MicroRNA expression analyses

2.2.2.1 Total RNA including miRNA extraction from rectal mucosal biopsies

Total RNA was extracted using Qiagen’s miRNeasy Mini Kit (Qiagen, UK) following the manufacturer’s instructions. OCT-embedded samples were removed from storage at -80°C. Whole biopsies were cut in half using a new, sterile scalpel blade for each sample and RNA was extracted from half a biopsy. The remaining half not used was immediately placed back into its tube and returned to storage at -80°C. Tissue disruption and homogenisation were performed using glass beads (VWR, UK) followed by QiaShredders (Qiagen, UK). Tissue was disrupted in 2ml tubes containing five 3mm glass beads and 700µl QIAzol Lysis Reagent and shaken for 1 minute using an amalgamator. The lysate and beads were poured into the QiaShredder column and centrifuged for 2 minutes at maximum speed. The homogenate was left at room temperature for 5 minutes to promote dissociation of nucleoprotein complexes. A 140µl volume of chloroform (Sigma-Aldrich) was added to the homogenate and shaken vigorously for 15 seconds using the amalgamator. After incubation at room temperature for 2 minutes, the sample was centrifuged for 15 minutes at 12,000g at 4°C. The upper aqueous phase, approximately 330µl in volume, was transferred to a new 2ml collection tube and 495µl of 100% RNase-free ethanol were added and mixed thoroughly. Up to 700µl of the sample were pipetted into a RNeasy Mini spin column in a 2ml collection tube and centrifuged at 10,000rpm for 15 seconds at room temperature. The flow-through was discarded and the step was repeated with the remainder of the sample. The spin column membrane was washed with 700µl of Buffer RWT and centrifuged at 10,000rpm for 15 seconds. The flow-through was discarded and 500µl Buffer RPE were added to the column. The tube was centrifuged at 10,000rpm for 15 seconds at room temperature to wash the column and the flow-through was discarded. Another 500µl of Buffer RPE was added and centrifuged at 10,000 rpm for 2 minutes at room temperature to dry the column membrane and ensure that no ethanol was carried over during the elution step. A final centrifugation step was performed in a new 2ml collection tube at maximum speed for 1 minute to eliminate any possible carryover of Buffer RPE.

The RNeasy Mini spin column was then transferred to a new 1.5ml tube and 30µl of RNase-free water were pipetted directly onto the column membrane. The tube was centrifuged at 10,000rpm for 1 minute at room temperature to elute the RNA.

2.2.2.2 cDNA synthesis

cDNA was synthesised from 0.8µg of RNA using the miScript II RT Kit (Qiagen) as described in the manufacturer’s manual. The miScript HiSpec Buffer (5x) was used during reverse transcription to enable subsequent quantification of mature miRNAs.

The reverse transcription master mix was prepared as described in Table 2.11 and template RNA (variable volumes, equal to 0.8µg) was added to the respective tubes.

Table 2.11 miScript II RT Kit reverse transcription master mix.

Component Volume per reaction (µl)

miScript HiSpec Buffer (5x) 4

miScript Nucleics Mix (10x) 2

miScript Reverse Transcriptase Mix 2

RNase-free water Variable

Alongside the samples, two negative controls were included to determine the presence of any contaminants. These were:

1. A NTC containing all the reaction components except the template RNA, which was replaced with RNase-free water (12µl).

2. A RTC containing all the reaction components except the reverse transcriptase enzyme, which was replaced with 2µl of RNase-free water. The tubes were mixed, centrifuged briefly and incubated for 60 minutes at 37°C followed by 5 minutes at 95°C to inactivate the miScript Reverse Transcriptase Mix. All incubation steps were performed using the Sensoquest lab cycler (Göttingen, Germany). The cDNA was stored at -20°C. Prior to running the

qPCRs, the cDNA samples were diluted to a total volume of 200µl with RNase- free water.

2.2.2.3 cDNA quality control prior to profiling mature miRNAs

The miScript miRNA Quality Control (QC) PCR Array (Qiagen) was run to assess the quality of a random selection of eight cDNA samples obtained from all three participant groups prior to the analyses of the selected miRNAs by qPCR.

QuantiTect SYBR Green PCR Master Mix, miScript Universal Primer, template cDNA and RNase-free water were thawed at room temperature and mixed. A PCR master mix was prepared as described in Table 2.12 for each of the eight cDNA samples.

Table 2.12 qPCR master mix for miScript miRNA QC PCR Array.

Component Volume (µl)

QuantiTect SYBR Green PCR Master

Mix (2x) 175

RNase-free water 135

miScript Universal Primer (10x) 35

Template cDNA 5

The miScript miRNA QC PCR Array was carefully removed from storage at - 80°C and 25µl of master mix were dispensed into the respective wells. The plate was sealed and centrifuged for 1 minute at 1,000rpm at room temperature. The real-time cycler was programmed and run as described in Table 2.13.

Table 2.13 Cycling programme used to quantify miRNAs using the Applied Biosystems® StepOnePlus™ System.

Step Time Temperature Number of cycles

PCR initial

activation step 15 minutes 95°C 1

3-step cycling: Denaturation Annealing Extension 15 seconds 30 seconds 30 seconds 94°C 55°C 70°C 40 Data collection 2.2.2.4 miRNA quantification by qPCR

Quantification of the selected miRNAs and two reference controls, the small nucleolar RNA (snoRNA) SNORD68 and the small nuclear RNA (snRNA)

RNU6, were performed using the miScript SYBR® Green PCR Kit (Qiagen, UK)

and the miScript Primer Assays (please see Table 2.14 and Table 2.15). Lyophilised miScript Primer Assays were reconstituted in 550µl TE Buffer, pH 8.0 and kept at -20°C.

Table 2.14 Primer assays used for quantification of selected miRNAs for Intervention participants.

miRNA miScript Primer

Assay Mature miRNA sequence

SNORD68

control Hs_SNORD68_11 RNU6 control Hs_RNU6-2_11

miR-17 Hs_miR-17_2 5' CAAAGUGCUUACAGUGCAGGUAG

miR-19a Hs_miR-19a_1 5' UGUGCAAAUCUAUGCAAAACUGA

miR-19b Hs_miR-19b_2 5' UGUGCAAAUCCAUGCAAAACUGA

miR-20a Hs_miR-20a_1 5' UAAAGUGCUUAUAGUGCAGGUAG

miR-25 Hs_miR-25_1 5' CAUUGCACUUGUCUCGGUCUGA

miR-93 Hs_miR-93_1 5' CAAAGUGCUGUUCGUGCAGGUAG

miR-106b Hs_miR-106b_1 5' UAAAGUGCUGACAGUGCAGAU

miR-424 Hs_miR-424_1 5' CAGCAGCAAUUCAUGUUUUGAA Table 2.15 Primer assays used for quantification of selected miRNAs in participants at differential risk of CRC.

miRNA miScript Primer

Assay Mature miRNA sequence

miR-101 Hs_miR-101_3 5' UACAGUACUGUGAUAACUGAA

miR-122a Hs_miR-122a_1 5' UGGAGUGUGACAAUGGUGUUUG

miR-135b Hs_miR-135b_1 5' UAUGGCUUUUCAUUCCUAUGUGA

miR-145 Hs_miR-145_1 5' GUCCAGUUUUCCCAGGAAUCCCU

miR-335 Hs_miR-335_1 5' UCAAGAGCAAUAACGAAAAAUGU

A qPCR master mix was prepared as defined in Table 2.16 and 18µl of master mix were dispensed into each well of a 96-well plate followed by 2µl of the respective cDNA to produce a 20µl total reaction volume. The plates were sealed, centrifuged at 1,000 rpm for 1 minute at room temperature and then placed in the real-time cycler to commence the cycling program as described in Table 2.13.

Table 2.16 Reaction components for miRNA expression analyses by qPCR.

Component Volume per reaction

(µl)

QuantiTect SYBR Green PCR Master Mix (2x) 10

RNase-free water 4

miScript Universal Primer (10x) 2

miScript Primer Assay (10x) 2

2.2.2.5 miRNA expression data processing

Prior to analysis of the qPCR data, the melt curves were checked for a single peak as multiple peaks can be indicators of lack of specificity or the formation of primer dimers (Figure 2.5). A constant threshold value was set for each miRNA separately for all of the samples as described in Table 2.17 (for the miRNAs selected for intervention analyses) and in Table 2.18 (for the miRNAs selected for analysis in participants at differential risk of CRC). This was calculated by taking the average of the set thresholds for each miRNA for every plate.

Table 2.17 Set thresholds for analyses of miRNAs selected for quantification in intervention participants.

miRNA Set Threshold

RNU6 1.72 SNORD68 1.11 miR-17 1.74 miR-19a 1.23 miR-19b 1.31 miR-20a 1.50 miR-25 1.83 miR-93 1.81 miR-106b 1.64 miR-424 1.91

Table 2.18 Set thresholds for analyses of miRNAs selected for quantification in participants at differential risk of CRC.

miRNA Set Threshold

RNU6 1.72 SNORD68 1.11 miR-101 2.11 miR-122a 1.40 miR-135 1.19 miR-145 2.05 miR-335 1.26

Two control RNAs, RNU6 and SNORD68, were quantified for each sample alongside the target miRNAs. The geometric means of RNU6 and SNORD68 controls were calculated and used for the normalisation of the expression of each miRNA.

The delta Ct (∆Ct) value was calculated for each miRNA for each sample by subtracting the geometric mean of the control RNAs from the mean Ct value of duplicates for the target miRNA:

∆Ct = Ct (target miRNA) – Ct (geometric mean of RNU6 and SNORD68) The relative copies for each miRNA were then calculated using the formula: Relative copies = 2-∆Ct

The adjusted copies were calculated by multiplying the relative copies by a factor, in this case 1,000.

Adjusted copies = relative copies x 1,000

The standard deviation for the duplicates was calculated and any samples with a standard deviation >0.5 were repeated or excluded from statistical analysis.