Copyright C)1992, American Society for Microbiology
Epstein-Barr Virus BZLF1 Transactivator
Is
a
Negative
Regulator of
Jun
HIROSHI
SATO,'*
HAZIME TAKESHITA,"2 MITSURU FURUKAWA,2 ANDMOTOHARU SEIKI1Departmentof Molecular Virology and Oncology, CancerResearchInstitute, 1 and Departmentof Otorhinolaryngology, School of Medicine,2Kanazawa University,
13-1 Takaramachi, Kanazawa 920, Japan
Received 3 March 1992/Accepted 25 April 1992
The Epstein-Barr virus BZLF1 protein that can induce the lytic cycle in latently infected cells is a
transcriptionfactorpartiallyhomologoustoFos and bindsnotonlythe canonicalTPA(tetradecanoyl phorbol acetate)-responsive element (TRE) sitebutalsosequencesdeviating from the TREconsensus sequence.Thus,
expressionof cellulargenesregulated by AP-1, including the autoregulated AP-1
family,
should be affectedby BZLF1. However, induction of only Fos by BZLF1 was observed in a gel mobility shift assay using anoligonucleotide probe containing theTREsequenceandtheantibody against Fos protein. Thec-junpromoter, which containsabinding site forJun and BZLF1,wasstimulated by Jun butnotby BZLF1. Furthermore, BZLF1 inhibited stimulation of the c-jun promoterby Jun. Jun together with Fos effectively activated the collagenase promoterthat containsa single TRE site. However,notonlywasBZLF1 unabletostimulate the collagenase promoter,but it also inhibited activation by Jun and Fos. On the otherhand, BZLF1stimulated constructs containingmultimeric binding sites. These results and those ofprevious studies ofEpstein-Barr virus promoters regulated byBZLF1 indicate thatBZLF1requires adjacent multiple DNA-binding sites for cooperative interaction to function as a transactivator and to repress the activation by Jun of promoters
containingasingleTREsite. This suggests that BZLF1evolvedtoconferdistinctregulatorypatternsuponviral
targetgenesand cellularAP-1-responsivegenes.
TheEpstein-Barr virus (EBV) BZLF1 gene, an
immedi-ate-earlygenetranscribed in thepresence ofcycloheximide in EBV-positive cells after induction, encodes a 34- to 38-kDa transcription factor (4, 24). Expressionofthisgene
product alone is sufficienttoreactivatethe entirelytic-cycle
process (25), including viral DNA replication through
con-catenated linearmolecules,when BZLF1 is introduced into cells latentlyinfected with EBV (16, 23).
BZLF1 protein has amino acid homology with cellular AP-1 transcriptionfactorshavingTPA(tetradecanoyl phor-bol acetate)-responsive element (TRE) binding activities, including Fos, Fra-1, Jun,andJun-B (10).BZLF1 and AP-1 proteins have overlapping but distinct target DNA-binding specificities.BothrecognizecanonicalTREs,butonlyBZLF1 recognizes BZLF1-responsive elements, ZREs, which are cis elements identified in EBV genes regulated byBZLF1 proteinthat havepartial homologytoTREs(5, 10, 15, 18, 20, 27). Recently, Lieberman and Berk have demonstrated that BZLF1proteinmakes directphysicalcontactwith the basic transcriptionfactor TFIID(19).
Despite the structural and functional similarities between BZLF1 and AP-1proteins, the effect of BZLF1onthe AP-1 regulatory pathway has not been examined except for its effectonthec-fospromoter. BZLF1 induces Fosexpression through TRE and TRE-like sites present in the c-fos
pro-moter(13).
Wethereforeanalyzedtheeffect of BZLF1onthe
expres-sion of cellular AP-1-responsive genes and compared the
biological activityof BZLF1 with thatofJun protein. The results of this study indicate that BZLF1 fails to stimulate c-junandcollagenasepromoterswhich containasinglecopy
of TRE and are activated by Jun. Furthermore, BZLF1
*Corresponding author.
inhibits activation of these promoters by Jun. However, BZLF1canstimulateconstructscontaining multimeric bind-ing sites, suggestbind-ingthat itrequires adjacent multiple DNA-binding sites for cooperative interaction to function as a
transactivator. These differences in the transactivating
ac-tivities of BZLF1 and Junmaybe themechanismbywhich BZLF1 confers distinct regulatory patterns on viral target genesand cellular AP-1-responsivegenes.
MATERIALS ANDMETHODS
Plasmid construction. The BZLF1 codingregionwas
ob-tained by polymerase chain reaction amplification of
com-plementaryDNA synthesizedfrom an EBV-producing
epi-thelial hybridcell line (22) and cloned into thepSG5vector (Stratagene),which contains the simian virus 40early region and the bacteriophageT7promoter, allowing expressionof the protein in transfected mammalian cells and in vitro synthesis of BZLF1 RNA.ExpressionplasmidsforJun and Fos were constructed by inserting the coding regions of humanc-junandc-fosgenes,respectively,intocloningsites of the pSG5vector. Areporterplasmid, collagenase-CAT,
was constructed by fusingthe -141 to +40 region of the collagenasepromoterrelativetothemRNA CAP sitetothe chloramphenicol acetyltransferase (CAT) structural gene.
Thec-jun-CAT plasmid containingthe-80to +45regionof the c-jun promoterwas a gift fromI. M. Verma. Reporter
plasmids with an additional binding site for BZLF1 were
constructed by inserting a single copy of TRE and ZRE5 oligonucleotideDNAs(shown below) upstream of the
colla-genase promoter -74 to +40 region (forming collagenase-TRE CAT and collagenase-ZRE CAT, respectively), in whichanoriginal singleTRE is included.
DNA-bindingassays. Thesynthetic oligonucleotides used in the binding assays were as follows (shown asthe sense 4732
on November 9, 2019 by guest
http://jvi.asm.org/
EBV BZLF1 IS A NEGATIVE REGULATOR OF Jun 4733
strand only in 5'-to-3' orientation): TRE, GATCTTCTA
GACCGGAIAiAGTCATAGCT[G;
c-jun
TRE, GATCCTTGGGGTGACATCATGGGCTA; ZRE5, GATCTJTCTAG
ACCAAATGTGCAAAGGTGAG. The 32P-labeled probe
wasobtained bylabeling 20 ng of annealed oligonucleotides with[,y-32P]ATP. To prepareBZLF1, Jun, and Fos proteins, expression plasmid DNAs were linearized with BglII and transcribed with T7 RNA polymerase, and the resulting
mRNAs were translated in mRNA-dependent reticulocyte
lysates(Promega).F9cellsweretransfectedwithexpression plasmids by the method of Chen and Okayama (6), and nuclear extracts were prepared 48 h later by the rapid method of Osbom et al.(21).Aliquotsof in vitro translation and nuclear extracts were usedin the DNA-bindingassays containing 20 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonicacid,pH7.9),40 mMKCl,0.2 mMEDTA, 8 mM MgCl2, 10% glycerol, 2% polyvinyl alcohol, 1 mM dithiothreitol, 100 ,ug of poly(dI-dC) per ml, and
approxi-mately 10 pg of
32P-labeled
double-stranded syntheticoligo-nucleotide. After incubation for 20 min at room temperature, samples wereelectrophoresedon a4or5% polyacrylamide
gel in 0.25x TBE buffercontaining12.5 mM Tris-borate(pH
8.3) and 0.25 mM EDTA. Inhibition of DNA-protein com-plex binding with the antibodytothe M2 peptide ofmouse Fos wasperformed by addingthe antiserum to the nuclear
extractandincubating it foranhour at4°C (9).
CAT assays. Undifferentiated F9 and HepG2 cells were cultured in Dulbecco's Eagle medium supplemented with 10% fetal bovine serum and were then transfected by cal-ciumphosphateprecipitation. Radioactive spotswere quan-tified with a Bio-image analyzer BA100 (Fuji Photo Film
Co.).
RESULTS
BZLF1 induces expression ofonly oneFos
family
protein. Toanalyze the effect of BZLF1ontheexpression of cellular AP-1proteins,agel mobilityshift assayusinganoligonucle-otide probe containing the TRE sequence and a nuclear extract from mouse teratocarcinoma F9 cells transfected with the BZLF1expression plasmidwasperformed.F9cells were used as recipients because of their relatively low
endogenousAP-1-binding activity (17).Gel retardationwith a nuclear extract from cells transfected with pUC plasmid
DNAhadonlyafaint retarded band[Fig. 1, laneNE(pUC)]. Transfection with BZLF1 resulted in a new band [lane NE(BZLF1)],whichcomigratedwith that of BZLF1protein synthesized inareticulocyte lysate [lane RL(BZLF1)]. Ad-dition of Jun protein synthesized inareticulocyte lysateto the nuclear extract from BZLF1-transfected cells [lane NE(BZLFl)+RL(Jun)]butnot tothat from control
plasmid-transfected cells [lane NE(pUC)+RL(Jun)] produced a band which migrated to aposition similar to that of a hu-man Jun-Fos protein complex synthesized in a reticulo-cyte lysate [lane RL(Jun/Fos)]. Formation of these
com-plexes was inhibited by competition with an excess of unlabeled TRE oligonucleotide DNA, and only a retarded band ofBZLF1 was detected by using ZRE5 oligonucleo-tide DNA as a probe (data not shown). However, the addition ofreticulocyte Fos proteintothe nuclear extractdid not result in the formation of any retarded band [lane
NE(BZLF1)+RL(Fos)].
These results indicate thatBZLF1 inducesexpression ofoneof the Fosfamily proteins butnoexpressionofJunfamily proteins.
BZLF1 has been reported to induce the c-fos promoter
(13). Totestfor the presence of Fosprotein in thecomplex
40
40 Antiserum
- _
__-BZLFI 1_
w esw w
BZLFIt _A
FREE I
FIG. 1. Induction ofaFosfamily protein byBZLF1.Aliquots of nuclear extracts (NE) from F9 cells transfected with pUC and expressionplasmid forBZLF1wereincubated withapproximately 10 pgof32P-labeledTREprobe(GATCT-TCTAGACCGGAITGAGI CATAGCTTG, shown as the sense strandonlyin 5'-to-3' orienta-tion)in the presenceorabsence ofinvitro translation(RL) ofJunor Fos protein and were analyzed on a 4% polyacrylamide gel as described in Materials and Methods. Inhibition of DNA-protein complex binding with antibody to mouse Fos was performed as
described in Materials and Methods. The faster migration of re-tarded bands than BZLF1 bands is due to nonspecific binding of reticulocyte lysate andserumto theoligonucleotideprobe. Cont., control. FREE,freeprobe.
produced by adding Jun protein to the nuclear extract from BZLF1-transfected cells, we used an antiserum against
mouse Fos protein (9). The antibody against mouse Fos
protein inhibited formation of the complex (Fig. 1, right
panel).
BZLF1 inhibits thec-jun promoter. The BZLF1 promoter
autoregulated byitsownproductcontainsanoctanucleotide coresequence(TGACATCA)identicaltothe TRE sequence of the
c-jun
promotertowhich BZLF1canbind(11, 12,26).The c-jun expression is reportedly positively autoregulated via this element(3), which prompted us to examine the effect of BZLF1onthec-jun promoter. Toconfirm thebindingof BZLF1 protein to the c-jun TRE site, a gel mobility shift assaywasperformed withanoligonucleotide containing the TRE sequenceof the c-jun promoterastheprobe. As shown inFig. 2,BZLF1bound c-jun promoter TRE sequence with anaffinity comparabletothat of the Junprotein,towhich the Jun-Fos heterodimerbound withhigheraffinity. BZLF1 but not Junbinding to the probe wasinhibited by competition
with unlabeled ZRE5 oligonucleotide DNA, to which only
BZLF1 specificallybinds, and bothwereinhibited by com-petition with theoligonucleotideDNAcontainingthe canon-ical TRE sequence. These results indicate that BZLF1 protein binds theTREsequence of the
c-jun
promoter.Asreportedpreviously,expressionofJun leadstoefficient stimulation of the
c-jun
promoter(3). However, theBZLF1expressionplasmidDNAdidnotincrease promoter
activity
(Fig. 3). Notonlywas BZLF1 unabletostimulatethec-jun
promoter, butcotransfection of the BZLF1expression vec-torwith the c-junvectorinhibited activation
by
Jun. VOL. 66, 1992on November 9, 2019 by guest
http://jvi.asm.org/
[image:2.612.330.560.80.285.2]4734 SATO ET AL.
+Competitor +Competitor
TRE ZRE5
0Nto s oe
__*^~~~~'(
(|*
OIk <O
... ^.=
w. w
.: _
-*....
.sw
i: __
F|
....
..ww
.::.:
:: :..w wZe
* * S
...
[image:3.612.95.259.76.281.2]:REE
FIG. 2. Binding of BZLF1 to the c-jun promoter sequence. Aliquots ofinvitro-synthesizedBZLF1, Jun, andFos proteins and a control reticulocyte lysate (lanes C) were incubated with a 32P-labeledoligonucleotide probe containing the TRE sequence of the c-jun promoter (GATCCTTGGGGTGACATCATGGGCTA, shownasthe sense strandonlyin the 5'-to-3' orientation) prior to analysisof the retardation complexesona5% polyacrylamidegel. Competitor oligonucleotide DNA (5 ng) containing the TRE se-quence ofthe c-jun promoter (TRE) or the ZRE5 sequence was included in the binding reaction to confirm the specificity of the binding.FREE, freeprobe.
BZLF1 needs multimeric bindingsites fortransactivation. The response of the AP-1-dependent reporter gene to the cotransfected BZLF1 expression vector was examined by using thecollagenase promoter that contains a single TRE site and that is stimulated by Jun and moreeffectively bya Jun and Fos heterocomplex (1). The collagenase promoter was used as a reporterplasmid, because BZLF1 had much higheraffinitytoits TRE core sequence than that of the jun promoter. Asshown inFig.4,BZLF1failedtostimulate the
collagenase-CATreporter gene.Furthermore,BZLF1 inhib-ited activation of this promoter by coexpression of Jun and Fos, whichindicates that BZLF1 interacts with the TRE site in thecollagenase promoter.
CollagenaseCAT Collagenass-TRE CAT Collgenase-ZRECAT
4~~~~~~~V~ ~ 1
'O
SSg<°
S
NS}
00§
Conversiorq%)<0.1 <0.1 13.55.4 1.26.1 39.5 26.3 <0.1 3.29.5 13.9
FIG. 4. BZLF1 activates multimeric TREs. HepG2 cells were cotransfected with 5 jLg of BZLF1, 2 ,ug each of Jun and Fos expressionplasmids, and1 ,ug of reporterplasmidcollagenaseCAT, collagenase-TRE CAT, orcollagenase-ZRE CAT. Cells were har-vested 24 hafter transfectionandassayed for CATactivity. Repre-sentative results fromtriplicate experiments areshown.
One structural difference between thepromoters of
c-jun
and collagenase and the promoters of EBV regulated by BZLF1 is that EBVpromoterscontainmultiplebinding sites for BZLF1 incontrast toasingle bindingsite forpromoters of cellulargenes.Tofurther investigate the biological differ-encesbetween Jun andBZLF1,we examined their abilities toactivateconstructswith anadditionalbindingsite foreach of them. TRE (TGAGTCA) and ZRE5 (TGTGCAA) (20) were insertedupstream of thecollagenase promoter contain-ing asingle TRE, formingcollagenase-TRE CATand colla-genase-ZRECAT, respectively. The basal level of collage-nase-TRE CAT but not of collagenase-ZRE CAT was significantly higherthan that ofcollagenase CAT, suggesting that the multimerized TRE functions as an enhancer in F9 cells,aspreviously reported (7). Expressionof this construct wastransactivatedbyBZLF1and moreeffectivelyby coex-pression of Jun and Fos (Fig. 4). A reporter plasmid, collagenase-ZRECAT,which contains an additionalbinding sitespecificforBZLF1,wasalsostimulatedaseffectively by BZLF1 asby Jun and Fos,although the basal transcription was not as high as that of the collagenase-TRE CAT con-struct. Mutation of the collagenase TRE sequence in the collagenase-ZRECAT constructabolishedactivation ofthe promoterby both BZLF1 and coexpression of Jun and Fos (datanotshown). These results suggest thattransactivation byBZLF1requiressynergistic interactions between multiple homodimersbound to adjacentsites.
DISCUSSION
[image:3.612.315.552.77.173.2]Conversion (%) <0.1 5.6 2.2 0.6 <0.1 <0.1
FIG. 3. BZLF1 inhibits activation ofc-junpromoterby Jun. Jun (3 jig)and BZLF1expression plasmids (1to6,ug,asindicated)were
cotransfected into F9 cells with 0.5 jig of c-jun-CAT reporter
plasmid. The totalamountoftransfected DNAwasmaintainedat10
jig perplate with pUCplasmid DNA. The cellswereharvested, and
CAT activity was analyzed 24 h after the transfections.
Repre-sentative resultsfromtriplicate experimentsareshown.
The BZLF1 protein is aviral transcription factor whose expression is sufficienttoinduce the viruslyticcycle in cells latently infected withEBV (25). BZLF1 geneexpression is
positively regulated via at least two distinct sets of cis elements responsive to either TPA or theBZLF1-encoded protein itself (11, 12). The ZIT domain of the BZLF1 pro-moter contains an octanucleotide core sequence
(TGA-CATCA) which is identical to the c-jun TRE and is an essential promoter element forTPAinduction(11, 12). AP-1
family proteins includingJun and FosinducedbyTPAmay bind to this element to stimulate the promoter. Once the BZLF1protein is synthesized, itcan autostimulate its own promoterandsubsequently induces the viral lytic cycle. The
bindingof theBZLF1proteinnotonlytocanonicalTRE but alsoto theTRE sequence ofthe c-jun promoter raises the questionof how BZLF1 affects the expression of theAP-1
family, including c-jun, which is regulated in a similar fashion. Agel retardation assayusing the TREprobe dem-J. VIROL.
4b
k
0 10.114I"Sp
4.40:0 1
,Jun 'Jun/Fos
BZLF1
on November 9, 2019 by guest
http://jvi.asm.org/
[image:3.612.97.252.555.657.2]EBV BZLF1 IS A NEGATIVE REGULATOR OF Jun 4735
onstrated that BZLF1 induces only a Fos family member, which forms a complex with Jun protein synthesized in vitro. Thecomplex formation between Jun and the factor induced by BZLF1 was inhibited by the antibody against mouse Fos protein, indicating that synthesis of Fos was induced by BZLF1.This is consistent with a previous report describing how BZLF1 induces the c-fos promoter (13). Not only was BZLF1unable to stimulate c-jun and collagenase promoters which contain a single TRE, but it also inhibited activation of these promoters by Jun. BZLF1 also partially inhibited
activation of the collagenase promoter by TPA (data not
shown), which is mediated via the TRE sequence (2). BZLF1 may downregulate the AP-1 regulatory pathway at twosteps:(i) induction of Jun and (ii) activation mediated via the TREby Jun. Thus, BZLF1 synthesized in excess during the viral lytic cycle may shut off the cellular AP-1 regulatory pathway, which is no longer necessary for virus replication. We also demonstrated that inhibition of Jun transactiva-tion by BZLF1 is due to the distinct transactivating activities of these proteins, both of which can bind TRE. Jun can activate its own promoter as well as the collagenase pro-moter (both contain a single copy of the TRE), whereas BZLF1failed to stimulate them and inhibited their activation by Jun. On the other hand, BZLF1 can stimulate collagenase promoter constructs inserted with additional binding sites
for BZLF1 adjacent to the TRE site. The EBV promoters responsive to BZLF1 and c-fos promoter contain multiple binding sites for BZLF1 (5, 10, 13, 15, 18, 20, 27). Thus, BZLF1 requires synergistic interaction to function as a
transactivator. Synergistic effects on transcriptional activa-tion have been explained by two basic mechanisms; one is the cooperative binding of activators to adjacent binding
sites, and the other is a cooperative effect upon transcrip-tion. BZLF1 protein reportedly exhibits cooperative binding to adjacent binding sites with low affinities (26). However, since BZLF1 showed a high affinity to a single canonical TRE (5, 10, 18, 20, 26, 27) and inhibited activation of the promoter by Jun and Fos, it should interact with the single TREin the collagenase promoter. Thus, we favor the second mechanism for synergism of BZLF1. Jun-B, which has DNA-binding properties very similar to those of Jun, also exhibited an inability to stimulate promoters containing a single binding site and inhibited activation of these promot-ers by Jun (7). The distinct behavior of Jun and Jun-B has beenexplained by differences in their activation domains (7). BZLF1 protein may also contain a Jun-B-type activation domain and require adjacent multiple binding sites to coop-eratively interact to function as a transactivator. The nega-tive regulation of Jun by BZLF1 most likely occurs by
competition between Junand BZLF1 for the TRE site. This is supported by the fact that a deletion mutant of BZLF1 which lacks DNA binding activity because of 46 deleted C-terminal amino acids, including the dimerization domain
(5), did not significantly influence the activation of the promoter by Jun and Fos (data not shown). Recently, Lieberman and Berk have demonstrated that BZLF1 makes directphysical contact with basic transcription factor TFIID and influences TFIID binding to TATA sequences (19).
MultipleBZLF1homodimers bound to adjacent DNA-bind-ing sites may further stabilize the BZLF1-TFIID-promoter
complex. The possibility that BZLF1 protein bound to a
single binding site may become a positive regulator by interacting with another transactivator bound to a site adja-cent totheBZLF1-bindingsite cannot be excluded. Indeed, interaction between BZLF1 and EBV transcription factor R
has been reported, although the molecular mechanism is still unknown (8, 14).
ACKNOWLEDGMENTS
WethankInderVermaforthegenerousgift of the
c-jun
promoter and MasahiroFujii andNancy Raab-Traub for their helpful discus-sion andadvice.Thisworkwas supported by a grant-in-aid from the Ministry of Education, Science andCulture ofJapan.
REFERENCES
1. Angel, P., E. A. Allegretto, S.Okino, K. Hattori, W. J. Boyle, T. Hunter, and M. Karin. 1988. Oncogene jun encodes a sequence-specific transactivator similar to AP-1. Nature (London) 332: 166-171.
2. Angel, P.,L. Baumann, B. Stein, H. Delius, H. J. Rahmsdorf, and P. Herrlich. 1987. 12-0-Tetradecanoyl-phorbol-13-acetate in-duction of the human collagenase gene is mediated by an inducible enhancer element located in the 5'-flanking region. Mol. Cell. Biol. 7:2256-2266.
3. Angel, P., K. Hattori, T. Smeal, and M. Karin. 1988. The jun proto-oncogene is positively autoregulated by its product, Jun/ AP-1. Cell 55:875-885.
4. Biggin, M., M. Bodescot, M. Perricaudet, and P.Farrell. 1987. Epstein-Barr virus gene expression in P3HR-1-superinfected Rajicells. J. Virol. 61:3120-3132.
5. Chang, Y.-N., D. L.-Y. Dong, G. S. Hayward, and S. D. Hayward. 1990. The Epstein-Barr virus Zta transactivator: a member of the bZIP family with unique DNA-binding specificity and adimerization domain that lacks the characteristic heptad leucine zipper motif. J. Virol. 64:3358-3369.
6. Chen, C., and H. Okayama. 1987. High-efficiency transforma-tion of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7:2745-2752.
7. Chiu, R., P. Angel, and M. Karin. 1989. Jun-B differs in its biological properties from, and is a negative regulator of, c-Jun. Cell 59:979-986.
8. Cox, M. A., J. Leahy, and J. M. Hardwick. 1990. An enhancer within the divergent promoter of Epstein-Barr virus responds synergisticallyto theR andZtransactivators. J. Virol. 64:313-321. 9. Curran, T., C.Van Beveren, N. Ling, andI.M. Verma. 1985. Viral andcellularfos proteins are complexed with a 39,000-Da cellularprotein. Mol. Cell. Biol. 5:167-172.
10. Farrel, P. J., D. T. Rowe, C. M. Rooney, and T. Kouzarides. 1989. Epstein-Barr virus BZLF1 trans-activator specifically binds to aconsensus AP-1 site and is related to c-fos. EMBO J. 8:127-132.
11. Flemington, E., andS. H.Speclk 1990. Identification of phorbol ester responseelements in the promoter of Epstein-Barr virus putative lyticswitchgene BZLF1. J. Virol. 64:1217-1226. 12. Flemington, E., and S. H. Speck. 1990. Autoregulation of
Epstein-Barr virusputative lytic switch gene BZLF1. J. Virol. 64:1227-1232.
13. Flemington, E., and S. H. Speck. 1990. Epstein-Barr virus BZLF1 trans activator induces the promoter of a cellular cognate gene, c-fos. J. Virol. 64:4549-4552.
14. Giot, J.-F., I. Mikaelian, M. Buisson, E. Manet,I. Joab, J.-C. Nicolas, and A. Sergeant. 1991. Transcriptional interference between theEBVtranscription factorsEB1 and R: both DNA-binding and activation domains ofEB1 are required. Nucleic Acids Res. 19:1251-1258.
15. Gruffat, H., N. Moreno, andA.Sergeant. 1990. The Epstein-Barr virus (EBV)ORIItenhancer is not B-cellspecificand does notrespondsynergistically to the EBV transcriptionfactors R and Z. J. Virol.64:2810-2818.
16. Hammerschmidt, W., and B. Sugden. 1988. Identification of ORILyt, a lytic origin of DNAreplicationof Epstein-Barr virus. Cell55:427-433.
17. Kryszke,M.-H.,J.Piette, and M. Yaniv. 1987. Induction of a factor that binds to thepolyoma virus A enhancer on differen-tiation of embryonal carcinoma cells. Nature (London) 328:254-256.
VOL.66, 1992
on November 9, 2019 by guest
http://jvi.asm.org/
18. Lieberman, P. M.,andA. J. Berk.1990. In vitrotranscriptional activation, dimerization, and DNA-binding specificity of the Epstein-Barr virus Zta protein. J. Virol.64:2560-2568. 19. Lieberman, P. M., and A. J. Berk. 1991. The Ztatrans-activator
protein stabilizes TFIID association with promoter DNA by direct protein-protein interaction. Genes Dev. 5:2441-2454. 20. Lieberman, P. M., J. M. Hardwick, J. Sample,G.S.Hayward,
and S. D. Hayward. 1990. The Zta transactivator involved in induction of lytic cyclegeneexpression inEpstein-Barr
virus-infected lymphocytes bindstoboth AP-1 andZREsites intarget promoterand enhancerregions. J.Virol. 64:1143-1155. 21. Osborn, L., S. Kunkel, and G. J. Nabel. 1989.Tumournecrosis
factor a and interleukin 1 stimulate the human
immunodefi-ciency virus enhancer by activation of the nuclearfactor kB. Proc.Natl. Acad. Sci. USA 86:2336-2340.
22. Sato, H., T. Takimoto, S. Tanaka, H. Ogura, K. Shiraishi,andJ. Tanaka. 1989. Cytopathic effects induced byEpstein-Barr virus replication in epithelial nasopharyngeal carcinoma hybrid cells. J. Virol. 63:3555-3559.
23. Sato, H., T. Takimoto, S. Tanaka, J. Tanaka, and N.
Raab-Traub. 1990. Concatemeric replication of Epstein-Barr virus:
structure of the termini in virus-producer and newly
trans-formedcell lines. J. Virol. 64:5295-5300.
24. Takada, K., and Y. Ono. 1989. Synchronous and sequential activation oflatently infected Epstein-Barr virus genomes. J. Virol. 63:445-449.
25. Takada, K.,N. Shimizu, S. Sakuma, and Y. Ono. 1986. trans
activationof the latentEpstein-Barr virus (EBV)genomeafter transfectionofthe EBV DNAfragment. J. Virol. 57:1016-1022. 26. Taylor, N., E. Flemington, J. L. Kolman, R. P. Baumann, S. H. Speck, and G.Miller. 1991. ZEBRAandaFos-GCN4chimeric
protein differintheirDNA-binding specificities for sites in the Epstein-Barr virus BZLF1promoter.J. Virol. 65:4033-4041. 27. Urier, G., M. Buisson, P. Chambard, and A. Sergeant. 1989. The
Epstein-Barr virus early protein EB1 activates transcription from differentresponsiveelementsincludingAP-1bindingsites. EMBO J. 8:1447-1453.