• No results found

2.2.1 Oligonucleotides, compounds and buffer

The unlabeled and 5‟-biotin labeled oligonucleotides Tel22, d[AGGG(TTAGGG)3];

Tel24, d[TTGGG(TTAGGG)3A]; Tel26, d[AAAGGG(TTAGGG)3AA]; c-myc,

d[T(AGGGTGGGG)2AA]; U6U7, d[TTAGGGUUAGGG]; d[TGGGGT]; ODN9,

Dickerson, d[CGAATTCGTTTTCGAATTCG] were purchased from The Midland Certified Reagent Company or Integrated DNA Technologies with HPLC purification and mass spectrometry characterization. NMR analysis performed on these sequences further confirmed the purity of these sequences. The concentration of oligonucleotides was determined from absorbance at 260 nm using molar extinction coefficient obtained from nearest-neighbor principle. F1190 was purchased from Life Chemicals. Thiazole Orange and TMPyP4 were purchased from Mid-Century Chemicals. The synthesis of DB832 will be described elsewhere. A 1 mM stock solution of each compound was prepared in double deionized water and in deuterated water for NMR experiments. This stock solution was diluted to required concentrations with appropriate buffer right before their usage.

2.2.2 Circular Dichroism Studies

All CD experiments were performed at 25 °C in 10 mM K2HPO4 buffer containing 80

mM KCl and 1 mM EDTA. CD spectra were recorded using a Jasco J-810 spectrophotometer with a 1-cm pathlength quartz cell at a scan speed of 50 nm/min and response time of 1 second. Appropriate amount of compounds were sequentially titrated from the stock solution into the DNA solution in the cuvette until the desired mole ratios of compound to quadruplex were obtained. The spectra were averaged over four scans. A buffer baseline scan was collected in the same cuvette and subtracted from the average scan of each ratio. Data were processed and plotted using Kaleidagraph 4.0 software.

2.2.3 Thermal Melting Studies

Thermal denaturation studies were conducted on a Cary 300 BIO UV-visible spectrophotometer in quartz cuvettes of 1 cm pathlength. Compound-DNA solutions were prepared in low salt buffer containing 10 mM TRIS buffer (pH 7.4), 10 mM KCl and 1 mM EDTA. The absorbance of the oligonucleotides was monitored at the recommended wavelength of 295 nm for quadruplex sequences and 260 nm for duplex sequences as a function of

temperature. Several duplex and hairpin DNA oligonucleotides without compound were used as a control. Samples of compound to DNA ratios from 0:1 to 4:1 was prepared. Cuvettes were mounted in a thermal block, and the solution temperatures were monitored by a thermistor in a reference cuvette with a computer-controlled heating rate of 0.5 °C/min. Experiments were generally conducted at quadruplex concentrations in the range of 2-3 µM in TRIS buffer containing 10 mM KCl. Data were analyzed and plotted using Kaleidagraph 4.0 software.

2.2.4 Nuclear Magnetic Resonance Studies

Quadruplex DNA samples were prepared in degassed phosphate buffer containing 80 mM KCl, 10 mM K2HPO4 and 0.1 mM EDTA and reconstituted in 90% H2O:10% D2O. DSS was

employed as an internal reference. Intramolecular quadruplex concentrations were in the range of 0.1 mM to 0.3 mM unless otherwise mentioned. The final DNA samples were adjusted to pH 7.0 using 1M HCl or 1M KOH solutions. Finally, the NMR samples were heated past their transition temperature and annealed to room temperature several times before collecting the spectra. Experiments were performed on a Varian Unity 600 spectrometer. DB compounds were titrated into the quadruplex DNA with compound to DNA ratios varying from 1 to 4. Temperature-dependent 1H-spectra were recorded from 15ºC to 45ºC using jump-return and

WATERGATE methods for solvent suppression. All NMR data were processed and analyzed with a combination of VNMR (Varian Inc.) and MNova (Mestrelab Research) software.

2.2.5 Quadruplex-Fluorescence Intercalator Displacement Assay (G4-FID)

All the experiments were performed using a Varian CARY Eclipse Fluorescence Spectrophotometer in a 1 ml cuvette starting from 0.5 µM solution of pre-folded DNA mixed with 1 µM of the fluorophore thiazole orange (an excess is required to be sure that all the binding sites are occupied by the fluorophore) in 10 mM TRIS/50 mM KCl buffer at pH 7.5. The addiction of ligand was followed after 3 minutes of equilibration time and after this the fluorescence spectrum was recorded with excitation wavelength at 501 nm (thiazole orange

maximum absorbance wavelength) and scanned from 520 nm to 700 nm. The 1/30% fluorophore displacement value was then plotted as a function of the concentration of added ligand.

2.2.6 Surface Plasmon Resonance Studies

Biosensor SPR experiments were performed with a four-channel BIAcore 2000 optical biosensor system (BIAcore, Inc.) and streptavidin-coated sensor chips. All DNA samples, for either duplex- or quadruplex-binding experiments, were used as single strands to prevent dissociation in the SPR flow system. The chips were prepared for use by conditioning with a series of 1 min injections of 1 M NaCl in 50 mM NaOH followed by extensive washing with buffer. 5'-Biotinylated DNA samples (25-50 nM) in HBS buffer were immobilized on the flow cell surface by non-covalent capture as previously described [26]. Three flow cells were used to

immobilize DNA samples, and any one of the flow cell was left blank as a control. Interaction analysis was performed by using steady-state methods with multiple injections of increasing compound concentrations over the immobilized DNA surface at 25 ºC. Biosensor experiments were conducted in filtered, degassed HEPES buffer (10 mM HEPES, 100 mM KCl, 3 mM EDTA, 0.005 v/v of 10% P20 BIACORE surfactant, pH 7.3) at 25 °C. Flow cell 1 was left blank as a reference, while flow cells 2-4 were immobilized with DNA on a streptavidin-derivatized gold chip (SA chip from BIAcore) by manual injection of DNA stock solutions (flow rate of 1 µL/min) until the desired value of DNA response was obtained (350-400 RU). Compound solutions were prepared in with the running buffer by serial dilutions from stock solution. Typically, a series of different ligand concentrations (100 nM to 50 µM) were injected onto the chip (flow rate of 50 µL/min, 5-10 min) until a constant steady-state response was obtained followed by a dissociation period (buffer, 10 min). After every cycle, the chip surface was regenerated (20 s injection of 10 mM glycine solution, pH 2.0) followed by multiple buffer injections.

The instrument response (RU) in the steady-state region is proportional to the amount of bound drug and was typically determined by linear averaging over a 10-20 s or longer time span, depending on the length of the steady-state plateau. The predicted maximum response per bound compound in the steady-state region (RUmax) was determined from the DNA molecular weight, the amount of DNA on the flow cell, the compound molecular weight, and the refractive index gradient ratio of the compound and DNA, as previously described [27]. To

obtain the binding constants, the data were evaluated with different interaction models to obtain an optimal fit using BIAevaluation (BIAcore Inc.) and Kaleidagraph (Synergy Software) software for nonlinear least-squares optimization of the binding parameters:

One site: r = (K1Cfree)/(1 + K1Cfree)

Two site: r = (K1Cfree + 2K1K2Cfree2)/(1 + K1Cfree + K1K2Cfree2)

Three site: r = (K1Cfree + 2K1K2Cfree2 + 3K1K2K3Cfree3)/(1 + K1Cfree + K1K2Cfree2 +

K1K2K3Cfree3)

where K1, K2 and K3 are equilibrium constants for three types of binding sites and Cfree

is the concentration of the compound in equilibrium with the complex and is fixed by the concentration in the flow solution.

2.2.7 Isothermal Calorimetry

ITC experiments were performed with a MicroCal VP-ITC (MicroCal Inc., Northampton, MA, USA). Phosphate buffer containing 10 mM K2HPO4, 3 mM EDTA, and 80

mM KCl and pH adjusted to 7.4 was used for the ITC experiments. The compound was injected into the DNA in the sample cell in 5 µL increments. The observed heat for each injection was determined by integration of the injection peak areas with respect with time. Blank titrations were conducted by injecting the compound into the sample cell containing only buffer under the same conditions. The corrected interaction heat was determined by subtracting the blank heat from that for the compound/DNA titration.