Materials

2.2.1 Microorganisms

Saccharomyces cerevisiae was originally obtained in block form (Pike and Sons) and suspended in Ringers' solution. Escherichia coli strain NCIMB 8 6 was a gift

from Warren Spring Laboratory. Transketolase E. coli strain JM107 containing plasmid pQR 701 was obtained from John Ward, Biochemistry Dept., UCL.

2.2.2 Media and Chemicals

i.) Agar

Tryptone soya agar (Oxoid) 40g.L"l

Malt extract agar (Oxoid) SOg.L'^

Nutrient agar, containing:

Nutrient broth N^ 2 (Oxoid) 25g.L" 1

Bacto-Agar (Difco) 20g.L"l

These were prepared using RO water and autoclaved at 121°C for 15 minutes. Sterile filtered (0.2pm pore size) kanamycin (Sigma) was added to the autoclaved nutrient agar at a concentration of 20mg.L"l.

ii.) Broths

Tryptone soya broth (Oxoid) 30g.L"l

Malt extract broth (Oxoid) 20g.L'l

Nutrient broth N<^2 (Oxoid) 25g.L"^

These were prepared using RO water and autoclaved at 121^0 for 15 minutes. Sterile filtered (0.2pm pore size) kanamycin was added to the autoclaved nutrient broth at a concentration of lOmg.L'^.

Luria Broth, containing:

Tryptone (Oxoid) lOg.L"!

Yeast extract (Oxoid) 5g.L"l

NaCl (AnalaR, BDH) 5g.L' 1

Chapter Two: Methods and Materials

This was prepared using RO water and autoclaved at 121®C for 20 minutes.

YEP Broth, containing:

Y east extract (Oxoid) 1 Og.L" ^

Peptone (Oxoid) 20g.L"l

Glucose (BDH) 20g.L"l

The yeast extract and peptone were autoclaved together at 121^0 for 20 minutes in the fermenter pot. The glucose solution was prepared and autoclaved separately at

1 2 1 ^ 0 for 2 0 minutes.

iii.) Chemicals

Thiosulphate Ringers' solution (Oxoid) 2 tablets.L'l. This was prepared using RO water and sterilised at 121°C for 20 minutes.

3M Sodium hydroxide solution (prepared using pellets from BDH) was prepared using RO water and autoclaved at 121^0 for 20 minutes. This alkali was used for fermentation pH control.

2.5M Sulphuric acid (BDH) was autoclaved at 121°C and also used for fermentation pH control.

iv.) Reagents for the Polymerase Chain Reaction (PCR)

The experiments carried out using the reagents listed here are described in sections 3.7, 4.2.3 and 4.3.2.

Deoxynucleotide triphosphates (dNTPs) (Pharmacia):

This is a ultra pure (pH 7.76) mixture of deoxyadenosine triphosphate, deoxythymidine triphosphate, deoxyguanosine triphosphate and deoxycytidine triphosphate. These were stored at -20®C as a stock solution of concentration 100 mM in sterile distilled water. They were used at a concentration of 1.25 pM o f each in the reaction.

AmpllTaq DNA polymerase (Applied Biosystems):

This enzyme catalyses the extension of DNA molecules. It was stored at -20^C at a concentration of 5 x lO^.mL'l.

Chapter Two: Methods and Materials

Primers (Molecular Medicine Unit, Kings' College School of Medicine and Dentistry).

These were diluted from the stock solutions to a final concentration of 20 )j,M using sterile distilled water and stored at -20®C.

The primers used include:

KM 1 and KM 2, a set of primers which bind to sequences in the kanamycin resistance gene.

M l3 Forward and Reverse, a universal primer set which bind to sequences in the multiple cloning site in pUC plasmids.

L F l, the primer designed in this study to bind to the non-coding region following the cmtA gene in the pQR 700 and pQR 701 plasmids. It is designed to work in conjuction with either M l3 F or R.

Primer cmtBl bound to a site on the cmtB gene. The amplified sequence produced by cmtBl and M l3 Reverse was approximately 350 base pairs long and crossed the site of insertion of the transketolase encoded gene.

The structure of pQR 701 (the transketolase plasmid constructed by French and Ward (1992)), is shown in figure 3.10, in the next chapter.

Primer Sequences

KM l 510 5’ TGA CTC ATA CCA GGC GTG AA 3* 529

KM2 1592 5' TAG AAG GGG TGT TAT GAG CC 3' 1573

M13 forward 5* G TAA AAC GAC GGC CAG 3'

M13 reverse 5* CAG GAA ACA GCT ATG AC 3'

LFl 5' C G A TC G G TA A TA CA G A TC 3'

cmtB 1 5' CGTCAAAGAGTGTATTGAGG 3’

P C R Buffer I, containing:

KCl (Sigma) 500mM

Tris-HCl @ pH 8.3 (Sigma) 1 OOmM

MgCl2 (Aldrich) 15mM

Chapter Two: Methods and Materials

This was sterilised by autoclaving at 121°C for 20 minutes and stored at -20^0. This stock of lOx buffer was diluted to Ix in the reaction mixture.

PC R Buffer II, containing:

KCl 500mM

Tris-HCl (pH 8.3) lOOmM

This was sterilised by autoclaving at 121^C for 20 minutes and stored at -20®C. This stock o f lOx buffer was diluted to Ix in the reaction mixture.

TEE Buffer, containing:

Trizma base (Sigma) lOSg.L'l

Boric acid (Sigma) 55g.L"l

0.5 M EDTA @ pH 8.0 (Sigma) 7.44g.L"l

This was prepared using RO water and titrated to pH 8.2 with NaOH pellets.

V . ) Bio-Rad Protein Assay

The Bio-Rad protein assay is a dye-binding assay based on the differential colour change of a dye in response to various concentrations of protein. The absorbance maxima for an acidic solution of Coomassie Brilliant Blue G-250 shifts from 465 nm to 595 nm when binding to protein occurs (Reisner et a l, 1975). The dye reagent was diluted 1 in 5 using deionised water, and filtered through Whatman No. 1 paper. It can be stored at room temperature for up to 2 weeks.

The Bio-Rad protein standard consisted of lyophilised bovine albumin. It was reconstituted with 20 mL of distilled water, yielding a concentration o f 1.4 mg.mL"!.

2.2.3 Containment Cabinets

Bassaire Cabinet

This cabinet (manufactured by Bassaire) has a volume of 360L and is shown in figure 2.1. Air enters and leaves through opposite faces of the cabinet at a flow rate of 750L.m in'l. Both the air inlet and outlet are fan assisted high efficiency particulate air (HEPA) filters. Flow through the cabinet is laminar. There is a fan

Chapter Two: Methods and Materials

in the ceiling of the cabinet which can be used to mix the air, when the inlet and outlet fans are stopped.

Soft Film Cabinet

This cabinet (manufactured by A. C. and E. Isolation Systems, now trading as Elwyn E Roberts Isolators Ltd) has a volume of 8.37M^ and is shown in figure 2.2. It is constructed o f heavy duty PVC film suspended from a metal frame. It has a fan assisted inlet only which draws air in at 40L.min“l, and is designed to operate under a positive pressure. Although the air inlet and outlet are on opposite faces of the cabinet the air flow is not laminar.

Bioaerosol Test Chamber (BTC)

This cabinet (figure 2.3) was designed by D. Griffiths at AEA Technology and was constructed by Timart Precision. It has a volume of 2.5 and has both temperature (15-25®C) and humidity (30-90®C) controls. Air enters at the top of the cabinet at 3.6 M^.min"^ and leaves from the bottom. The air is mixed in the centre o f the cabinet by an impeller rotating at 2 RPM and is "straightened" by passing through a honeycomb layer.

Mixing fan

On O

Air in ...

(fan assisted) Laminar flow

Air out (fan assisted) 0.62 m

0.62

0.94 m