Control of Hepatitis C Virus Replication in Mouse Liver-Derived Cells by MAVS-Dependent Production of Type I and Type III Interferons

by MAVS-Dependent Production of Type I and Type III Interferons

Anggakusuma,aAnne Frentzen,aEngin Gürlevik,bQinggong Yuan,b,cEike Steinmann,aMichael Ott,b,cPeter Staeheli,d Jonathan Schmid-Burgk,eTobias Schmidt,eVeit Hornung,eFlorian Kuehnel,bThomas Pietschmanna

Institute of Experimental Virology, Twincore Centre for Experimental and Clinical Infection Research, Hanover, Germanya

; Department of Gastroenterology, Hepatology and Endocrinology, Medical School Hanover, Germanyb

; Translational Research Group, Twincore Centre for Experimental and Clinical Infection Research, Hanover, Germanyc

; Department of Virology, University of Freiburg, Freiburg, Germanyd

; Institute for Clinical Chemistry and Clinical Pharmacology, University Hospital, University of Bonn, Bonn, Germanye

ABSTRACT

Hepatitis C virus (HCV) efficiently infects only humans and chimpanzees. Although the detailed mechanisms responsible for

this narrow species tropism remain elusive, recent evidence has shown that murine innate immune responses efficiently

sup-press HCV replication. Therefore, poor adaptation of HCV to evade and/or counteract innate immune responses may prevent

HCV replication in mice. The HCV NS3-4A protease cleaves human MAVS, a key cellular adaptor protein required for RIG-I-like

receptor (RLR)-dependent innate immune signaling. However, it is unclear if HCV interferes with mouse MAVS function

equally well. Moreover, MAVS-dependent signaling events that restrict HCV replication in mouse cells were incompletely

de-fined. Thus, we quantified the ability of HCV NS3-4A to counteract mouse and human MAVS. HCV NS3-4A similarly

dimin-ished both human and mouse MAVS-dependent signaling in human and mouse cells. Moreover, replicon-encoded protease

cleaved a similar fraction of both MAVS variants. Finally, FLAG-tagged MAVS proteins repressed HCV replication to similar

degrees. Depending on MAVS expression, HCV replication in mouse liver cells triggered not only type I but also type III IFNs,

which cooperatively repressed HCV replication. Mouse liver cells lacking both type I and III IFN receptors were refractory to

MAVS-dependent antiviral effects, indicating that the HCV-induced MAVS-dependent antiviral state depends on both type I and

III IFN receptor signaling.

IMPORTANCE

In this study, we found that HCV NS3-4A similarly diminished both human and mouse MAVS-dependent signaling in human

and mouse cells. Therefore, it is unlikely that ineffective cleavage of mouse MAVS

per se

precludes HCV propagation in

immu-nocompetent mouse liver cells. Hence, approaches to reinforce HCV replication in mouse liver cells (e.g., by expression of

essen-tial human replication cofactors) should not be thwarted by the poor ability of HCV to counteract MAVS-dependent antiviral

signaling. In addition, we show that mouse MAVS induces both type I and type III IFNs, which together control HCV

replica-tion. Characterization of type I or type III-dependent interferon-stimulated genes in these cells should help to identify key

mu-rine restriction factors that preclude HCV propagation in immunocompetent mouse liver cells.

H

epatitis C virus (HCV) infection is associated with chronic

liver disease, including hepatic steatosis, fibrosis, cirrhosis,

and hepatocellular carcinoma (

1

). Recent licensing of directly

act-ing antivirals (DAAs) has considerably improved therapeutic

op-tions, and novel drug combinations reach cure rates of more than

90% (

2

). However, natural or treatment-induced virus

elimina-tion does not prevent reinfecelimina-tion by HCV. Moreover, many of ca.

160 million infected individuals are not diagnosed, and the vast

majority of HCV patients have not been treated (

3

). Therefore,

development of a prophylactic vaccine that efficiently prevents

virus transmission is a major challenge for global control of

hep-atitis C. However, advances in HCV vaccine research are

ham-pered by a lack HCV-permissive, immunocompetent animal

models.

HCV, a plus-strand RNA virus and member of the family

Fla-viviridae

, has a narrow species tropism. Besides humans, only

chimpanzees are naturally susceptible to chronic HCV infection.

However, high costs and ethical concerns severely limit utilization

of chimpanzees for research purposes. Thus, understanding of the

mechanisms that limit HCV replication in other animals, for

in-stance, mice, is an important step to ultimately develop a robust

animal model for HCV. Encouragingly, recent advances have

highlighted key prerequisites for HCV infection of murine liver

cells. First, occludin and CD81 have been recognized to determine

HCV species tropism at the level of viral cell entry (

4

).

Impor-tantly, this blockade can be overcome by engineering mice to

ex-press human occludin and CD81 (

5

) or by adaptation of HCV to

usage of mouse CD81 (

6

). Second, HCV replication in murine

embryonic fibroblasts (

7

,

8

), in mouse liver-derived cells (

9

), and

Received27 October 2014Accepted12 January 2015

Accepted manuscript posted online21 January 2015

CitationAnggakusuma, Frentzen A, Gürlevik E, Yuan Q, Steinmann E, Ott M, Staeheli P, Hornung V, Kuehnel F, Pietschmann T. 2015. Control of hepatitis C virus replication in mouse liver-derived cells by MAVS-dependent production of type I and type III interferons. J Virol 89:3833–3845.doi:10.1128/JVI.03129-14. Editor:M. S. Diamond

Address correspondence to Thomas Pietschmann, [email protected].

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JVI.03129-14

on November 7, 2019 by guest

http://jvi.asm.org/

in mouse livers

in vivo

(

10

) is heavily impaired by innate immune

signaling, since inactivation of host molecules involved in viral

RNA sensing, innate immune signaling, or responsiveness to

in-terferons substantially increases HCV replication. Therefore,

ab-lation of distinct innate immune signaling molecules combined

with overexpression of essential human entry factors has emerged

as a valid strategy to allow HCV propagation in mouse cells

in vitro

and

in vivo

(

9

,

10

). However, this environment is only partially

immunocompetent, thus limiting utility for immunological

stud-ies. Moreover, the efficiency of HCV propagation remains modest

either because additional immune control mechanisms curtail

HCV replication or because essential human replication cofactors

are lacking.

In human cells, the HCV protease NS3-4A interferes with

in-nate immune signaling by cleaving TRIF (TIR domain-containing

adaptor-inducing beta interferon [IFN-

␤

]) (

11

) and MAVS

(mi-tochondrial antiviral signaling protein; also known as IPS-1,

VISA, or Cardif) (

12

), two critical adaptor proteins that link

cel-lular pattern recognition receptors with production of

interfer-ons. Nevertheless, viral interference in human cells is not

com-plete, as HCV infection of human liver cells triggers production of

both type I and III interferons which partially control HCV

repli-cation (

13–16

). Moreover, distinct human IFN-induced effector

proteins relevant for control of HCV replication have been

iden-tified (

17–19

). In contrast, little is known about murine

IFN-in-duced antiviral programs that limit HCV replication. Moreover,

the interferon-stimulated genes (ISGs) that establish antiviral

de-fenses against HCV replication in mouse cells are unknown.

Fi-nally, the level of interference of HCV with murine innate

im-mune signaling cascades is incompletely defined. Given the

importance of innate immunity for control of HCV replication in

both the human and murine systems, in this study, we wished to

better define the relevance of innate immune control and HCV

interference for propagation of HCV in mouse liver cells.

MATERIALS AND METHODS

Reagents.Mouse IFN-␣and IFN-␭3 were purchased from eBioscience

and R&D Systems, respectively. Boceprevir and 2=C-methyladenosine

(2=CMA) were gifts from Marc Windisch (Institute Pasteur Korea,

Seongnam, South Korea) and Tim Tellinghuisen (The Scripps Re-search Institute, FL), respectively. High-molecular-weight (HMW) poly(I·C) was purchased from InvivoGen. HCV subgenomic replicon

(HCV-SGR) RNA was generated in-house byin vitrotranscription as

described previously (9).

Cell culture and generation of cell lines.All cells were cultured in Dulbecco’s modified Eagle medium (DMEM; Invitrogen) supplemented

with 2 mML-glutamine, nonessential amino acids, 100 U/ml of penicillin,

100␮g/ml of streptomycin, and 10% fetal calf serum (FCS) at 37°C and

5% CO2. MLT-MAVS⫺/⫺and MLT-IFNAR⫺/⫺cells were generated in a

previous study (9). Stable cell lines expressing miR122 were created by

lentiviral gene transfer as described earlier (9). MLT-MAVS⫺/⫺miR122

cells with stable restoration of human MAVS (hMAVS) or mouse MAVS (mMAVS) were created through lentiviral gene transduction followed by

passaging in the presence of antibiotic pressure (5␮g/ml of blasticidin) as

described previously (9).

The generation of HEK 293T-MAVS⫺/⫺cells was done by targeting

the critical exons of the MAVS gene in 293T cells using the following

transcription activator-like effector nuclease (TALEN) target site: 5=-TT

GCTGAAGACAAGACCTAT/AAGTATATCTGCCGC/AATTTCAGCA

ATTTTTGCAA-3=. TALEN plasmids were assembled as described in

ref-erence3. HEK 293T cells were plated at a density of 2⫻104_{cells per well}

of a 96-well plate. The next day, TALEN plasmids were transfected using

GeneJuice transfection reagent (Merck Millipore) at a ratio of 1:1 (100 ng of each plasmid). Subsequently, all-allelic knockout clones were isolated. In short, 14 days after limiting dilution cloning, growing monoclones were selected by bright-field microscopy. Identified clones were trypsinized and expanded in two separate wells. One well was used to recover genomic DNA, and subsequently, the target region of interest was amplified in a two-step PCR and subjected to deep sequencing. Knockout cell clones were identified as cell clones harboring all-allelic frameshift

mutations using the OutKnocker webtool athttp://www.outknocker.org

/. To further confirm the knockout, Western blotting was performed.

Note that the faint band visible in Western blotting (seeFig. 2E) is a result of a nonspecific cross-reaction of the antibody used. This was confirmed by further Western blotting and genotyping, which verified proper knock-out of MAVS (data not shown). Genotypes of the respective knockknock-out cell lines are available upon request.

Mice. Normal C57BL/J6 and BALB/c mice were purchased from Charles River Labs. C57BL/6 mice lacking functional receptors for type I

and III IFN (20) were bred at University Medical Center Freiburg. Mouse

experiments were carried out using animals between 6 and 12 weeks of age. Mice were housed under specific-pathogen-free conditions at the Twincore animal facility, and all experiments were conducted according to institutional guidelines for animal care and use and in compliance with regulations of German animal welfare law.

In vivoimmortalization and generation of tumor cell lines.

Intrahe-patic tumors were induced in IFNAR⫺/⫺IFNLR1⫺/⫺double-knockout

mice (20) by retrograde liver transduction with oncogenic transposon

plasmids using hydrodynamic injection. For this purpose, mice received

30␮g of total plasmid DNA (8␮g of pT/KRas-G12V, 8␮g of pT3/EF1␣

-myrAkt1, 8␮g of pT3/EF1␣-shRp53, and 6␮g of pPGK-SB13). A more

detailed description of the used plasmids and plasmid construction can be

found elsewhere (9). The pPGK-SB13 plasmid for expression of Sleeping

Beauty SB13 was kindly provided by David A. Largaespada (University of Minnesota). For tumor induction, oncogenic transposon plasmids were injected into mice in 0.9% saline at a final volume of 10% of the animal’s body weight via tail vein injection within 5 s. Once tumors became palpa-ble (5 to 12 weeks postinjection), mice were sacrificed and tumors were harvested for subsequent isolation of immortalized cell lines. Isolated tu-mors were dissected and incubated for 30 min at 37°C in RPMI 1640 plus

GlutaMAX supplemented with 200␮g/ml of collagenase IA, collagenase

IV, and hyaluronidase IV, 300␮g/ml of dispase, and 50␮g/ml of DNase I

(Sigma-Aldrich). Separated cells were purified using a 40-␮m strainer,

washed once, and then cultivated in DMEM plus GlutaMAX with 10%

FCS and penicillin-streptomycin at 37°C in 5% CO₂. Cells were then

cultivated as described previously (9). Deletions of IFNAR and IFNLR1

genes were confirmed by quantitative reverse transcription-PCR (qRT-PCR).

PMH isolation.Primary mouse hepatocytes (PMHs) were isolated from BALB/cJ and/or C57BL/6J mice by a modified 2-step Liberase

per-fusion (21,22). Briefly, mice were anesthetized using ketamine (Albrecht)

and Rompun (Bayer). The body cavity was opened and a catheter was placed into the portal vein and connected to a flow pump, which pumped media prewarmed at 37°C from a water bath into the catheter. The liver was first perfused with Earle’s balanced salt solution (EBSS) (GIBCO) solution containing 0.5 mM EGTA (Sigma-Aldrich) and 10 mM HEPES buffer (Sigma). Subsequently, EBSS supplemented with 10 mM HEPES

buffer and Liberase (Roche) at 100␮g/liter was applied for enzymatic

digestion of the tissue at 37°C. After digestion for 10 to 12 min, the liver was carefully disconnected and tissue was manually disrupted with a ster-ile scissors and scalpel in DMEM (GIBCO Germany) containing 10%

FCS. The suspended hepatocytes were passed through a 100-␮m nylon

filter into 50-ml Falcon tubes. The cell suspensions were centrifuged twice at 300 rpm for 5 min at 4°C, and the cell pellet was resuspended in ice-cold DMEM containing 10% FCS (PAN Biotech). Cell viability was tested by trypan blue (Fluka).

Anggakusuma et al.

on November 7, 2019 by guest

http://jvi.asm.org/

Transient HCV luciferase replication assay.Methods for

transfec-tion of HCV-SGR RNA are described elsewhere (9). Luciferase activity of

replicating HCV-SGR was analyzed as described elsewhere (9,23).

Lentiviral pseudoparticle production.Lentiviral, HIV-based

pseu-dotypes were created essentially as described previously (9). Briefly, HEK

293T cells were transfected with envelope glycoprotein expression

con-struct pcz-VSV-G, lentiviral gag-pol expression concon-struct pCMV⌬R.74,

and lentiviral genomic backbone for the desired gene expression using a polyethyleneimine (PEI) method (Carl Roth).

Plasmids.The lentiviral plasmid pWPI-JFH1-NS3-4A-BLR encodes the NS3-4A protease of HCV strain JFH1. The lentiviral plasmids pWPI-hMAVS-BLR, pWPI-mMAVS-BLR, pWPI-HA-hMAVS-GUN, and pWPI-HA-mMAVS-GUN encode human or mouse MAVS variants with or without a hemagglutinin (HA) tag. Lentiviral plasmid pWPI-mIFNLR1-BLR encodes the mouse ortholog of a high-affinity type III IFN receptor (NM174851.3). All pWPI constructs were cloned in-house with detailed cloning strategies that are available upon request. The plasmid pTRIP-pre-miR-122-puro was described previously and given as a kind

gift from Matthew Evans (Mount Sinai School of Medicine, NY) (24). The

IFN-␤promoter reporter plasmid (pGL3b-IFN-␤promoter-Luc) was

kindly provided by Stefan Lienenklaus (HZI, Braunschweig, Germany). Western blotting.Cells were washed with phosphate-buffered saline (PBS) and lysed in RIPA buffer (0.3 M NaCl, 20 mM Tris-HCl [pH 8], 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS], and 1% Triton X-100) for 30 min on ice. Total protein content was determined by the Bradford assay. Equal protein amounts for each sample were mixed with

2⫻denaturing protein sample buffer (200 mM Tris-HCl [pH 8.8], 5 mM

EDTA, 0.1% bromophenol blue, 10% sucrose, 3.3% SDS, 2% 2-mercap-toethanol [2-ME]), heated for 5 min at 98°C, loaded onto an 11% SDS gel, and resolved by electrophoresis. Subsequently, proteins were transferred to a polyvinylidene difluoride membrane which was then blocked with 5% milk in PBS containing 0.5% Tween (PBS-T) for 1 h at room temper-ature. The membrane was then incubated with either anti-NS3337 tag (1:300), anti-HA tag (1:1,000; Covance), anti-FLAG tag (1:1,000; Sigma-Aldrich), hMAVS or mMAVS (both at 1:300; Santa Cruz),

anti-green fluorescent protein (anti-GFP, 1:1,000; Santa Cruz), or anti-␤-actin

(1:1,000; Sigma-Aldrich), followed by incubation with secondary body coupled to horseradish peroxidase (Sigma-Aldrich). Bound anti-bodies were detected with the ECL Plus detection system (GE Healthcare). Quantitative reverse transcription-PCR.Total RNA was extracted using the Nucleospin RNA II kit (Macherey-Nagel) by following the

man-ufacturer’s protocol. Subsequently, 2␮l was reverse transcribed into

cDNA using the PrimeScript First Strand cDNA synthesis kit (TaKaRa), and PCR was carried out using a 400 nM concentration of primers

to-gether with SYBR PremixEx Taq(TaKaRa) and was quantified with a

LightCycler480 (Roche). Murine glyceraldehyde-3-phosphate dehydro-genase (mGAPDH) mRNA levels were always quantified in parallel.

Prim-ers used this study are as follows: for mouse IFN-␤, CTGCGTTCCTGCT

GTGCTTCTCCA (sense) and TTCTCCGTCATCTCCATAGGGATC

(antisense) (25); for mouse IFN-␭2/3, AGCTGCAGGCCTTCAAAAAG

(sense) and TGGGAGTGAATGTGGCTCAG (antisense) (26); for mouse

GAPDH, TTCACCACCATGGAGAAGGC (sense) and GGCATCGACT

GTGGTCATGA (antisense) (25); for mouse viperin, AACCCCCGTGAG

TGTCAACTA (sense) and AACCAGCCTGTTTGAGCAGAA (antisense)

(27); for mouse ISG15, AGCAATGGCCTGGGACCTAAA (sense) and

AGCCGGCACACCAATCTT (antisense) (28); and for mouse IFIT1, CA

GAAGCACACATTGAAGAA (sense) and TGTAAGTAGCCAGAGGA

AG (antisense) (29).

Immunofluorescence.HCV replication was visualized by indirect

im-munofluorescence as described previously (23). HCV antigen-expressing

cells were detected using the mouse monoclonal NS5A-9E10 antibody (kindly provided by Charles M. Rice, Center for the Study of Hepatitis C, The Rockefeller University, NY) at a dilution of 1:1,000. Bound primary antibodies were detected using goat anti-mouse IgG-specific secondary antibodies conjugated to Alexa Fluor 488 or Alexa Fluor 546

(Sigma-Aldrich) at a dilution of 1:1,000. Nuclear DNA was stained using 4=

,6-diamidino-2-phenylindole (DAPI) at a dilution of 1:3,000.

Statistical methods.GraphPad Prism 6 software was used for data analysis using a one-way analysis of variance (ANOVA) adjusted with

Bonferroni’s multiple-comparison test.Pvalues of⬍0.05 (single asterisks

in figures) were considered statistically significant, whereasPvalues of

⬍0.01 (double asterisks) and⬍0.001 (triple asterisks) were considered

highly significant.

RESULTS

mMAVS restricts HCV replication in MLT cells.

Previously, we

have reported that HCV replicons and full-length RNAs efficiently

propagate in transfected mouse liver-derived tumor (MLT) cells

which lack endogenous expression of MAVS (MLT-MAVS

⫺/⫺

miR122 cells) (

9

). These cells therefore provide a unique

environ-ment to test the importance of mouse MAVS (mMAVS) for

re-stricting HCV replication and to explore the ability of HCV to

interfere with mMAVS function.

To this end, we confirmed the absence of endogenous mMAVS

expression in these cells and subsequently restored mMAVS

ex-pression by lentiviral gene transfer. Murine Hep56.1D cells and

human Huh-7.5 cells served as controls for specific detection of

mMAVS in our protein expression analysis (

Fig. 1A

). Parental

MLT-MAVS

⫺/⫺

miR122 cells were not responsive to transfection

of poly(I·C), a mimic of double-stranded RNA which triggers

RIG-I-like receptor (RLR [

30

])-dependent signaling via MAVS to

produce of IFN-

␤

mRNA (

Fig. 1B

). In contrast, restoration of

mMAVS expression in these cells (

Fig. 1A

) resulted in

upregula-tion of IFN-

␤

mRNA upon transfection of poly(I·C) to a level

similar to the one observed in poly(I·C)-transfected Hep56.1D

cells (

Fig. 1B

). Thus, we concluded that repair of mMAVS

expres-sion in MLT-MAVS

⫺/⫺

miR122 cells restored the sensitivity of

these cells to RLR-dependent recognition of viral double-stranded

RNA comparable to that of cells expressing endogenous levels of

mMAVS (e.g., Hep56.1D). Next, we analyzed the influence of

re-introducing mMAVS on permissiveness for HCV replication. To

this end, cells were transfected with a subgenomic JFH1 replicon

expressing luciferase or a control luciferase replicon with an

inac-tivating mutation in the viral NS5B polymerase. HCV replication

in transfected cells was monitored by luciferase assays (

Fig. 1C

)

and indirect immunofluorescence (

Fig. 1D

). As reported

previ-ously (

9

), parental MLT-MAVS

⫺/⫺

miR122 cells sustained

vigor-ous HCV RNA replication, as evidenced by rapid accumulation of

luciferase activity (

Fig. 1C

) and by detection of numerous

NS5A-expressing cells (

Fig. 1D

). In contrast, reintroduction of mMAVS

ablated HCV replication to background levels, with luciferase

ac-tivity indistinguishable from that of cells transfected with the

rep-lication-incompetent viral RNA (

Fig. 1C

) and with no

NS5A-pos-itive cells detectable (

Fig. 1D

). Therefore, repair of mMAVS

expression in MLT-MAVS

⫺/⫺

miR122 cells efficiently restored

innate immune signaling and restricted HCV RNA replication.

HCV interferes with mouse and human MAVS to similar

lev-els.

The above-described findings suggested that HCV replication

is efficiently restricted by mMAVS potentially because the HCV

NS3-4A protease fails to efficiently cleave and interfere with

mMAVS function. In turn, inefficient HCV interference with

mMAVS in mouse cells may explain why HCV is unable to

efficiently replicate in mouse cells with active innate immune

signaling.

To test these hypotheses, we compared HCV interference with

hMAVS and mMAVS. First, we stably expressed either human or

on November 7, 2019 by guest

http://jvi.asm.org/

mouse MAVS in MLT-MAVS

⫺/⫺

miR122 cells (

Fig. 2

), followed

by transient expression of the NS3-4A protease via lentiviral gene

transduction. This method was chosen to mimic the expression of

the protease in viral invasion independent of constraints on HCV

RNA replication (e.g., due to lack of HCV replication-assisting

cofactors). Both hMAVS (

Fig. 2A

) and mMAVS (

Fig. 2B

) were

partially cleaved upon transient coexpression of NS3-4A in

MLT-MAVS

⫺/⫺

miR122 cells. This is either due to incomplete

trans-duction of the cell populations with the HCV protease or due to

incomplete cleavage of overexpressed MAVS proteins under these

experimental conditions. Cleavage was specifically mediated by

the viral protease, since coexpression of GFP did not induce

cleav-age and as addition of a protease inhibitor reduced cleavcleav-age of

both hMAVS and mMAVS (

Fig. 2A

and

B

). When these cells were

transfected with poly(I·C), coexpression of the HCV NS3-4A

pro-tease clearly lowered both hMAVS- and mMAVS-dependent

production of IFN-

␤

(

Fig. 2C

and

D

). Since the extents to

which IFN-

␤

production was suppressed were comparable

be-tween NS3-4A coexpressed with hMAVS and mMAVS, we

con-clude that in this system the HCV protease interferes with the

function of these two MAVS proteins to similar levels. To

ex-clude that species-specific signaling activity of hMAVS in

mouse cells may mask differential HCV interference, we

con-ducted principally similar cotransfection experiments with

hu-man HEK 293T cells, which upon transcription activator-like

effector nuclease (TALEN)-mediated knockout of hMAVS lack

endogenous expression of the adaptor protein (

Fig. 3A

). Like in

the mouse cells, we noted HCV NS3-4A-dependent cleavage of

both MAVS species (

Fig. 3A

and

B

). The appearance of partial

cleavage of MAVS was mainly caused by the cotransfection

FIG 1mMAVS suppresses HCV replication in transfected mouse liver-derived tumor (MLT) cells. (A) Detection of mMAVS and hMAVS proteins in given

human and murine cell lines using MAVS-specific antibodies. Detection of␤-actin expression was used as a loading control. (B) Responsiveness of

MLT-MAVS⫺/⫺_{miR122 cells with or without mMAVS expression to transfection of poly(I·C). Hep56.1D mouse cells expressing endogenous levels of mMAVS served}

as a control. A day after seeding, the indicated cells were either left untreated, mock transfected, or transfected with 10␮g/ml of poly(I·C). Four hours later, total

cellular RNA was collected and the expression of mIFN-_␤mRNA was determined by RT-PCR. Expression of IFN-_␤mRNA was normalized to endogenous levels

of mGAPDH and is given relative to the basal expression in Hep56.1D cells. Asterisks show a significant difference between the indicated data. (C) Transient

replication of HCV-JFH1 subgenomic replicon with luciferase reporter with an active NS5B polymerase (HCV-SGR) or a_⌬GDD polymerase mutant [HCV-SGR

(⫺) Polymerase] in given cell lines. Transfected cells were harvested at the indicated time points, and HCV RNA replication was determined by luciferase assays. RLU, relative light units; h.p.t, hours posttransfection. (D) Detection of HCV NS5A expression (red) in transfected cells by indirect immunofluorescence (IF)

analysis 48 h posttransfection. Nuclei were stained with DAPI (blue). All graph data are shown as mean values⫾SDs from three independent experiments, and

images are representative of three individual experiments.

Anggakusuma et al.

on November 7, 2019 by guest

http://jvi.asm.org/

[image:4.585.125.465.64.436.2]

efficiency issue, as not all cells were equally transfected with

equal amounts and ratios of plasmids. Finally, using an IFN-

␤

promoter-dependent luciferase reporter plasmid, we observed

5- to 10-fold-greater suppression of poly(I·C)-dependent IFN-

␤

promoter activity by expression of the NS3-4A protease in the case

of mMAVS than with hMAVS (

Fig. 3C

and

D

). Collectively, these

results indicate that the HCV NS3-4A protease cleaves and

inter-feres with the function of both mMAVS and hMAVS in human

and mouse cells. Moreover, interference with the murine MAVS

ortholog was not inferior to that with the human MAVS protein.

To investigate whether NS3-4A expressed from an

autono-mously replicating HCV RNA is sufficient to overcome restriction

by hMAVS or mMAVS in MLT-MAVS

⫺/⫺

miR122 cells, we

trans-fected a subgenomic HCV luciferase replicon into parental

MLT-MAVS

⫺/⫺

miR122 cells or derivative cell lines stably expressing

these MAVS variants. Irrespective of whether hMAVS or mMAVS

was present, luciferase activity did not rise over the background

level defined by the replication-inactive replicon mutant (

Fig. 4A

).

In parallel, only very inefficient cleavage of both MAVS variants

was observed (

Fig. 4B

), which likely results from initial

produc-tion of viral protease translated from the input of transfected viral

RNA. Taken together, these results indicate that HCV replication

was suppressed to background levels in cells overexpressing either

hMAVS or mMAVS.

Considering that overexpression of MAVS may preactivate

cellular innate immune responses prior to transfection, thus

ablating HCV replication, we chose an alternative

experimen-tal setting: MAVS proteins were introduced into

MLT-MAVS

⫺/⫺

miR122 cells engineered to express a replicating

HCV luciferase replicon (

Fig. 4C

). In these experiments, the

degree of MAVS overexpression was modulated by serially

di-luting the lentiviral stocks used for transduction of MAVS

pro-teins (

Fig. 4D

). Interestingly, both mMAVS and hMAVS

re-stricted HCV replication in a dose-dependent fashion (

Fig.

4E

), as evidenced by ca. 85% reduction of luciferase activity at

the highest dose of MAVS expression compared with the

expression of GFP. Notably, the two MAVS proteins were

over-expressed to similar levels, as was evident from our protein

expression analysis utilizing FLAG-specific antibodies to detect

the FLAG-tagged hMAVS and mMAVS proteins transfected in

these experiments (

Fig. 4D

). Congruently, transfection of

wild-type, untagged hMAVS and mMAVS proteins resulted in

com-parable and dose-dependent repression of HCV replication in

MLT-MAVS

⫺/⫺

miR122 replicon cells (data not shown).

Fi-nally, FLAG-tagged hMAVS and mMAVS variants that are

re-sistant to cleavage by the HCV NS3-4A protease due to

muta-tion of the cleavage site exerted a further increased repression

on HCV replication compared to that with the parental MAVS

FIG 2Comparison HCV NS3-4A-dependent cleavage of and interference with hMAVS and mMAVS in mouse cells. (A and B) Human (A) or mouse (B) MAVS

was expressed in MLT-MAVS⫺/⫺_{miR122 cells in the presence or absence of GFP or the HCV NS3-4A protease. Expression of proteins was monitored by Western}

blotting using GFP-, actin-, mMAVS-, or hMAVS-specific antibodies. One day after lentiviral gene transduction, the medium was changed and the indicated cells were treated with addition of 10␮M boceprevir, a protease inhibitor (P.I). Twenty-four hours later, the cells were lysed for specific Western blot analysis. The

cleaved (⌬) products of hMAVS and mMAVS are indicated, and␤-actin expression was used as a loading control. Images are representative of two individual

experiments. (C and D) Effect of HCV NS3-4A protease expression on human (C) or mouse (D) MAVS-dependent type I IFN induction. One day after the cells were transduced, the cells were either mock transfected or transfected with 10␮g/ml of poly(I·C). Four hours later, total RNA was extracted and the relative levels

of mIFN-␤mRNA expression were determined by qRT-PCR. Data were normalized to the mGAPDH mRNA data. Asterisks show a significant difference

between the indicated data. Mean values⫾SDs from three independent experiments are given.

on November 7, 2019 by guest

http://jvi.asm.org/

[image:5.585.136.455.65.360.2]

proteins that are susceptible to cleavage by HCV (ca. 3-fold)

(

Fig. 4E

). These results indicate that the ability of HCV to

cleave MAVS facilitates HCV replication. Furthermore, since

the degrees of restriction exerted by parental MAVS and the

cleavage-resistant MAVS variant were in each case

indistin-guishable between the human and the mouse orthologs, we

conclude that HCV is capable of interfering with mouse MAVS

to a level similar to that of the human variant. As a

conse-quence, it is unlikely that inefficient viral cleavage of mouse

MAVS is the critical limitation that prevents HCV from

prop-agating in mouse liver cells with intact innate immune

sig-naling.

HCV replication in mouse liver tumor cells elicits

produc-tion of both type I and III IFNs in a MAVS-dependent fashion.

Next, we dissected the mMAVS-regulated downstream

signal-ing events responsible for limitsignal-ing HCV replication in mouse

cells. To this end, we first explored which type of IFN is

pro-duced upon administration of poly(I·C) or after transfection of

HCV RNA. Using mIFN-

␤

(type I IFN)-specific and mIFN-

␭

(type III IFN)-specific mRNA detection systems, we observed

that both types of IFNs were vigorously upregulated upon

ex-tracellular addition or transfection of poly(I·C) to primary

mouse hepatocytes (

Fig. 5A

). In the case of MLT-MAVS

⫺/⫺

miR122 cells, repair of mMAVS expression led to rapid and

strong induction of mIFN-

␤

and mIFN-

␭

mRNA upon

trans-fection of poly(I·C) (

Fig. 5B

). Likewise, transfection of HCV

replicon RNA also induced both types of IFNs (

Fig. 5B

),

indi-cating that HCV replication in MLT-MAVS

⫺/⫺

miR122 elicits

type I and III IFN production in a mMAVS-dependent

fashion.

FIG 3Comparison HCV NS3-4A-dependent cleavage of and interference with hMAVS and mMAVS in human cells. (A and B) Appearance of human (A) or

mouse (B) MAVS expression in the presence of HCV protease in human HEK 293T-MAVS⫺/⫺_{miR122 cells. The cells were reverse transfected with reporter}

plasmids (100 ng) together with vector expressing each indicated gene (100 ng). A day after transfection, the medium was changed and the indicated cells were treated with addition of 10_␮M boceprevir, a protease inhibitor (P.I). Twenty-four hours later, the cells were lysed and specific Western blotting detection using

the indicated antibodies was performed. The cleaved (⌬) products of hMAVS and mMAVS are indicated, and␤-actin expression was used as a loading control.

Images are representative of two individual experiments. (C and D) Effect of HCV protease presence on human (C) or mouse (D) MAVS-dependent IFN-_␤

promoter regulation. HEK 293T-MAVS⫺/⫺_{miR122 cells were reverse transfected with reporter plasmids (100 ng) together with the each indicated expression}

vector (100 ng). A day after the cells were reverse transfected, the medium was changed and the indicated cells were transfected with either water (mock) or 10

␮g/ml of poly(I·C) for 4 h. After that, the cells were treated with addition of water or 10␮M P.I. The cells were then lysed and assayed for luciferase activities 24 h later. Values were then normalized to those for MAVS-GFP-transfected cells. Asterisks show a significant difference between the indicated data. All graph data

are shown as mean values⫾SDs from three independent experiments, and Western blotting images are representative of two individual experiments.

Anggakusuma et al.

on November 7, 2019 by guest

http://jvi.asm.org/

[image:6.585.113.472.67.423.2]

FIG 4Control of HCV replication in mouse liver cells by human and mouse MAVS. (A) Replication of HCV in in MLT-MAVS⫺/⫺_{miR122 cells stably expressing}

hMAVS or mMAVS. Luciferase replicon RNA was transfected into the given cell lines and RNA replication was determined at the given time points by way of

luciferase assays. A replicon with inactive polymerase transfected into MLT-MAVS⫺/⫺_{miR122 cells served as a control. (B) Cleavage of hMAVS and mMAVS by}

replicon-encoded NS3-4A protease. MAVS cleavage was monitored 48 h after mock transfection (N) or HCV-SGR transfection (S) into MLT-MAVS⫺/⫺_miR122

cells stably expressing hMAVS and mMAVS. (C) Schematic representation of the experimental setup used to titrate MAVS abundance. The HCV replicon

(HCV-SGR) was transfected into target cells (MLT-MAVS⫺/⫺_{miR122 cells) to establish HCV replication. Twenty-four hours later, cells were reseeded into}

12-well plates. At 48 h posttransfection, the cells were transduced with equal titers of lentiviruses carrying the gene of interest._⫹, low-titer dose;_⫹⫹, middle-titer

dose;⫹⫹⫹, high-titer dose. After another 48 h, expression of the gene of interest and HCV RNA replication were measured. (D) Dose-dependent expression of

FLAG-tagged MAVS variants. hMAVS C508R and mMAVS C470R represent hMAVS and mMAVS variants resistant to cleavage by the HCV NS3-4A protease

(E) Dose-dependent repression of HCV RNA replication by FLAG-tagged MAVS variants. Given MAVS proteins were introduced into MLT-MAVS⫺/⫺_miR122

cells carrying a luciferase replicon.as described for panel C. HCV RNA replication was measured by luciferase activity and normalized to the data for cells that

were transduced to express GFP. Asterisks show a significant difference between the indicated data. All graph data are shown as mean values⫾SDs from three

independent experiments, and Western blotting images are representative of two individual experiments.

on November 7, 2019 by guest

http://jvi.asm.org/

Both type I and III IFNs control HCV replication in mouse

liver tumor cells.

To assess if both types of IFN contribute to

control of HCV replication in these cells, we first investigated if

both primary mouse hepatocytes and MLT-MAVS

⫺/⫺

miR122

cells are responsive to these IFNs. To this end, we incubated these

cells with exogenously added mouse IFN-

␣

or mouse IFN-

␭

3 and

monitored upregulation of the mRNAs of typical

interferon-stim-ulated genes (ISGs). All three ISGs tested by us were clearly

in-duced upon administration of either mIFN-

␣

or mIFN-

␭

,

indi-cating that these cells are responsive to both type I and III IFNs

(

Fig. 5C

). To explore the relevance of both types of IFNs for

con-trol of HCV replication in mouse liver-derived cells, we

estab-lished a novel MLT cell line lacking both type I and III IFN

recep-tors (MLT-IFNAR

⫺/⫺

IFNLR1

⫺/⫺

miR122) (

Fig. 6A

). When

transfected with an HCV luciferase replicon, these cells sustained

vigorous HCV RNA replication similar to that with

MLT-MAVS

⫺/⫺

miR122 cells and somewhat greater than with MLT

cells lacking endogenous expression of the type I IFN receptor

FIG 5mMAVS-dependent induction of type I and III IFN mRNA in mouse liver cells. (A) Relative mRNA expression of mouse type I (mIFN-␤) and III IFN

(mIFN-␭2/3) in wild-type C57BL/6 mouse-derived primary hepatocytes. The primary cells were treated with 50␮g/ml of poly(I·C) either by transfection (T-poly

I:C) or by direct addition to the culture medium (A-poly I:C). Eight hours later, total RNA from the each group of treated cells was extracted. (B) Induction of

mIFN-␤and mIFN-␭2/3 mRNA in MLT-MAVS⫺/⫺_{miR122 cells with or without mMAVS. The indicated cells were transfected with 50␮g/ml of poly(I·C) or}

with 10␮g of HCV replicon RNA. At the indicated time points, transfected cells were collected and total RNA was extracted. The level of IFN mRNA expression

was normalized to that of mGAPDH mRNA as determined by qRT-PCR. h.p.t, hours posttransfection. (C) Induction of representative mouse

interferon-stimulated genes (mISGs) in wild-type C57BL/6 mouse PMHs and in MLT-MAVS⫺/⫺_{miR122 cells treated with the indicated doses of exogenous mouse type I}

(mIFN-␣) or III (mIFN-␭3) IFN. At the indicated time points, cells were harvested and total RNA was extracted. mISG mRNA levels are expressed relative to

mGAPDH mRNA as determined by qRT-PCR. Asterisks show a significant difference between the indicated data. All graph data are shown as mean values⫾SDs

from three independent experiments.

Anggakusuma et al.

on November 7, 2019 by guest

http://jvi.asm.org/

[image:8.585.136.449.70.507.2]

alone (MLT-IFNAR

⫺/⫺

miR122 [

9

]) (

Fig. 6B

). This observation

was also corroborated by analysis of NS5A expression in the

trans-fected cells showing larger numbers of NS5A-positive cells in the

case of MAVS knockout and IFNAR plus IFNLR1 double

knock-out than with the IFNAR knockknock-out alone (

Fig. 6C

). Therefore,

inactivation of MAVS or both type I and III IFN receptors together

renders MLT cells highly permissive to HCV RNA replication. To

confirm that the latter cells lack functional type I and III IFN

receptors, we treated them with exogenous mIFN-

␣

or different

doses of mIFN-

␭

3 and used the nucleoside polymerase inhibitor

FIG 6Regulation of HCV-SGR replication in mouse cells by mouse type III IFNs. (A) Phenotypic appearances of all MLT cells. (B) Transient replication of the

HCV luciferase replicon without polymerase activity in MLT-MAVS⫺/⫺_{miR122, MLT-IFNAR}⫺/⫺_{miR122, and MLT-IFNAR}⫺/⫺_IFNLR1⫺/⫺_{miR122 cells. At}

the indicated time points posttransfection, HCV RNA replication was determined by luciferase activity. (C) Indirect immunofluorescence analysis of NS5A expression in given cell lines 48 h posttransfection. The HCV-NS5A protein was detected by specific antibody (9E10), and cell nuclei were stained with DAPI. (D)

Effect of exogenously added mouse type I and III IFNs (mIFNa and mIFN-␭3, respectively) on HCV replication in given MLT cells. Forty-eight hours after

administration of the given drugs, HCV RNA replication was determined by luciferase assays. Luciferase activity was normalized to that measured in control cells that were mock treated. Asterisks indicate a significant difference compared to each related mock group. (E) Repair of type III IFN receptor expression restores

responsiveness of MLT-IFNAR⫺/⫺_IFNLR1⫺/⫺_{miR122 cells to antiviral effect mediated by mIFN-␭3. Given MLT cells carrying a luciferase replicon were}

transduced to express GFP or the mIFNLR1 cDNA. Subsequently, cells were treated as indicated with 2=CMA or mIFN-␭3. Luciferase activity was determined 48

h later and is expressed relative to that in mock-treated and untransduced cells. Asterisks show a significant difference between the indicated data. All graph data

are shown as mean values⫾SDs from three independent experiments; images are representative of two individual experiments.

on November 7, 2019 by guest

http://jvi.asm.org/

[image:9.585.126.459.64.541.2]

2

=

C-methyladenosine (2

=

CMA) as a control. As expected, the

polymerase inhibitor reduced HCV replication in all three

above-mentioned cell lines (

Fig. 6D

). In contrast, mIFN-

␭

3 was antiviral

in MLT-MAVS

⫺/⫺

miR122 and MLT-IFNAR

⫺/⫺

miR122 cells,

and mIFN-

␣

was active only in MLT-MAVS

⫺/⫺

miR122 cells.

Importantly, HCV replication in MLT-IFNAR

⫺/⫺

IFNLR1

⫺/⫺

miR122 cells was fully resistant to exogenous administration of

both type I and III IFN, confirming the absence of both IFN

re-ceptors (

Fig. 6D

). Finally, we repaired expression of IFNLR1 in the

MLT cells with double knockout of type I and III IFN receptors

using lentiviral gene transfer and monitored HCV replication in

the presence or absence of mIFN-

␭

3 (

Fig. 6E

). Reintroduction of

the type III IFN receptor chain reduced HCV replication ca.

3-fold. Moreover, it also restored responsiveness of these cells to

mIFN-

␭

3, as addition of this type of IFN further repressed HCV

replication to a level ca. 10-fold lower than in mIFN-

␭

3-treated

cells in the absence of IFNLR1 expression (

Fig. 6E

). Collectively,

these observations indicate that HCV replication in MLT cells is

susceptible to suppression by both exogenous type I and III IFNs.

Finally, we explored if MAVS-dependent upregulation of

en-dogenous type I and III IFNs limits HCV replication in the MLT

culture system by using the experimental setup detailed in

Fig. 7A

.

To this end, we transduced mMAVS into MLT-MAVS

⫺/⫺

miR122,

MLT-IFNAR

⫺/⫺

miR122,

or

MLT-IFNAR

⫺/⫺

IFNLR1

⫺/⫺

miR122 cells that had been transfected with an HCV

replicon. Subsequently, we monitored MAVS cleavage by HCV

(

Fig. 7B

) and the influence of mMAVS overexpression on

HCV replication by using luciferase assays (

Fig. 7C

). As expected,

lentiviral gene transfer resulted in dose-dependent expression of

mMAVS in all transduced cell lines and HCV NS3-4A partially

cleaved overexpressed or endogenous mMAVS (

Fig. 7B

).

Reintro-duction of mMAVS into MLT-MAVS

⫺/⫺

miR122 cells, which

en-dogenously express both functional type I and III IFN receptors

(

Fig. 6

), suppressed HCV-dependent luciferase activity in a

dose-dependent fashion down to less than 10% at the highest dose of

mMAVS expression (

Fig. 7C

). Notably, mMAVS overexpression

also suppressed HCV replication in MLT cells lacking the type I

IFN receptor, albeit with modestly reduced efficacy (

Fig. 7C

). In

contrast, in cells that lack both type I and III IFN receptors,

over-expression of mMAVS no longer was antiviral, as evidenced by

stable high-level luciferase expression irrespective of the level of

overexpressed mMAVS (

Fig. 7C

). To examine if the antiviral

ac-tivity was caused by mMAVS-dependent secretion of both type I

and III IFNs, we assessed the bioactivity of the supernatants

col-lected from the mMAVS-overexpressing MLT-IFNAR

⫺/⫺

IFNLR1

⫺/⫺

miR122 cells. To this end, these supernatants were

filtered and passed onto MLT-MAVS

⫺/⫺

miR122, MLT-IFNAR

⫺/⫺

miR122, or MLT-IFNAR

⫺/⫺

IFNLR1

⫺/⫺

miR122 cells that

had been transfected with an HCV replicon (

Fig. 7D

). The

condi-tioned supernatants could suppress

de novo

HCV-dependent

lu-ciferase activity only in the MLT-MAVS

⫺/⫺

miR122 and

MLT-IFNAR

⫺/⫺

miR122 cells and not in the MLT cells lacking both IFN

receptors (

Fig. 7D

), confirming the secretion of bioactive type I

and III IFNs. Taken together, these data indicate that HCV

repli-cation in mouse-derived liver cells triggers mMAVS-dependent

signaling which upregulates both type I and III IFNs, which, in

turn, suppress HCV replication.

DISCUSSION

In this study, we showed that mMAVS-dependent innate immune

signaling potently restricts HCV replication in mouse liver cells by

way of inducing both type I and III IFN production. These results

refine and extend previous

in vitro

and

in vivo

studies highlighting

the fact that ablation of host proteins involved in innate immune

signaling facilitates HCV replication in mouse cells (

7–10

).

Nota-bly, mMAVS does potently restrict HCV replication in mouse cells

in spite of its susceptibility to cleavage by the CV NS3-4A protease,

which was reported recently (

31

,

32

). However, it remained

un-determined if the efficiency of cleavage paralleled that of hMAVS

and if expression of mMAVS poses a greater degree of restriction

on HCV replication than its human ortholog.

Therefore, we quantitatively and qualitatively compared the

cleavage efficiencies of hMAVS and mMAVS by the HCV NS3-4A

protease both in human and in mouse cells. Moreover, we

ex-plored to what level HCV interferes with the signaling activities of

both proteins and how efficiently these two orthologs restrict

HCV replication in mouse liver cells. Overexpressed HCV

NS3-4A similarly diminished hMAVS- and mMAVS-dependent

signaling in mouse (

Fig. 2

) and human (

Fig. 3

) cells. Moreover,

replicon-encoded protease cleaved similar fractions of

overex-pressed hMAVS and mMAVS, as was evident from detection of

these proteins via a FLAG tag (

Fig. 4

). Therefore, although

species-specific functioning of hMAVS and mMAVS in human and

mouse cells cannot be fully ruled out, these analyses strongly

sug-gest that in the human and mouse cells tested by us, cleavage and

viral interference with hMAVS and mMAVS were comparable.

These novel findings have implications relevant to the

devel-opment of immunocompetent mouse models for HCV. First, it is

unlikely that inefficient mMAVS cleavage by HCV

per se

prevents

efficient HCV replication in mouse liver cells. Therefore, MAVS

function apparently does not pose an insurmountable barrier to

HCV replication. Of note, in human cells, HCV NS3-4A also

cleaves human TRIF, which transmits Toll-like receptor 3

(TLR-3)-dependent signaling for production of IFN (

11

). Since there is

controversy about whether mouse TRIF is susceptible to cleavage

by HCV (

32

,

33

), it is possible that poor adaptation of HCV to

interfere with TRIF-dependent signaling prevents efficient HCV

replication in mouse cells. While resolving this question merits

further work, it is also possible that lack of human replication

cofactors limits replication and accumulation of HCV proteins to

establish sufficient interference with innate immunity. If these

cofactors were known, their ectopic expression in the mouse

en-vironment may reinforce HCV replication so that artificial

abla-tion of MAVS-dependent (and/or TRIF-dependent) innate

im-munity is not necessary. The cell lines described in this study

should be a useful platform to screen for such human replication

cofactors, for instance, by cDNA library-based approaches.

An alternative approach to establish

(pseudo)immunocompe-tent mouse models for HCV may be to selectively eliminate

dis-tinct IFN-expressed antiviral effector proteins to circumvent

global elimination of central innate immunity signaling

mole-cules. This study indicates that in the context of MLT cells, both

type I- and III-dependent antiviral effector mechanisms are

trig-gered by HCV replication which cooperate to efficiently suppress

HCV replication. This conclusion is based on our observations

that HCV RNA triggers both mouse IFN-

␤

and IFN-

␭

mRNA

expression (

Fig. 5

) and that HCV replication in MLT cells can be

Anggakusuma et al.

on November 7, 2019 by guest

http://jvi.asm.org/

suppressed by exogenous administration of both type I and III

IFNs (

Fig. 6

). Moreover, we observed that MAVS

signaling-de-pendent suppression of HCV replication mediated by secreted

type I and type III IFNs was most pronounced in cells expressing

both type I and III receptors, was reduced when the type I IFN

receptor was lacking, and was fully ablated when both IFN

recep-tors were absent (

Fig. 7

). Although MAVS also directly activates

interferon-stimulated genes (reference

34

and data not shown),

FIG 7mMAVS-dependent secreted type I and III IFNs cooperatively restrict HCV replication in mouse liver cells. (A) Schematic representation of the experimental setup. First, the HCV replicon (HCV-SGR) was transfected into target cells to establish HCV replication. Twenty-four hours later, cells were reseeded into 12-well plates. Forty-eight posttransfection, the cells were mock transduced or challenged with matched titers of lentiviruses carrying either GFP

or mMAVS using three different doses.⫹, low-titer dose;⫹⫹, middle-titer dose;⫹⫹⫹, high-titer dose. At the desired time point, expression of the gene of

interest was measured by Western blotting (B) and dose-dependent repression of HCV replication in given cell lines by mMAVS expression was measured by luciferase assays (C). Data are expressed relative to data for the mock-treated controls, and asterisks indicate a significant difference compared to each related

mock treatment. (D) To test the activity of secreted IFN, the supernatants from the mock-transduced or gene-of-interest (⫹⫹⫹)-transduced MLT-IFNAR⫺/⫺

IFNLR1⫺/⫺_{miR122 cells with replicating HCV-SGR were collected, filtered with a 0.45-mm filter, and then used to treatde novoHCV-SGR replication in the}

indicated cells. Forty-eight hours later, the HCV RNA replication was measured by luciferase assays. Data are expressed relative to those for the mock-treated

controls, and asterisks indicate a significant difference compared to each related mock group. All graph data are shown as mean values⫾SDs from three

independent experiments, and Western blotting images are representative of two individual experiments.

on November 7, 2019 by guest

http://jvi.asm.org/

[image:11.585.80.502.70.562.2]

this is apparently not sufficient to efficiently restrict HCV

replica-tion in the MLT cells lacking both IFN receptors (

Fig. 7

). These

data indicate that to mount a strong antiviral effect, it is necessary

for MAVS-dependent antiviral effector mechanisms to involve

signaling through type I and III IFN receptors. Further work will

be needed to find out which IFN-dependent mouse effector

pro-teins curtail HCV propagation. Evaluation of the type I- and III

IFN-dependent gene expression signatures should provide

inter-esting clues in this direction.

To what extent both type I and III IFNs limit HCV replication

in mouse livers

in vivo

remains to be shown. Notably, a recent

study concluded that type III IFN did not impact acute infection of

mouse livers by hepatotropic viruses due to the absence of

expres-sion of the type III IFN receptor (

35

). Given that expression of this

receptor is tightly controlled by epigenetic mechanisms, it is

pos-sible that this may change in the course of a long-term (

36

),

chronic infection. In any case, firm evidence derived from human

liver cells and from chimpanzees firmly establishes that HCV

in-duces both type I and III IFN responses which contribute to

con-trol of replication (

13

,

14

,

16

). In this regard, the novel MLT cells

described here may be useful not only to delineate species-specific

restrictions for HCV replication in mouse liver cells but also to

model both type I and III IFN-dependent HCV control

mecha-nisms.

ACKNOWLEDGMENTS

We are very grateful to Takaji Wakita for the gift of the JFH1 isolate, to Charles Rice for Huh-7.5 cells and 9E10 antibody, and to Matthew Evans for the miR122 expression construct. We also thank all members of the Institute for Experimental Virology at Twincore for helpful comments and discussions of this work.

This work was supported by a grant from the European Research Council, ERC-2011-StG_281473-(VIRAFRONT), and by a grant from the Helmholtz Association SO-024 to T.P.

Twincore Centre for Experimental and Clinical Infection Research is a joint venture between the Medical School Hanover and the Helmholtz Centre for Infection Research, Braunschweig.

REFERENCES

1.Maasoumy B, Wedemeyer H.2012. Natural history of acute and chronic

hepatitis C. Best Pract Res Clin Gastroenterol26:401– 412.http://dx.doi

.org/10.1016/j.bpg.2012.09.009.

2.Tse MT.2013. All-oral HCV therapies near approval. Nat Rev Drug Dis-cov12:409 – 411.http://dx.doi.org/10.1038/nrd4036.

3.Thomas DL.2013. Global control of hepatitis C: where challenge meets

opportunity. Nat Med19:850 – 858.http://dx.doi.org/10.1038/nm.3184.

4.Ploss A, Evans MJ, Gaysinskaya VA, Panis M, You H, de Jong YP, Rice

CM.2009. Human occludin is a hepatitis C virus entry factor required for

infection of mouse cells. Nature457:882– 886.http://dx.doi.org/10.1038

/nature07684.

5.Dorner M, Horwitz JA, Robbins JB, Barry WT, Feng Q, Mu K, Jones CT, Schoggins JW, Catanese MT, Burton DR, Law M, Rice CM, Ploss

A.2011. A genetically humanized mouse model for hepatitis C virus

in-fection. Nature474:208 –211.http://dx.doi.org/10.1038/nature10168.

6.Bitzegeio J, Bankwitz D, Hueging K, Haid S, Brohm C, Zeisel MB, Herrmann E, Iken M, Ott M, Baumert TF, Pietschmann T. 2010. Adaptation of hepatitis C virus to mouse CD81 permits infection of mouse cells in the absence of human entry factors. PLoS Pathog6:e1000978.http: //dx.doi.org/10.1371/journal.ppat.1000978.

7.Chang KS, Cai Z, Zhang C, Sen GC, Williams BR, Luo G. 2006. Replication of hepatitis C virus (HCV) RNA in mouse embryonic fibro-blasts: protein kinase R (PKR)-dependent and PKR-independent mecha-nisms for controlling HCV RNA replication and mediating interferon activities. J Virol80:7364 –7374.http://dx.doi.org/10.1128/JVI.00586-06. 8.Lin LT, Noyce RS, Pham TN, Wilson JA, Sisson GR, Michalak TI,

Mossman KL, Richardson CD.2010. Replication of subgenomic hepati-tis C virus replicons in mouse fibroblasts is facilitated by deletion of inter-feron regulatory factor 3 and expression of liver-specific microRNA 122. J

Virol84:9170 –9180.http://dx.doi.org/10.1128/JVI.00559-10.

9.Frentzen A, Anggakusuma, Gurlevik E, Hueging K, Knocke S, Ginkel C, Brown RJ, Heim M, Dill MT, Kroger A, Kalinke U, Kaderali L, Kuehnel F, Pietschmann T.2014. Cell entry, efficient RNA replication, and pro-duction of infectious hepatitis C virus progeny in mouse liver-derived cells. Hepatology59:78 – 88.http://dx.doi.org/10.1002/hep.26626. 10. Dorner M, Horwitz JA, Donovan BM, Labitt RN, Budell WC, Friling T,

Vogt A, Catanese MT, Satoh T, Kawai T, Akira S, Law M, Rice CM, Ploss A.2013. Completion of the entire hepatitis C virus life cycle in

genetically humanized mice. Nature501:237–241.http://dx.doi.org/10

.1038/nature12427.

11. Li K, Foy E, Ferreon JC, Nakamura M, Ferreon AC, Ikeda M, Ray SC, Gale M, Jr, Lemon SM.2005. Immune evasion by hepatitis C virus NS3/4A protease-mediated cleavage of the Toll-like receptor 3 adaptor

protein TRIF. Proc Natl Acad Sci U S A102:2992–2997.http://dx.doi.org

/10.1073/pnas.0408824102.

12. Meylan E, Curran J, Hofmann K, Moradpour D, Binder M, Barten-schlager R, Tschopp J.2005. Cardif is an adaptor protein in the RIG-I

antiviral pathway and is targeted by hepatitis C virus. Nature437:1167–

1172.http://dx.doi.org/10.1038/nature04193.

13. Marukian S, Andrus L, Sheahan TP, Jones CT, Charles ED, Ploss A, Rice CM, Dustin LB.2011. Hepatitis C virus induces interferon-lambda

and interferon-stimulated genes in primary liver cultures. Hepatology54:

1913–1923.http://dx.doi.org/10.1002/hep.24580.

14. Park H, Serti E, Eke O, Muchmore B, Prokunina-Olsson L, Capone S, Folgori A, Rehermann B.2012. IL-29 is the dominant type III interferon produced by hepatocytes during acute hepatitis C virus infection.

Hepa-tology56:2060 –2070.http://dx.doi.org/10.1002/hep.25897.

15. Sheahan T, Imanaka N, Marukian S, Dorner M, Liu P, Ploss A, Rice

CM.2014. Interferon lambda alleles predict innate antiviral immune

re-sponses and hepatitis C virus permissiveness. Cell Host Microbe15:190 –

202.http://dx.doi.org/10.1016/j.chom.2014.01.007.

16. Thomas E, Gonzalez VD, Li Q, Modi AA, Chen W, Noureddin M, Rotman Y, Liang TJ. 2012. HCV infection induces a unique hepatic innate immune response associated with robust production of type III

interferons. Gastroenterology 142:978 –988.http://dx.doi.org/10.1053/j

.gastro.2011.12.055.

17.Metz P, Reuter A, Bender S, Bartenschlager R. 2013. Interferon-stimulated genes and their role in controlling hepatitis C virus. J Hepatol

59:1331–1341.http://dx.doi.org/10.1016/j.jhep.2013.07.033.

18. Schoggins JW.2014. Interferon-stimulated genes: roles in viral pathogen-esis. Curr Opin Virol6:40 – 46.http://dx.doi.org/10.1016/j.coviro.2014.03 .006.

19. Schoggins JW, Wilson SJ, Panis M, Murphy MY, Jones CT, Bieniasz P, Rice CM.2011. A diverse range of gene products are effectors of the type I interferon antiviral response. Nature472:481– 485.http://dx.doi.org/10 .1038/nature09907.

20. Cooper J, Fields JK.1988. A hospital wellness program: where challenge

meets opportunity. Home Healthc Nurse6:10 –16.

21. Rothe M, Rittelmeyer I, Iken M, Rudrich U, Schambach A, Glage S, Manns MP, Baum C, Bock M, Ott M, Modlich U. 2012. Epidermal growth factor improves lentivirus vector gene transfer into primary mouse

hepatocytes. Gene Ther 19:425– 434.http://dx.doi.org/10.1038/gt.2011

.117.

22. Yuan Q, Loya K, Rani B, Mobus S, Balakrishnan A, Lamle J, Cathomen T, Vogel A, Manns MP, Ott M, Cantz T, Sharma AD.

2013. MicroRNA-221 overexpression accelerates hepatocyte

prolifer-ation during liver regenerprolifer-ation. Hepatology57:299 –310.http://dx.doi

.org/10.1002/hep.25984.

23. Anggakusuma, Colpitts CC, Schang LM, Rachmawati H, Frentzen A, Pfaender S, Behrendt P, Brown RJ, Bankwitz D, Steinmann J, Ott M, Meuleman P, Rice CM, Ploss A, Pietschmann T, Steinmann E.2014. Turmeric curcumin inhibits entry of all hepatitis C virus genotypes into

human liver cells. Gut 63:1137–1149.http://dx.doi.org/10.1136/gutjnl

-2012-304299.

24. Narbus CM, Israelow B, Sourisseau M, Michta ML, Hopcraft SE, Zeiner GM, Evans MJ.2011. HepG2 cells expressing microRNA miR-122 sup-port the entire hepatitis C virus life cycle. J Virol85:12087–12092.http: //dx.doi.org/10.1128/JVI.05843-11.

25. Yan N, Regalado-Magdos AD, Stiggelbout B, Lee-Kirsch MA, Lieber-Anggakusuma et al.

on November 7, 2019 by guest

http://jvi.asm.org/

man J.2010. The cytosolic exonuclease TREX1 inhibits the innate im-mune response to human immunodeficiency virus type 1. Nat Immunol

11:1005–1013.http://dx.doi.org/10.1038/ni.1941.

26. Sommereyns C, Paul S, Staeheli P, Michiels T. 2008. IFN-lambda (IFN-lambda) is expressed in a tissue-dependent fashion and primarily acts on epithelial cells in vivo. PLoS Pathog4:e1000017.http://dx.doi.org /10.1371/journal.ppat.1000017.

27. Bossaller L, Rathinam VA, Bonegio R, Chiang PI, Busto P, Wespiser AR, Caffrey DR, Li Q Z, Mohan C, Fitzgerald KA, Latz E, Marshak-Rothstein A.2013. Overexpression of membrane-bound fas ligand (CD95L) exacerbates autoimmune disease and renal pathology in

pristane-induced lupus. J Immunol191:2104 –2114.http://dx.doi.org/10

.4049/jimmunol.1300341.

28. Ank N, West H, Bartholdy C, Eriksson K, Thomsen AR, Paludan SR.

2006. Lambda interferon (IFN-lambda), a type III IFN, is induced by viruses and IFNs and displays potent antiviral activity against select virus infections in vivo. J Virol80:4501– 4509.http://dx.doi.org/10.1128/JVI.80 .9.4501-4509.2006.

29. Fensterl V, White CL, Yamashita M, Sen GC.2008. Novel characteristics

of the function and induction of murine p56 family proteins. J Virol82:

11045–11053.http://dx.doi.org/10.1128/JVI.01593-08.

30. Kawai T, Takahashi K, Sato S, Coban C, Kumar H, Kato H, Ishii KJ, Takeuchi O, Akira S.2005. IPS-1, an adaptor triggering RIG-I- and

Mda5-mediated type I interferon induction. Nat Immunol6:981–988.

http://dx.doi.org/10.1038/ni1243.

31. Ahlen G, Derk E, Weiland M, Jiao J, Rahbin N, Aleman S, Peterson DL, Pokrovskaja K, Grander D, Frelin L, Sallberg M.2009. Cleavage of the

IPS-1/Cardif/MAVS/VISA does not inhibit T cell-mediated elimination of

hepatitis C virus non-structural 3/4A-expressing hepatocytes. Gut58:

560 –569.http://dx.doi.org/10.1136/gut.2007.147264.

32. Vogt A, Scull MA, Friling T, Horwitz JA, Donovan BM, Dorner M, Gerold G, Labitt RN, Rice CM, Ploss A. 2013. Recapitulation of the hepatitis C virus life-cycle in engineered murine cell lines. Virology444:

1–11.http://dx.doi.org/10.1016/j.virol.2013.05.036.

33. Abe T, Kaname Y, Hamamoto I, Tsuda Y, Wen X, Taguwa S, Moriishi K, Takeuchi O, Kawai T, Kanto T, Hayashi N, Akira S, Matsuura Y.2007. Hepatitis C virus nonstructural protein 5A modu-lates the Toll-like receptor-MyD88-dependent signaling pathway in

macrophage cell lines. J Virol81:8953– 8966.http://dx.doi.org/10.1128

/JVI.00649-07.

34. Lazear HM, Lancaster A, Wilkins C, Suthar MS, Huang A, Vick SC, Clepper L, Thackray L, Brassil MM, Virgin HW, Nikolich-Zugich J, Moses AV, Gale M, Jr, Fruh K, Diamond MS.2013. IRF-3, IRF-5, and IRF-7 coordinately regulate the type I IFN response in myeloid dendritic

cells downstream of MAVS signaling. PLoS Pathog9:e1003118.http://dx

.doi.org/10.1371/journal.ppat.1003118.

35. Hermant P, Demarez C, Mahlakoiv T, Staeheli P, Meuleman P, Michiels T.2014. Human but not mouse hepatocytes respond to

inter-feron-lambda in vivo. PLoS One 9:e87906. http://dx.doi.org/10.1371

/journal.pone.0087906.

36. Ding S, Khoury-Hanold W, Iwasaki A, Robek MD. 2014. Epigenetic reprogramming of the type III interferon response potentiates antiviral

activity and suppresses tumor growth. PLoS Biol12:e1001758.http://dx

.doi.org/10.1371/journal.pbio.1001758.

on November 7, 2019 by guest

http://jvi.asm.org/