minutes. The Western sandwich was

assembled and put into the mini Trans-Blot® (Bio-Rad) chamber with an ice pack. The apparatus was placed on a stir plate with agitation, and proteins were transferred at 100 volts for 45

minutes. The PVDF membrane was rinsed with water, and incubated in 50%odyssey block/50% PBS for an hour and subsequently rinsed in dH2O, three times for five minutes. Polyclonal rabbit

anti-KLK3 and mouse anti-TGM4 primary antibodies (ABCAM) were diluted (1:1,000) in 50%odyssey block/50% PBST. The membrane was incubated overnight in primary antibody, washed three times for five minutes in PBS, and then incubated for an hour in secondary donkey anti-mouse IRDye® 680RD and anti-rabbit IRDye® 800CW (Licor, Lincoln, NE) antibodies (1:15,000). Following three washes in PBST for five minutes, the Western blot was imaged on the Odyssey FC (Licor) imager.

Approximately 80,000 LNCaP cells were plated in each well of a 12 well plate (Corning, Corning, NY) 24 hours before transfection. SEMG1 and SEMG2 (1µg) in pSG5 (provided by Miyamoto) were mixed with 7.5µl of FuGENE (Promega), and DMEM media up to 250µl, and were incubated at room temperature for 5 minutes. Then 50µl of each mixture was slowly dropped in a circular fashion to a designated well. The plate was returned to the incubator (37°C and 5% CO2). 24 hours after transfection, 1mL of media was removed from each well and

replaced with 0.5mL of DMEM with 1% penicillin streptomycin. Media was collected and saved after 48 hours post transfection. Media was quantified, acetone precipitated, and Western blotted described later.

3.2.6.3 293T mammalian cell culture

Human embryonic kidney cells with T antigen (293T) were ordered from ATCC (lot number: 59587035). Cells were grown at 37°C with 5% CO2 in DMEM (GE Healthcare), with

10% FBS (Atlanta Biologicals) and 1% penicillin streptomycin (Cellgro). Cells were dispersed by Trypsin EDTA (Life Technologies) every 2-5 days and transferred to a new 25cm2 flask (Sarstedt) in a 1:4 or 1:10 dilution. Initially, SEMG1 and SEMG2 in pSG5 vectors were transfected as described for LNCaP cells. However, Jennifer (Vill) Doyle, optimized transfections with pCMV-GFP with polyethylinamine (PEI) transfection reagent.

Between 200,000-250,000 293T cells were plated with 1mL of DMEM, 10% FBS, and 1% penicillin streptomycin in a BioLite 12 well plate (Thermofisher Scientific) 24 hours before transfection. Then 1-2µg of pCMV- DNA, 1.63µl of PEI, and DMEM media up to 160µl was mixed together and incubated at room temperature for 20 minutes and then dropped into a designated well. Between 16-20 hours post transfection, total media was removed from the cells and replaced with 0.6 mL DMEM and 1% penicillin streptomycin. Media was collected at various time points (48, 72, 96, and 120 hours) post transfection. During optimization, cell lysate was also collected at various time points using Promega passive lysis buffer.

Transfections were up-scaled by plating 1,500,000 cells in 5mL DMEM, 10% FBS, and 1% penicillin streptomycin in a 25cm2 flask. 5µg of pCMV-DNA, 1µg of pCMV-GFP DNA, 8.2µl of PEI, and DMEM media up to 800µl was mixed together and incubated for 20 minutes in a 15mL conical tube. To ensure a uniform transfection, media was removed from the 25cm2 flask

and then 4.2mL of total media was added to the mixture and added to the 25cm2 flask. GFP

expression was imaged 48-72 hours post transfection using the confocal microscope. Media and lysate were quantified, purified, and assayed described later.

3.2.6.4 Protein quantification

Protein concentration was determined using either the Qubit® Protein Assay Kit (Thermofisher Scientific) or the Bradford protein assay (Bio-Rad). For the Qubit® Protein Assay, samples were undiluted and diluted 1:20 before assaying. 2µl of diluted sample was added to Qubit® protein assay buffer (1µl reagent in 199µl buffer) with the total volume being 200µl. Samples were vortexed, incubated for 5 minutes, and then protein concentration was measured with the Qubit 2.0 (Life Technologies). In the Bradford assay, samples were undiluted before assaying. Then 20µl of sample was added to 1mL of Bio-Rad Bradford assay dye, mixed, and incubated for 5 minutes. Absorbance at 595nm was measured using the Genesys 10 UV spectrophotometer (Thermo Spectronic, Rochester, NY). Utilizing 7 BSA standards, a standard curve was generated relating absorbance to mg/mL concentration. Sample concentration was calculated by solving for “x” using the standard slope equation generated by the standards. 3.2.6.5 Acetone precipitation

Some transfected media from both LNCaP and 293T cell lines were acetone precipitated. Four times the volume of -20°C acetone was added to the sample in a 15mL conical tube and incubated on ice for an hour. Samples were centrifuged at 4°C for 10 minutes at 14,000 rpm. The supernatant was decanted and the pellet was dried. Once dried, PBS was used to re-suspend the sample to its original volume.

3.2.6.6 His purification and dialysis

Transfected media from 293T cells was purified with His-Pur™ cobalt columns (Thermofisher Scientific). After purification, columns were washed with regeneration MES buffer (20mM 2-(N-morpholine)-ethanesulfonic acid, 0.1M sodium chloride: pH 5.0) and stored with 20% ethanol. Columns were labeled with the species and protein name and were only re- used with the same species/protein sample. Samples were dialyzed with slide-a-lyzer™ dialysis cassettes (Thermofisher Scientific). TGM4 proteins were dialyzed in 7.5mM CaCl2 and 5mM

Tris (pH 7.5) buffer because it was the reaction buffer used in downstream applications. 3.2.6.7 Antibody detection of recombinant proteins

Media and cell lysate from transfected 293T cells were analyzed with traditional Western and dot blotting methods, with primary antibodies specific to the protein, or most commonly, an anti-HIS primary antibody (Gen Script). 10µg of media or lysate was separated in a 10% SDS- PAGE (Invitrogen). An Immobilin®-FL PVDF (Millipore, Merck, Germany) was activated in methanol for one minute, and incubated in 1X NuPAGE (Invitrogen) transfer buffer with the separated gel and other cassette components for 10 minutes. The Western sandwich was

assembled and put into the mini Trans-Blot® (Bio-Rad) chamber with an ice pack. The apparatus was placed on a stir plate with agitation, and proteins were transferred at 100 volts for 45

minutes. The PVDF membrane was rinsed with water, and incubated in 50%odyssey block/50% PBS for an hour and subsequently rinsed in dH2O, three times for five minutes. Primary

antibodies specific to TGM4, KLK3, SEMG1, SEMG2, or HIS were diluted (1:1,000) in 50%odyssey block/50% PBST. The membrane was incubated overnight in primary antibody, washed three times for five minutes in PBST, and then incubated for an hour in secondary donkey anti-mouse IRDye® 680RD or anti-rabbit IRDye® 800CW (Licor) antibodies, diluted

1:15,000. Following three washes in PBST for five minutes, the Western blot was imaged on the Odyssey FC (Licor) imager.

Media and cell lysate samples (10µl, 100µl, and 200µl) were added to a dot blot apparatus (BioRad) over a dry nitrocellulose-FL (Licor) membrane. Samples were absorbed using a vacuum pump attached to a faucet. The membrane was blocked with 50% odyssey block/50% PBS for one hour, and rinsed three times with dH2O for five minutes. Anti-HIS (or

anti-TGM4) antibody, diluted 1:1,000 in 50%PBST/50% odyssey block, covered the membrane and was incubated overnight. The membrane was washed three times for five minutes in PBST, and then incubated for an hour in secondary goat anti-mouse IRDye® 800CW (Licor) antibody (diluted 1:15,000). After three washes in PBST for five minutes, the dot blot was imaged on the Odyssey FC (Licor) imager.

3.2.7 TGM4 assays