Gene expression analyses

Quantitative PCR (qPCR) amplifies specific DNA sequences for the detection and quantification of a target in real time. Synthesis of complementary DNA (cDNA) followed by reverse-transcription qPCR (RT-qPCR) is now regarded as the optimal approach for quantifying messenger ribonucleic acid (mRNA) abundance (Bustin, 2000).

Primers are used to bind to a specific sequence of the template DNA to be amplified in the presence of DNA polymerase. Then a thermal cycler is used to produce cycles, customarily 40, of the following stages:

1. Denaturation: denaturation of the double-stranded DNA (dsDNA) to single-stranded DNA (ssDNA) at a high temperature, typically 95°C. 2. Annealing: Hybridisation of primers (and probes) to complementary

template sequences, at approximately 60°C.

3. Extension: Primer extension by DNA polymerase, typically 70-72°C where polymerase activity is optimal.

Quantification by qPCR is based on the fluorescence intensity detected at the end of each cycle and this increases as the PCR product is amplified. This reaches 100% efficiency during the exponential amplification phase where the quantity of PCR product is doubled in each cycle (Edwards et al., 2004). A passive reference dye, such as carboxy-X-rhodamine (ROX), is also included in the reaction to normalise the fluorescent signals and to adjust for any differences between wells (Edwards et al., 2004).

Two detection methodologies exist: primer-dye based assays and probe-based assays. The first uses a dye, commonly SYBR Green, that binds dsDNA, i.e. the PCR product, and fluoresces (Dorak, 2006). A downfall of the use of such dyes is that they are non-specific and are able to bind to any dsDNA, which can lead to inaccurate quantification of the target of interest. Melting curve, or dissociation, analyses are run directly after the PCR reaction to confirm that the PCR has generated a single PCR product and identify whether primer-dimers have been detected. This is particularly important when running primer-dye

based assays where the dye binds non-specifically to dsDNA. Each target PCR product has a unique melting temperature (Tm), where half of the template is ssDNA (Dorak, 2006), and a single fluorescence peak should be visualised at, or close to, the Tm of the PCR product on the dissociation curve (Dorak, 2006). This issue of specificity associated with dye methods is overcome by using probe-based assays, labelled with a fluorescent reporter dye (5’ end) and a quencher (3’ end). When the probe is not bound and the reporter and quencher are in close proximity, the reporter signals are absorbed by the quencher by fluorescence resonance energy transfer (Dorak, 2006). During the extension stage of the reaction, the probe is degraded by exonuclease activity present in the polymerase. This releases and separates the reporter dye and quencher, allowing the reporter to emit fluorescent signals which are detected by the qPCR machine. Once the reaction has terminated, a threshold fluorescence value is set in the exponential phase for each gene and the threshold cycle (Ct value), which is the number of cycles taken for each sample to reach this fluorescence value, is determined (Edwards et al., 2004). The Ct value is inversely proportional to the amount of the target gene in the template sample. Two different methods may be used for gene expression quantification: quantification relative to the expression of reference genes or absolute quantification. In the present study, the relative quantification method was used where one or more reference, or housekeeping, genes that show stable expression in the tissue of interest and are not altered by treatment groups or condition are selected (Fink et al., 1998). The expression of the reference genes is quantified alongside that of the target genes, allowing for normalisation of gene expression which overcomes issues such as differences in template cDNA volumes and in quality of the extracted RNA.

To investigate differences in gene expression, both between groups following the dietary intervention and between different CRC risk groups (‘Normal’, ‘UC’ and ‘Polyp’), two-step RT-qPCR was used to quantify and compare the expression of the selected genes to be analysed. The dye detection method using SYBR Green was utilised, followed by relative quantification by normalisation with 18S and β2M reference genes.

2.2.1.1 Extraction of RNA from rectal mucosal biopsies

Total RNA was extracted using Qiagen’s RNeasy Mini Kit (Qiagen, UK) following the manufacturer’s instructions. OCT-embedded samples were removed from storage at -80°C and the biopsy was removed from the excess OCT using sterile pipette tips. Whole biopsies were cut in half using a new, sterile scalpel blade for each sample and RNA was extracted from half a biopsy. The remaining half biopsy not used was immediately placed back into its tube and returned to storage at -80°C. The tissue was scraped into a RNase-free tube containing 500μl RNAlater® and vortex mixed.

Tissue disruption and homogenisation were performed using 3mm glass beads (VWR, UK) followed by QiaShredders (Qiagen, UK). Five glass beads were dispensed into 2ml tubes and 150μl of Buffer RLT were added. The tissue was transferred to the 2ml tube containing the beads and shaken for 1 minute using an amalgamator. An additional 450μl of Buffer RLT were added to the lysate, yielding a total volume of 600μl of Buffer RLT. The lysate and beads were poured into the QiaShredder column and centrifuged for 2 minutes at maximum speed. The lysate was then centrifuged for 3 minutes at maximum speed and the supernatant was removed and transferred into a new microcentrifuge tube. One volume of 70% nuclease-free ethanol (≥99.8%, Fluka Analytical, Ukraine) was added to the lysate and mixed immediately by pipetting. The sample (700μl) was loaded onto an RNeasy spin column placed in a 2ml collection tube and centrifuged for 15 seconds at 10,000rpm.

The spin column membrane was washed with 700μl Buffer RW1 and centrifuged for 15 seconds at 10,000rpm. Two further wash steps were performed with Buffer RPE to prevent the carryover of ethanol during RNA elution. A final centrifugation step was performed in a new 2ml collection tube at maximum speed for 1 minute to eliminate any possible carryover of Buffer RPE. The RNA was eluted in 30μl of RNase-free water and only one elution step was performed in an attempt to maximise the total RNA concentration. All centrifugation steps were performed at room temperature.

2.2.1.1.1 RNA quantification

The RNA concentration and purity, indicated by the A260/A280 ratio, were quantified using the NanoDrop 1000 spectrophotometer (Thermo Scientific) and the NanoDrop 1000 Software version 3.7.1. The mean RNA concentrations and A260/280 ratios for each participant group are described in Table 2.1. These were of sufficient concentration for subsequent analyses and of adequate purity as indicated by an A260/280 ratio between 2.0 and 2.1.

The quality and integrity of the RNA were assessed using agarose gel electrophoresis and the presence and intensity of 18S and 28S ribosomal RNA bands were analysed. A 1% agarose gel was prepared using agarose powder (Fermentas) and 1x TBE buffer (gibco®) and heated until the agarose had dissolved. The gel was stained with 3µl of GelRed™ dye (10,000x) (Biotium, UK) and the cooled mixture was poured into the electrophoresis tray and left to set for 30 minutes. A volume of 4µl of extracted RNA mixed with 3µl of 6x loading dye (Fermentas) was loaded into each well alongside a DNA molecular weight marker ladder (Fermentas). The gel was run at 120V for approximately 30 minutes using the Flowgen Bioscience CS-250V. UV light was used to visualise the RNA using the AlphaImage® (Alpha Innotech) gel documentation system and AlphaEase® FC Software Version 4.1.0. An example image is shown in Figure 2.2.

Table 2.1 RNA concentrations and A260/280 ratios for Intervention, UC and Polyp samples.

Measurement Intervention UC Polyp

RNA concentration (ng/µl)

mean (SEM) 121.2 (5.5) 153.6 (25.3) 148.9 (12.2)

A260/A280 ratio

mean (SEM) 2.04 (0.01) 2.03 (0.02) 2.04 (0.01)

Figure 2.2 RNA agarose gel electrophoresis image showing 28S and 18S rRNA bands.

A volume of 4µl of each RNA sample (equating to 0.665µg of 052 pre and 0.452µg of 056 pre) were loaded onto a 1% agarose gel and electrophoresed for 30 minutes at 120V.

2.2.1.2 cDNA synthesis

cDNA was synthesised by reverse transcription using the QuantiTect Reverse Transcription Kit (Qiagen, UK). A total amount of 1µg of RNA was reverse transcribed as described in the manufacturer’s manual.

Firstly, a genomic DNA (gDNA) elimination step was performed by incubating the gDNA elimination reaction components (see Table 2.2) with the RNA for 2 minutes at 42°C and then placing immediately on ice.

Table 2.2 gDNA elimination reaction components.

Component Volume per reaction (µl)

gDNA Wipeout Buffer (7x) 2

Template RNA Variable (1µg)

RNase-free water Variable (make up to 14µl)

The reverse transcription master mix was prepared as summarised in Table 2.3. This mix (6µl) was added to the template RNA (14µl from the gDNA elimination reaction) to produce a total volume of 20µl of cDNA.

Table 2.3 Reverse transcription reaction components.

Component Volume per reaction (μl)

Quantiscript Reverse Transcriptase 1

Quantiscript RT Buffer (5x) 4

RT Primer Mix 1

Alongside the samples, two negative controls were included to determine the presence of any contaminants. These were:

 A no template control (NTC) containing all the reaction components except the template RNA, which was replaced with RNase-free water.

 A no reverse transcriptase control (RTC) containing all the reaction components except the reverse transcriptase enzyme, which was replaced with 1µl of water.

The tubes were mixed and incubated for 30 minutes at 42°C followed by 3 minutes at 95°C to inactivate the Quantiscript Reverse Transcriptase. All incubation steps were performed using the Sensoquest lab cycler (Göttingen, Germany). The cDNA was stored at -20°C. Prior to running the qPCR analyses, the cDNA was diluted 10x with RNase-free water to a total volume of 200µl.

2.2.1.3 Gene expression analysis

The expression of WNT pathway-related genes was quantified by qPCR using the Applied Biosystems® StepOnePlus™ System. All samples, including RTC and NTC controls were run in duplicate on a 96-well plate.

Assay validation was performed for the designed primers prior to analysing the samples by producing standard curves from serial dilution experiments and determining the amplification efficiency (Figure 2.3). For all qPCR reactions described in this thesis, data collection was performed during the extension stage of the 3-step cycling and melting curve analysis of the PCR products was performed following the cycling program to verify the specificity of the reactions (Figure 2.4).

A total of 12 WNT pathway-related genes were selected to be quantified by qPCR in the intervention study and in participants at differential risk of CRC. The process used for the selection of these genes is described in section 3.3. Figure 2.3 qPCR standard curve analysis of CTNNB1.

2.2.1.3.1 Quantification of CCND1, c-MYC and SFRP1

Quantification of CCND1, c-MYC and SFRP1, alongside the two reference genes 18S and B2M, was performed using primers designed and optimised by Dr. Nigel Belshaw and Dr. Wing Leung (IFR, Norwich) (Table 2.4).

Table 2.4 Primer sequences for quantification of CCND1, c-MYC and

SFRP1 by qPCR.

Gene Forward primer sequence Reverse primer sequence

18S GGCTCATTAAATCAGTTATG GTTCCT GTATTAGCTCTAGAATTACCA CAGTTATCC B2M AAAGATGAGTATGCCTGCCG T ACTTAACTATCTTGGGCTGT GACAA CCND1 TTGTACCTGTAGGACTCTCA TTCG ACAGCACTGTGAGCTGGCT

c-MYC AGATCCGGAGCGAATAGGG GTCCTTGCTCGGGTGTTGTA

SFRP1 TGGTGTGGATCTATTGGCTG TCACTTTCTGGGCTTGACCT

A qPCR master mix was prepared as defined in Table 2.5. A 7µl volume of master mix was dispensed into each well of a 96-well plate followed by 3µl of the respective cDNA to produce a 10µl total reaction volume. The plates were sealed, centrifuged at 1,000rpm for 1 minute and then placed in the real-time cycler to commence the cycling program as described in Table 2.6.

Table 2.5 qPCR master mix components for quantification of CCND1, c-

MYC and SFRP1.

Component Volume per reaction (µl)

ImmoMix™ (2x) (Bioline, UK) 5.00

MgCl2 (50mm) (Bioline, UK) 0.10

BSA (10mg/ml) (Ambion, UK) 1.00

ROX Reference Dye (50x) (Invitrogen, UK) 0.20

SYBR Green (100x) (Invitrogen, UK) 0.06

RNase-free water 0.60

Forward primer (100µM) 0.02

Reverse primer (100µM) 0.02

Table 2.6 Cycling programme used for quantification of CCND1, c-MYC and SFRP1 using the Applied Biosystems® StepOnePlus™ System.

Step Time Temperature Number of

cycles PCR initial

activation step 10 minutes 95°C 1

3-step cycling: Denaturation Annealing Extension 30 seconds 30 seconds 30 seconds 95°C 60°C 72°C 40 Data collection

2.2.1.3.2 Quantification of APC, AXIN2, CTNNB1, FOSL1, GSK3β, c-JUN,

SFRP2, WNT5A and WNT11

Quantification of APC, AXIN2, CTNNB1, FOSL1, GSK3β, c-JUN, SFRP2,

WNT5A and WNT11 alongside the two reference genes 18S and 2M was

performed using the QuantiTect® SYBR® Green PCR Kit (Qiagen, UK) and the QuantiTect® Primer Assays (please see Table 2.7). Lyophilised QuantiTect® Primer Assays were reconstituted in 1.1ml Tris EDTA (TE), pH 8.0 and kept at - 20°C.

Table 2.7 QuantiTect® Primer Assays for quantification of WNT pathway- related gene expression by qPCR.

Gene QuantiTect® Primer Assay name

18S Hs_RRN18S_1_SG 2M Hs_B2M_1_SG APC Hs_APC_2_SG AXIN2 Hs_AXIN2_1_SG CTNNB1 Hs_CTNNB1_1_SG FOSL1 Hs_FOSL1_1_SF GSK3β Hs_GSK3B_1_SG c-JUN Hs_JUN_1_SG SFRP2 Hs_SFRP2_1_SG WNT5A Hs_WNT5A_1_SG WNT11 Hs_WNT11_1_SG

A qPCR master mix was prepared as defined in Table 2.8 and 15µl of master mix were dispensed into each well of a 96-well plate followed by 5µl of the respective cDNA to produce a 20µl total reaction volume. The plates were sealed, centrifuged at 1,000rpm for 1 minute and then placed in the real-time cycler to commence the cycling program as described in Table 2.9.

Table 2.8 Reaction components for gene expression analyses using QuantiTect primer assays by qPCR.

Component Volume per reaction

(µl)

QuantiTect SYBR Green PCR Master Mix (2x) 10

QuantiTect Primer Assay (10x) 4

RNase-free water 1

Table 2.9 Cycling conditions for gene expression analyses using QuantiTect primer assays by qPCR.

Step Time Temperature Number of

cycles PCR initial

activation step 15 minutes 95°C 1

3-step cycling: Denaturation Annealing Extension 15 seconds 30 seconds 30 seconds 94°C 55°C 72°C 40 Data collection

2.2.1.4 Gene expression data processing

Prior to analysis of the qPCR data, the melt curves were checked for a single peak as multiple peaks can be indicators of lack of specificity or the formation of primer-dimers. A constant threshold value was set for each gene separately for all samples as described in Table 2.10. This was calculated by taking the average of the set thresholds for each gene for every plate.

Table 2.10 Set thresholds for gene expression analyses.

Gene Set Threshold

18S 1.451 β2M 1.384 APC 1.336 AXIN2 1.804 CCND1 2.066 c-MYC 1.800 CTNNB1 1.706 FOSL1 0.960 GSK3β 1.820 c-JUN 1.748 SFRP1 2.060 SFRP2 1.481 WNT5A 1.805 WNT11 1.272

Two reference genes were quantified on each plate alongside the target genes for each sample. The geometric mean of 18S and β2M housekeeping genes was calculated for each sample and used for the normalisation of the expression of each gene as described by Vandesompele et al. (Vandesompele

et al., 2002).

The delta Ct (∆Ct) value was calculated for each gene for each sample by subtracting the mean Ct value of the geometric mean of the reference genes from the mean Ct value of duplicates for the gene of interest:

∆Ct = Ct (target gene) – Ct (geometric mean of 18S and β2M)

The relative copies for each gene were then calculated using the formula: Relative copies = 2-∆Ct

The adjusted copies were calculated by multiplying the relative copies by a constant factor, in this case 10,000.

Adjusted copies = relative copies x 10,000

The standard deviation (SD) was calculated for each gene for each sample and any samples with SD >0.5 were repeated or excluded from statistical analysis.