• No results found

MATERIALS AND METHODS

In document Lists in a Lighthouse (Page 89-95)

Confirmation Number: 11294858 Citation Information

MATERIALS AND METHODS

Plasmid Construction. The ORF of E. coli Grx4 was amplified from E. coli

genomic DNA by PCR using the primers shown in Table 2.1 and cloned into the BspHI

and BamHI sites of pRSFDuet-1 (Novagen) to generate pRSFDuet-1-Grx4. The ORF of E.

coli BolA or YrbA (starting from the second Met) was amplified from E. coli genomic

DNA by PCR using the primers shown in Table 2.1 and cloned into the NdeIand XhoI sites

of pRSFDuet-1 to generate pRSFDuet-1-BolA, or the NdeI and KpnI sites to generate

pRSFDuet-1-YrbA. Dual expression plasmids for Grx4-BolA or Grx4-YrbA were made as described above, where the ORF for BolA or YrbA was cloned into the pRSFDuet-1-Grx4 plasmid to create pRSFDuet-1-Grx4/BolA or pRSFDuet-1-Grx4/YrbA, respectively. Grx4, BolA, and YrbA mutants were created by site-directed mutagenesis of pRSFDuet- 1-Grx4, pRSFDuet-1-BolA, pRSFDuet-1-YrbA, pRSFDuet-1-Grx4/BolA, or pRSFDuet-

72 Table 2.1. Primers used in this study.

Primer Name Primer Sequence Enzyme

Grx4 FOR GGAAGCAAGATCATGAGCACCAC BspHI

Grx4 REV CCCGTTCGGATCCGTCAGTATTG BamHI

BolA FOR GGAGGAGATATCATATGATGATACGTGAG NdeI

BolA REV GCAACATACTCGAGAAGCGCCGAC XhoI

YrbA FOR GATGATTGAAGATCATATGGAAAATAATG NdeI

YrbA REV CATATCCGGTACCGGCGAATC KpnI

BolA(H73A) CTACCGTTGCTGCGCTGGCTCTG - BolA(C98H) CCTCTCCTCCCCATCGTGGAGCAGG - BolA(H29A) GAAAGCTATCGTGCCAATGTCCCAGC - BolA(H29C) GCTGGGACATTGCAACGATAGCTTTC - BolA(S37A) CGGCTCTGAAGCCCATTTTAAAGTTG - BolA(H38A) CGGCTCTGAAAGCGCTTTTAAAGTTG - BolA(H38C) CGGCTCTGAAAGCTGTTTTAAAGTTG - BolA(C98S) CCTCTCCTCCCTCTCGTGGAGCAGG - YrbA(S26A) CCGGCGATGGCGCCCACTTTCAGG - YrbA(H27A) CGATGGCAGCGCCTTTCAGGTTATTGC - YrbA(H27C) CGATGGCAGCTGCTTTCAGGTTATTGC - YrbA(H63A) TAACCGCATTGCTGCTGTGTCGATCAAAG - YrbA(H63C) TAACCGCATTTGTGCTGTGTCGATCAAAG - Grx4(C30S) CTGCCGAGCTCCGGTTTCTCTGCCC - Grx4(C43S) GGCGCTTGCCGCATCTGGCGAACG - Grx4(C84S) GGTCGGCGGTTCTGATATCGTG -

73

1-Grx4/YrbA (QuikChange Mutagenesis kit, Stratagene) using primers listed in Table 2.1. These experiments were performed by Adrienne C. Dlouhy and Haoran Li (C. Outten group, unpublished).

Protein Expression and Purification. Overexpression of Grx4 was performed in the E. coli BL21(DE3) strain in 1L of LB media at 30 °C shaking until the A600 = 0.6-0.8

followed by induction with 1 mM isopropyl β-D-thiogalactosidase (IPTG). The cells were

collected 18 hr after induction and resuspended in 50 mM Tris/MES, pH 8.0, 5 mM GSH, sonicated, and centrifuged to remove cell debris. The cell-free extract was loaded onto a Q Sepharose anion-exchange column (GE Helathcare) equilibrated with 50 mM Tris/MES, pH 8.0, 5 mM GSH. The protein was eluted with a 0-1 M NaCl gradient using 50 mM Tris/MES, pH 8.0, 5 mM GSH, 1 M NaCl. Fractions containing Grx4 were pooled and

(NH4)2SO4 was added to a final concentration of 1 M. The sample was loaded onto a Phenyl

Sepharose column (GE Healthcare) equilibrated with 50 mM Tris/MES, pH 8.0, 5 mM

GSH, 1 M (NH4)2SO4, 100 mM NaCl. The protein was eluted with a 1-0M (NH4)2SO4

gradient, and fractions containing Grx4 were concentrated loaded onto a HiLoad Superdex 75 gel filtration column (GE Healthcare) equilibrated with 50 mM Tris/MES, pH 8.0, 5 mM GSH, 150 mM NaCl. The purest fractions of [2Fe-2S] Grx4 homodimer and apo-Grx4 monomer, as judged by SDS-PAGE and UV-visible spectroscopy, were collected separately and concentrated with the addition of 5% (v/v) glycerol and stored at -80 °C.

All purifications were carried out under anaerobic conditions (O2 < 5 ppm) in a glovebox

(Coy Laboratory Products).

Coexpression and copurification of Grx4 with BolA or YrbA was performed with the pRSFDuet-1-Grx4/BolA or pRSFDuet-1-Grx4/YrbA expression plasmids transformed

74

into E. coli BL21(DE3), using the procedure described above for Grx4, except no GSH

was added to the purification buffers. Some purifications utilized 50 mM Tris-HCl (pH8.0) instead of 50 mM Tris/MES (pH8.0). Purification of apo-BolA and apo-YrbA was

performed as described previously for yeast apo-Fra2 (Li H et al, 2009). All Grx4, BolA,

and YrbA mutants (either alone or coexpressed) were purified using the same procedure as their WT. These experiments were performed by Adrienne C. Dlouhy and Haoran Li (C. Outten group, unpublished).

Biochemical Analyses. Protein concentrations were determined by the Bradford Assay (Bio-Rad) using bovine serum albumin as the standard. Iron concentrations

were determined using the colorimetric ferrozine assay (Riemer et al, 2004). Acid-labile

sulfur concentrations were determined using published methods (Beinert, 1983; Broderick

et al, 2000). For GSH measurements, the purified Fe-S protein complexes were denatured and precipitated with 1% 5-sulfosalicylic acid, and GSH in the supernatant was measured by the 5, 5’-dithiobis(2-nitrobenzoic acid) -GSSG reductase cycling assay as described previously (Outten and Culotta, 2004). GRX oxidoreductase activity was measured using a fresh mixture of 1 mM GSH, 0.4 mM NADPH, 2mM EDTA, 0.1 mg/mL BSA, and 6 μg/mL yeast GSSG reductase in 100 mM Tris-HCl, pH 8.0. HED was added to a final concentration of 0.7 mM to 260 μL of this mixture. After 2 minutes, glutaredoxin was

added, or buffer to a reference, and the decrease in A340 was monitored for 2 min at 15 sec

intervals, with human Grx2 as a control (Holmgren and Aslund, 1995).

Analytical and Spectroscopic Methods. Analytical gel filtration analyses were performed on a Superdex 75 10/300 GL column (GE Healthcare) equilibrated with 50 mM Tris/MES, pH 8.0, 150 mM NaCl, 5 mM GSH and calibrated with the low molecular

75

weight gel filtration kit (GE Healthcare) as described previously for the yeast Grx3-Fra2

complexes (Li H et al, 2009). Mass spectrometry analysis of purified proteins was

determined using a Bruker UltraFlex MALDI-TOF/TOF mass spectrometer. A saturated solution of sinapinic acid in 50% acetonitrile and 0.1% trifluoroacetic acid was used as the matrix. These experiments were performed by Adrienne C. Dlouhy and Haoran Li (C. Outten group, unpublished).

UV-visible absorption spectra were recorded using a Beckman DU-800 spectrophotometer. CD spectra were recorded under anaerobic conditions on identical samples using a Jasco J-715 or J-800 spectropolarimeter (Jasco, Easton, MD). X-band EPR spectra were recorded using either a ESP-300D spectrometer (~9.6 GHz, Bruker, Billerica, MA), or a Bruker EMX plus spectrometer (~9.4 GHz, Bruker, Billerica, MA) equipped with an ESR900 continuous flow cryostat (Oxford Instruments, Concord, MA). Spectra were quantified under nonsaturating conditions by double integration against a 1.0 mM CuEDTA standard. EPR conditions: modulation frequency, 100 kHz, modulation amplitude, 1.0 mT, microwave power, 10 mW, and temperature 10-20 K.

Resonance Raman spectra were recorded as previously described (Cosper et al,

2004), using an Instruments SA Ramanor U1000 spectrometer coupled with a Coherent Sabre argon ion laser, with 20 μl frozen droplets of ~1.5-2.5 mM sample mounted on the cold finger of an Air Products Displex Model CSA-202E closed cycle refrigerator. These experiments were performed by Adrienne C. Dlouhy and Haoran Li (C. Outten group, unpublished), and M. Johnson group (UGA, unpublished).

CD-Monitored Titration of [2Fe-2S] Cluster-bound Grx4 with BolA or YrbA. The

76

under anaerobic conditions at room temperature using UV-visible CD spectroscopy. Reactions were carried out in 50 mM Tris/MES, pH 8.0, 5 mM GSH, with the [2Fe-2S] cluster concentration kept constant at 100 μM and BolA/YrbA:[2Fe-2S] ratios varying from 0 to 4. Samples were equilibrated for 5 min at room temperature after addition of BolA or YrbA prior to recording CD spectra, followed by analytical gel filtration analyses on a Superdex 75 10/300 GL column (GE Healthcare) as described above to determine the oligomerization state between Grx4 and BolA or YrbA. These experiments were performed by Adrienne C. Dlouhy and Haoran Li (C. Outten group, unpublished).

Isothermal Titration Calorimetry. Binding characteristics of the apo Grx4-BolA and Grx4-YrbA complexes were determined by ITC, using a VP-ITC titration microcalorimeter (MicroCal, Inc.). Experiments were performed at 26 °C by titrating a 1.24 mM solution of either BolA or YrbA in the syringe into a 62.1 µM solution of apo- Grx4 in the adiabatic cell, with all proteins prepared in 50 mM Tris-HCl, pH 8.0. For the BolA titration into Grx4, the initial four injections were at 2 µL, followed by four injections at 4 µL, four injections at 6 µL, and finally 25 injections at 10 µL. For the YrbA titration into Grx4, the initial injection was at 1 µL, followed by 59 additional injections at 3 µL. Data analysis was performed using the Origin Software (MicroCal) to calculate the binding stoichiometry, dissociation constant, and change in enthalpy and entropy of the titration.

CD-Monitored pH Titration of [2Fe-2S] Complexes. pH-dependent [2Fe-

2S]2+ cluster ligation changes were monitored by CD. Holo complexes of Grx4, Grx4-

YrbA and Grx4-BolA were anaerobically equilibrated in 50 mM MES buffer at a pH range of 5.5-6.7, or 50 mM Tris buffer at a pH range of 6.5-9.0 for 15 min at room temperature

77

before recording CD spectra. The [2Fe-2S] cluster concentration was kept constant at 40 μM.

Electrophoretic Mobility Shift Assay. The DNA-binding ability of BolA and YrbA protein complexes was determined using electrophoretic mobility shift assays. The DNA

probe consisted of a 360-bp region upstream of the mreB gene containing three putative

promoter regions. This region was amplified from E. coli genomic DNA using the primers

5’-CAGCCACTTGATACTAACGTG-3’ and 5’-CAACATACTAAGGGATAATCCTG- 3’ labeled with IRDye700 and the 5’-ends (Integrated DNA Technologies). Binding reactions were prepared in the dark, and consisted of hybridization buffer (20 mM Tris- HCl, pH 8, 100 mM KCl, 1 mM DTT, 5% glycerol, and 4 ng/μl sonicated salmon sperm

DNA), 1 nM IRDye-mreB oligonucleotides, and purified recombinant protein. Proteins

used were apo-BolA, apo-YrbA, [2Fe-2S] Grx4-BolA, and [2Fe-2S] Grx4-YrbA, and all were prepared in 50 mM Tris/MES, pH 8, 150 mM NaCl buffer. Once the protein was added, reactions were incubated for 20 minutes in the dark. A 5% polyacrylamide non- denaturing gel containing Tris-borate-EDTA (TBE) was pre-electrophoresed in 0.5x TBE buffer until the current was stable. The binding reactions were then applied to the equilibrated gel and electrophoresed using TBE buffer for 1.5 hours at 80 V. Gels were imaged and quantified using an Odyssey Infrared Imaging System (LI-COR).

In document Lists in a Lighthouse (Page 89-95)

Related documents