• No results found

Purification, primary structure, bacterial expression and subcellular distribution of an oocyte-specific protein in Xenopus

N/A
N/A
Protected

Academic year: 2021

Share "Purification, primary structure, bacterial expression and subcellular distribution of an oocyte-specific protein in Xenopus"

Copied!
11
0
0

Loading.... (view fulltext now)

Full text

(1)

Purification, primary structure, bacterial expression and subcellular distribution of an oocyte-specific protein in Xenopus

Russell P. ROTHER ', ', Mark B. FRANK

'.

and Patricia S. THOMAS

',

Arthritis and Immunology Program, Oklahoma Medical Research Foundation, Oklahoma City, USA

Department of Microbiology and Immunology, University of Oklahoma Health Sciences Center, Oklahoma City, USA (Received January 6, 1992) - EJB 92 0007

This study defines a novel Xenopus luevis protein (PIOO) that has recently been shown to be recognized by scleroderma patient sera. Using a combination of differential solubility in detergents, hydroxyapatite chromatography and one-dimensional PAGE, PlOO was purified to apparent hom- ogeneity and the amino acid sequence was obtained. An oligonucleotide derived from this sequence was used to clone PlOO cDNA through a polymerase-chain-reaction cloning strategy. The entire PlOO cDNA sequence was determined, identifying a novel 83000-Da protein. Two alleles for PlOO were transcribed in the oocyte, with only one predicted amino acid change between them. Bacterial expression of a clone containing the entire PlOO coding region produced a protein that migrated at a mass 15% greater than that predicted from the amino acid sequence, indicating an aberrant electrophoretic mobility. The mRNA transcript for PlOO was only expressed during the previtellogenic stages of oogenesis (stages I and 11) and was absent from other Xenopus tissues. Similarly, the PlOO protein was found only in Xenopus oocytes and was localized to the cytoplasm of these cells. PlOO irreversibly bound single-stranded-DNA - cellulose but not double-stranded-DNA - cellulose. These data demonstrate the presence of a novel oocyte-specific protein in Xenopus.

Autoantibodies in rheumatic diseases target a variety of highly conserved intracellular proteins, including those involved in RNA polymerase I and 111 transcription, hetero- nuclear RNA splicing, aminoacylation of certain tRNA species, DNA replication, DNA supercoiling and mitosis (re- view in [l]). The Xenopus oocyte and embryo have provided valuable systems for the characterization of many of these proteins. One example is the ribonucleoproteins targeted by systemic lupus erythematosus patient sera [2]. Antibodies against Sm and RNP were shown to inhibit intron excision from ribosomal genes when injected into germinal vesicles of oocytes, confirming that the RNA-splicing function of these particles demonstrated in vitro also occurred in vivo [3-51.

Furthermore, Xenopus Sm and RNP were able to package exogenous small-nuclear RNA from mouse, Drosophila and yeast [6, 71. The Xenopus egg and early embryo were also shown to contain a large store of the U1 small nuclear RNA [6]. Fibrillarin, a ribonucleoprotein associated with U3 small nuclear RNA and recognized by scleroderma patient anti- bodies, was first cloned and sequenced from a Xenopus cDNA library [8, 91. Other autoantigenic proteins characterized in

the Xenopus system include the proliferating cell nuclear anti- gen and the histones 130- 131.

Recent experiments in our laboratory have shown that scleroderma sera recognize a 100-kDa protein (P100) which is expressed in Xenopus luevis ovary [14]. Preliminary work also suggests a low level of expression in HeLa cells; however, attempts to clone a 100-kDa protein from a HeLa cell cDNA expression library with such sera have proven to be unsuccess- ful. In light of the abundance of a 100-kDa protein in X . luevis oocytes that is recognized by these sera, we attempted to characterize this protein in Xenopus. This study reports the purification and molecular characterization of the PlOO pro- tein found in X . luevis ovary. The subcellular localization and tissue distribution of PlOO are also presented. The results of these experiments identify PlOO as a novel, oocyte-specific protein and suggest that scleroderma patient reactivity to this protein is due to a cross-reactive epitope found in the molecule.

MATERIALS AND METHODS Correspondence to R. P. Rother, Section of Immunobiology, Yale Preparation Of tissue and

X . luevis tissues (from immature frogs 6 - 7 cm in length;

Xenopus I, Ann Arbor, MI) and mouse ovary were prepared

Fax: + l 203 789 1059.

by homogenizing tissues (5% mass/vol.) in 50 mM Tris/HCl, Abbreviations. GV, germinal vesicle; RACE, rapid amplification

of cDNA ends; 3'AP, 3' amplification primer; SAP, 5' amplification

primer; SRTP, 5' reverse transcription primer. pH 7.5, 25 mM KCI, 5 mM MgC12, 0.25 mM dithiothreitol Note. The novel nucleotide sequence data published here have and mM phenylmethylsulphonyl (homogenization been submitted to the GenBank sequence data bank(s) and are avail- buffer) followed by centrifugation at 1oC)Oo x g for 15 min. TO able under accession number(s) M76720 and M76721. prepare stage-specific oocytes [ 151, one ovary was excised from

homogenates Medical School, 310 Cedar Street, New Haven, CT 06510, USA

(2)

a mature frog and follicle cells were removed by incubating with type 2 collagenase (1 mg/ml; Cooper Biomedical, Free- hold, NJ) in 40 ml of modified Barths saline (7.5 mM Tris/

HCI, pH 7.5, 88 mM NaCl, 10 mM KCI, 3.3 mM NaNO,, 0.5 mM CaC12, 1 mM MgS04, 2.3 mM NaHC03 and 50 pg/

ml gentamicin) for 6 h a t room temperature [16]. Oocytes from each of the first five stages of oogenesis were obtained by differential sedimentation through a 0.8 cm x 23 cm Bio-Rad column containing modified Barth's saline. After settling, the different stages were removed with a pasteur pipet as distinct layers in the column. Stage I oocytes were obtained by isolating ovaries from immature frogs which had undergone the first two stages of oogenesis only. Ten oocytes from each of the first three stages of oogenesis were homogenized in 100 pl homogenization buffer followed by centrifugation at 10000 x g for 2 min.

Germinal vesicles (GV) were isolated from stage V oocytes under a dissecting microscope by pricking the animal pole with a 25-gauge needle and extracting the protruding GV with a pipet (Dr. Ron Reeder, Fred Hutchinson Cancer Research Center; personal communications). A total of 10 GV, ooplasms and whole oocytes were quick frozen and thawed in 100 pl homogenization buffer, vortexed vigorously and centri- fuged at 10000 x g for 2 min before assaying homogenates for Pl 00 and topoisomerase I (Scl-70) by immunoblotting.

Immunoblot analysis

Protein preparations were boiled in Laemmli sample buffer (0.0625 M Tris/HCl, pH 6.8, 2% SDS, 10% glycerol, 1 % 2-mercaptoethanol and 0.001 YO bromophenol blue) and sep- arated on 7.5% SDS/polyacrylamide mini-gels (Idea Scien- tific, Corvallis, OR) for 1.5 h at 150 V [17]. The proteins were electrophoretically transferred to 0.45 pm nitrocellulose (Schleicher & Schuell, Keene, NH) for 30 rnin at 24 V in 25 mM Tris/HCl, pH 8, 192 mM glycine and 7% methanol [18]. The nitrocellulose was blocked for 30 min in blotto YO nonfat dry milk, 0.01 YO antifoam A, 0.01% thimerosal, 50 mM Tris/HCl, pH 7.5 and 200 mM NaCl). After overnight incubation with scleroderma patient serum or affinity-purified antibodies, blots were reacted with alkaline-phosphatase-con- jugated anti-IgG antibody (1 : 5000) for 1 h and subsequently developed with 5-bromo-4-chloro-3-indolylphosphate and nitroblue tetrazolium (Sigma, St. Louis, MO). The anti-P100 patient serum was selected from the sera bank of the Arthritis and Immunology Program at the Oklahoma Medical Re- search Foundation courtesy of Dr. Morris Reichlin. The patient was characterized by a rapid onset of diffuse disease and a high titer of antibody to the 100-kDa X . luevis protein (P100).

Affinity purification of anti-Pl00 antibody

Anti-PI00 antibody was affinity purified using a modifi- cation of a method developed by Adam et al. [19]. X . laevis ovary homogenate was resolved on 7.5% SDS/PAGE pre- parative gels, transferred to nitrocellulose and blocked in blotto solution. A horizontal strip (5 mm wide) was excised from the membrane at the region of 100 kDa. Strips were incubated for 2 h with anti-P100 patient serum, diluted 1 : 100 in blotto. After washing strips in 50 mM Tris/HCl, pH 7.5, 200 mM NaCl and 0.05% Tween 20, bound antibody was eluted with 5 mM glycine, pH 2.3, and 1% bovine serum albumin for 2 min. The solution was neutralized immediately by the addition of 1 .O M KC1, pH 7, to a final concentration

of 50 mM. This procedure was repeated over 30 times with the same strips without loss of binding capacity or specificity.

Horizontal strips excised from the same membranes at the region of 70 kDa served as a control for nonspecifically bound antibody. These controls were always negative.

Detergent solubilization

The X . laevis ovary homogenate was centrifuged at 100000 x g for 1 h and the supernatant was discarded. The pellet was resuspended in 50 mM Tris/HCl, pH 7.5, and 200 mM NaCl containing one of the following detergents:

0.5% Nonidet P-40,0.5% SDS, 1% Triton X-100, 1 % Tween 20 or 0.5% Zwittergent 3 - 14. Another 100000 x g centrif- ugation was performed and both the supernatant and pellet fractions were analyzed for the presence of PlOO by immuno- blot.

Hydroxyapatite chromatography

SDS-solubilized material was applied directly to a hydroxyapatite Ultrogel column (Pharmacia LKB Biotech- nology, Piscataway, NJ; 0.9 cm x 15 cm) previously equili- brated to 100 mM NaH2P04/Na2HP04, pH 7, with 0.25%

SDS. A single peak was batch eluted with 500 mM NaH2P04/

Na2HP04 containing 0.25% SDS, and PlOO fractions were pooled, dialyzed and concentrated in 50 mM Tris/HCl, pH 7.5, and 200 mM NaCl to a final volume of 1 ml (Prodicon;

Bio-Molecular Dynamics, Beaverton, OR). The P100 protein was further purified by preparative SDS/PAGE.

Absorption of PlOO with solid-phase DNA

Solid-phase double-stranded-DN A -cellulose, single- stranded-DNA - cellulose or cellulose alone (Sigma, St. Louis MO) previously equilibrated with 40 mM Tris/HCl, pH 7.5, 50 mM KC1, 10% glycerol, 0.5 mM Na2EDTA and 0.5 mM dithiothreitol (buffer A) were incubated with X . luevis ovary homogenate (0.2 mg total protein/100 pl gel) for 3 h at room temperature with constant rotation. Cellulose beads were re- moved by centrifugation and the supernatant was collected.

Beads were washed 5 x with buffer A before eluting with 2 M NaCl for 15 min. Supernatants and high salt eluates were assayed for PlOO by immunoblot.

Amino acid sequence analysis

Peptide sequence analysis was performed essentially as described [20]. After PlOO purification, PAGE-separated pro- teins were transferred to nitrocellulose (Schleicher & Schuell, Keene, NH) for 2.5 h a t 100 V and stained with 0.1% Ponceau S (Fisher Scientific, Pittsburgh, PA) in 1 % aqueous acetic acid. Excess stain was removed by rinsing in 1 % aqueous acetic acid and the PlOO band (identified by immunoblot) was excised and stored wet at - 20 "C. Enzymatic digestion, separation by reverse-phase HPLC and peptide sequence analysis were performed by William S. Lane, Ruth Davenport and Renee Robinson at the Harvard Microchemistry Facility, Harvard University, Cambridge, MA.

Oligonucleotides

Oligonucleotides were synthesized on an Applied Biosys- tems DNA synthesizer (model 380B) using 2-cyanoethyl phos- phoramidite chemistry [21] at the Molecular Biology Resource

(3)

Table 1. Oligonucleotides. The location of gene-specific sequences relative to the PlOO nucleotide sequence (Fig. 6) are indicated to the right of the oligonucleotides. Oligonucleotides complementary to the PlOO nucleotide sequence are shown by asterisk. 5' anchors, containing restriction enzyme sites, are indicated in bold.

Name Sequence

R1*

dTI6-adaptor CGCGCATGCCTGCAGAAGCTT(T)16

TTY TCATAGTAIGCCTGGTAGTAGTARTCATCCAG (127 1 - 1237)

adaptor CGCGCATGCCTGCAG AAGCTTT

3'AP

SRTP* ACCAGTTTTGTAGGCTCT (1 340- 1323)

SAP*

R-15 CGCGGATCCGATGAATCTCGGCTCCGA (61 - 77)

R-16*

CGCCTGCAGAAGCTTCTGGATGAYTACTACTACCAGGCITACTATGARAA (1 237 - 1271) CGCGAGCTCCTGCAGCTCCCAAAAATTCTTCCT (1 309 - 1292)

CGCTCTAGATCATG AAGGTAC AGCTG (2262 - 2246)

Facility, University of Oklahoma Health Sciences Center. The name and sequence of each oligonucleotide are shown in Table 1. The degenerate R1 sequence was constructed with sense-strand complementarity from PlOO amino acid sequence information. A codon utilization table generated from X . laevis protein coding sequences [22] was used to predict the most probable codon for a particular amino acid. When codon preference could not predict between two bases, both were included (codons 3 and 11). When four possible bases were represented with equal frequencies (codon S), inosine was substituted as a neutral base [23]. Intercodon 5'-C-G-3' usage was avoided (codons 2 and lo), since this base combination has been shown to be significantly under-represented in most eukaryotes [24].

Oligonucleotides used in the rapid amplification of cDNA ends (RACE) are listed in Table 1. The dT,,-adaptor, adaptor, 3' amplification primer (3'AP) and 5' amplification primer (5'AP) contained 5'-restriction-enzyme-recognition sites for subsequent cloning. Primers used to generate clones for the protein-expression studies included R-I 5 and R-I 6.

End-labeled and random-primed probes

R1 oligonucleotide was end labeled with T4 polynucleotide kinase (USB, Cleveland, OH). RACE products isolated from agarose gels (USBioclean, USB, Cleveland, OH) were labeled using the Random Primed DNA Labeling Kit (Boehringer- Mannheim, Indianapolis, IN). Unincorporated deoxy- nucleotides were removed using G-50 chromatography [25].

Production of PlOO cDNA from polyadenylated message The generation of PlOO cDNA by polymerase-chain-reac- tion amplification of the reverse-transcribed message was ac- complished by a modified version of the RACE method de- vised by Frohman et al. [26]. Polyadenylated RNA was iso- lated from total RNA from stage I oocytes using an oligo(dT) column [27]. 1 pg polyadenylated message was heated at 65 "C for 3 rnin and cooled briefly on ice before adding 50 mM Tris/HCl, pH 8 at 41 "C, 40 mM KC1, 6 mM MgC12, 1 mM dithiothreitol, 1.5 mM each dNTP, 20 pmol dTI6-adaptor primer, 1 U Inhibit-ACE (5'-3' Inc., West Chester, PA) and 10 U avian myeloblastosis virus reverse transcriptase (Pro- mega, Madison, WI). The 2 0 4 reaction was incubated at 41 "C for 2 h and diluted to 1 ml with 10 mM Tris/HCI, pH 8.0, and 1 mM Na2EDTA.

3'-end polymerase-chain-reaction amplification of first- strand cDNA was carried out in a DNA Thermal Cycler (Perkin-Elmer-Cetus, Norwalk, CT) using a variation of a

technique described for degenerate primers [28]. 1 pl of the cDNA pool was combined with 25 pmol 3'AP in a 50-p1 reaction mixture (20 mM Tris/HCl, pH 8.5,50 mM KC1,O.l YO Tween 20,1.5 mM MgClz and 200 pM each dNTP) followed by the addition of 2.5 U of Tuq DNA polymerase (Perkin- Elmer-Cetus, Norwalk, CT) and 30 p1 mineral oil. 3'AP was complementary to the R1 oligonucleotide derived from the PlOO amino acid sequence (see Table 1). After 10 cycles of linear amplification (94"C, 40 s; 45"C, 2 min; 2.5min ex- tended ramp time, 7 2 T , 3 min), 25 pmol adaptor primer was added for an additional 30 cycles of exponential amplification (94"C, 40 s ; 54"C, 2 min; 72"C, 3 min). The adaptor primer consisted of the dTl6 -adaptor primer used in reverse tran- scription, excluding the poly(T) tail.

Production of the 5' end of PlOO cDNA began with the reverse transcription of stage-I oocyte polyadenylated RNA using 20 pCi [32P]dCTP and the 5' reverse-transcription primer (5'RTP). This primer sequence occurred 51 bp downstream of 3'AP. Since 3'AP was a predicted sequence generated from PlOO peptide information, it was inevitable that the terminal portion of the cDNA would contain base errors. The ability of 5'RTP to prime reverse transcription downstream of 3'AP enabled correct sequence determination of this region. Reverse-transcribed material was applied to a 2-ml Bio-Gel A-1.5 m (Bio-Rad, Richmond, CA) column equilibrated previously in 0.5 mM Tris/HCl, pH 8.0, and 0.05 M EDTA. After a void volume of 0.8 ml, 55 one-drop fractions were collected and assayed for radioactivity. Frac- tions from the first radioactive peak (24 - 43) were pooled and dried under reduced pressure. The first-strand cDNA was resuspended in 22 p1 water and incubated for 10 min at 37°C in a 30-p1 tailing reaction [l p16 mM dATP, 6 pl 5 x buffer B (0.5 M sodium cacodylate, pH 7.2, 1 mM dithiothreitol and 10 mM CoCl2) and 15 U terminal deoxynucleotidyl-transfer- ase (Bethesda Research Laboratories, BRL, Gaithersburg, MD)]. The mixture was incubated for 15 rnin at 65°C and finally diluted to 500 p1 with 10 mM Tris/HCl, pH 8.0, and 1 mM EDTA.

Polymerase-chain-reaction amplification of this tailed 5' portion of the cDNA was performed using 25 pmol each of S A P and the dT16 -adaptor primer for 40 cycles (94"C, 40 s ; 54"C, 2 min; 72"C, 3 min). 5'AP was generated from sequence information 13 bp upstream of 5'RTP and was used in place of 5'RTP during polymerase-chain-reaction amplification of first-strand cDNA. This not only prevented any tailed S'RTP present in the cDNA pool from serving as a substrate for the polymerase-chain reaction, but also eliminated amplification of cDNA that could have resulted from mismatched hy- bridization of 5'RTP during reverse transcription [26]. The

(4)

dT16 -adaptor served to prime DNA synthesis from the homopolymer tail.

Northern-blot analysis

Northern blots were prepared using a modification of the technique described by Thomas [29]. Total RNA was isolated from each of the first five stages of X . laevis oocytes, X. laevis A6 kidney cells (ATCC, Rockville, MD) and X . luevis testis using the acid/guanidinium thiocyanate technique [30]. Total RNA (7 pg) from each source was electrophoresed for 5 h at 50 V on a 1% agarose gel containing 0.66 M formaldehyde.

RNA was transferred to a Nytran membrane (Schleicher &

Schuell, Keene, NH) by capillary elution for 12 h in 10-times concentrated 0.15 M NaCl and 15 mM Na3C6H5O7, pH 7 (NaCl/Cit), and subsequently crosslinked to the membrane by ultraviolet light exposure for 5 min. The membrane was prehybridized in 6 x NaCl/Cit, 5 x Denhardt's, 0.5% SDS and 0.1 mg/ml salmon testis DNA at 65°C for 5 h. This was fol- lowed by a 16-h hybridization at 45°C with 10 pmol end- labeled R1 or a 16-h hybridization at 65°C with 100 ng ran- dom-primed labeled 3' and 5' RACE products. The blot, hy- bridized with the R1 oligonucleotides, was washed twice at room temperature and once at 40°C in 6 x NaCl/Cit with 0.1% SDS, while blots hybridized with the RACE products were washed twice at 65°C in 0.2 x NaCl/Cit with 0.1 % SDS.

All blots were exposed to film (X-OMAT AR, Eastman Kodak Co., Rochester, NY) with intensifying screens at - 80°C.

Cloning and sequencing PlOO cDNA

Polymerase-chain-reaction amplified cDNA was ligated into pUC18 using a 2: 1 molar ratio of insert/vector. Ligations were carried out for 10 h at 15 "C with 3 U T4 DNA ligase (Promega, Madison, WI) in a 15-pl reaction volume. Trans- formations of Escherichiu coli XL1-Blue [31] were performed as described by Hanahan [32]. Small-scale isolation of plasmid DNA was performed using the alkaline-lysis method [25].

Sequencing of double-stranded DNA templates [33] was car- ried out by the chain-termination method [34] using a genetic variant of T7 DNA polymerase (USB, Cleveland, OH) [35].

Sequencing primers included forward and reverse universal primers (United States Biochemical, USB, Cleveland, OH) or oligonucleotides generated from PlOO cDNA sequence infor- mation.

Prokaryotic expression of the PlOO fusion protein

Two primers that flanked the start and stop codons of P100 (R15 and R16) were used in the polymerase chain reaction to generate cDNA (R-l5/16) from the reverse-transcribed pool utilized in the amplification of the PlOO 3' cDNA. The R-15/

16 cDNA was ligated into pUC18 and the protein encoded by the plasmid was expressed in E. coli PR13Q (obtained from Dr. Alfred Bothwell, Section of Immunobiology, Yale Univer- sity School of Medicine, New Haven, CT) using a method described for expression in DH5a [36]. Whole-cell lysates were separated on a 7.5% polyacrylamide gel and subsequently transferred to nitrocellulose. The membrane was reacted with either aftinity-purified anti-P100 antibody, anti-P100 sclero- derma patient serum or normal human serum. X . laevis ovary homogenate and lysates from bacteria containing pUCl8 but no insert were included on the blot as controls.

Fig. 1. Detergent solubility of P100. Xenopus ovary homogenates were centrifuged at 100000 x g and the pellet was resuspended in the various detergents at > 50 times the critical micellar concentration. After an additional centrifugation, the supernatant (s) and pellet (p) fractions were subjected to SDS/PAGE, transferred to nitrocellulose and react- ed with affinity-purified anti-Pi00 antibody. The reactivity of Xenopus ovary homogenate (see Materials and Methods) is shown in the posi- tive-control lane (+ control), while the detergent utilized in each trial (Nonidet P-40, SDS, Triton X-100, Tween 20 or Zwittergent) is indicated above each lane. The location of PlOO is shown on the left of the figure. 0.5% SDS resulted in partial solubilization of P100. The protein was totally solubilized with 1 % SDS (data not shown).

Computer software and GenBank accession numbers

Nucleotide and protein sequence analysis were performed with the Genetics Computer Group analysis software package [37l.

RESULTS

Biochemical characterization and purification of the PlOO protein

The PlOO protein was purified from X . laevis ovaries iso- lated from immature 6.5 - 7.5-cm frogs. Although mature ovaries provided a more abundant source of oocyte proteins, the excessive yolk found in late-stage oocytes complicated PlOO purification and interfered with PlOO detection by immunoblotting and were therefore not used. Manipulations performed in the absence of SDS were performed at 4°C while those including SDS were performed at room temperature.

All centrifugations used during purification were performed at 100000 x g for 1 h. All buffers contained 1 mM phenyl- methylsulphonyl fluoride. 1 g ovaries was homogenized in 20 ml 50 mM Tris/HCl, pH 7.5, 25 mM KC1, 5 mM MgCI2, 0.25 mM dithiothreitol and 1 mM phenylmethylsulphonyl flu- oride, followed by centrifugation. Although the supernatant and the pellet both contained P100, as detected by immuno- blotting, the pellet fraction contained the majority of the pro- tein and was therefore utilized for further purification. The PlOO protein was not solubilized in 0.5% Nonidet P-40, 1%

Triton X-100, 1% Tween 20 or 0.5% Zwittergent (Fig. 1).

However, PlOO was partially solubilized in 0.5% SDS (Fig. 1) and was completely solubilized in 1% SDS (data not shown).

The insolubility of PlOO in nonionic detergents was used as an initial step in the purification of this protein. A 5% X.

(5)

- 4 8 0

'320

'160

?

ro

6 4 0

0.6

0 m N

a

0.3 0.1

-0.1

I ' . .

I . . . , . . . I . . . 1 ' . ' I . . . I . . . I . ' . I 0 0 4 8 1 2 1 6 2 0 2 4 2 8 3 2

Fraction no.

Fig. 2. Hydroxyapatite chromatography. After partial purification of PlOO by differential detergent solubilization, the 1 % SDS-soluble proteins were loaded onto a hydroxyapatite column and subsequently eluted with 500 mM NaH2P04/Na2HP04, pH 7. The unbound pro- tein peak (fractions 3 - 12) and the batch-eluted peak (fractions 18 - 25) are shown. The protein absorbance at 280 nm is represented as a solid line with corresponding values shown on the left ordinate. The concentration of NaH2P04/Na2HP04 is identified by dashed line with corresponding values on the right ordinate. The inset shows an immunoblot analysis of the eluted fractions using affinity-purified anti-P100 antibody. PlOO was not identified in other fractions. The molecular mass markers are shown on the left in kDa.

laevis ovary homogenate was centrifuged and the pellet was resuspended in 20 ml 50 mM Tris/HCl, pH 7.5 and 200 mM NaCl containing 0.5% Nonidet P-40, 1% Triton X-100 and 1

YO

Tween 20. This was again centrifuged and the pellet was resuspended in 20 m l 5 0 mM Tris/HCl, pH 7.5, and 200 mM NaCl with 1% SDS followed by a final centrifugation. The SDS-solubilized material was subjected to hydroxyapatite column chromatography. The majority of X . laevis proteins did not bind to the column in 100 mM NaH2P04/Na2HP04 (Fig. 2, fractions 3 - 12). Under these conditions, the PlOO protein bound to the hydroxyapatite and was subsequently eluted with 500 mM NaH2P04/Na2HP04 (Fig. 2, fractions 18 - 26), as shown by immunoblot analysis using anti-P100 antibody affinity purified from PlOO on blots (Fig. 2, inset).

In order to purify PlOO to homogeneity, fractions from the hydroxyapatite column containing the protein were further separated using one-dimensional PAGE. After Coomassie- blue staining, a predominant band was seen at 100 kDa (Fig. 3). To verify that the 100-kDa band contained the PlOO protein, the gel was transferred to nitrocellulose and the mem- brane was reacted with affinity-purified anti-P100 antibody.

Strong reactivity resulted in the 100-kDa band on the blot verifying the presence of PlOO (data not shown). The 100-kDa band was excised for amino acid sequence determination.

Northern-blot analysis

Attempts to obtain the amino-terminal amino acid se- quence from the PlOO protein isolated on immobilon indicated that the amino terminus was blocked. However, partial amino acid sequence information was obtained from the amino ter- mini of three peptides, following trypsin digestion of purified PlOO and reverse-phase HPLC isolation of the fragments. The absence of multiple amino acid residues at the majority of these positions suggested that PlOO had been purified to

Fig. 3. Preparative SDS/PAGE. Following hydroxyapatite chromatography, fractions containing PlOO were subjected to SDS/

PAGE on a 7.5% gel and stained with Coomassie blue in order to visualize protein bands. Molecular mass markers are shown on the left in kDa. The location of PI00 (arrow) was determined by immunoblot analysis on the same sample using affinity-purified anti-P100 antibody (data not shown).

homogeneity. A degenerate oligonucleotide sequence (R1 , Table 1) was derived from one of the peptides and was used in Northern-blot analysis. Since X . laevis ovary was the source of PlOO protein from which the R1 sequence was derived, R1 was tested for the ability to hybridize to polyadenylated mRNA isolated from oocytes. The R1 oligonucleotide hy- bridized to a 2.8-kb transcript present in stage I and stage I1 oocytes (Fig. 4A, lanes 1 and 2) but did not hybridize to RNA from later stage oocytes (lanes 3 - 5), X . laevis testis (lane 6 ) or X . laevis A6 kidney cells (lane 7). The apparent absence of the mRNA in later stages of oogenesis and A6 kidney cells suggested these transcripts are not well represented in somatic cells, while the inability to detect PlOO mRNA in testis indi- cated that PlOO is an oocyte-specific protein.

Cloning and sequencing of PlOO cDNA

The restricted expression of the 2.8-kb mRNA in early oocytes by Northern blot analysis (Fig. 4A) suggested that the PlOO mRNA would be absent or in low abundance in the available Xenopus early embryonic and ovarian libraries. To avoid such a problem, an alternative cloning strategy was utilized which allowed the cloning of specific cDNA in the absence of a cDNA library. This technique, called the RACE method, involved polymerase-chain-reaction amplification of reverse-transcribed oocyte cDNA between an internal, gene- specific priming site and its respective 3' and 5' ends [26].

Reverse-transcribed cDNA was prepared from poly- adenylated RNA isolated from stage I oocytes. This first- strand cDNA served as a template for polymerase-chain-reac- tion amplification of the PlOO 3' end using the internal, gene- specific primer derived from the partial PlOO amino acid se- quence (3'AP) and a nonspecific primer complementary to the 3' end of all reverse transcribed cDNA (adaptor; see Materials and Methods). This amplification yielded a single 1.5-kb prod- uct (data not shown). Since 3'AP was deduced from the amino acid sequence of a random peptide fragment, the size of the

(6)

Fig. 4. Northern blot analysis. Total RNA was isolated from different X . laevis sources followed by gel electrophoresis and transfer to nylon membrane. The membrane was hybridized with radiolabeled R1 oligonucleotide derived from the PlOO amino acid sequence (A) or radiolabeled polymerase-chain-reaction products from the amplification of 3’ and 5’ PlOO cDNA (B and C, respectively). Lanes 1 - 5 contain 7 pg total R N A from stage I -V oocytes, respectively. Lane 6 contains A’. laevis testis RNA and lane 7 contains X. laevis A6 kidney cell RNA. The R N A size (kb) is shown on the right of the figure. The amount of RNA in each lane was consistent as indicated by 28s and 18s rRNA bands visualized on the gel before transfer (data not shown). The hybridization pattern of R1 was identical to the pattern seen when hybridizing with the 3’ and 5’ cDNA species (indicated by arrow).

Pst I Pst I Pst z

I

5‘A

--

1Kb

5‘8

-

5’C

3‘A 3‘B

c__

- - -

7

- -

- - -

- - - - - -

R-15/16

__ __

Fig. 5. Sequencing strategy for the PlOO cDNA. The composite cDNA is shown at the top of the figure including the location of internal PstI sites used in cloning. The shaded box represents a continuous open reading frame with the adjacent thin lines indicating the 5’-un- translated and 3’-untranslated regions. An asterisk identifies the bind- ing site of 3’AP, deduced from the PlOO internal amino acid sequence.

The solid bars represent clones used in constructing the composite cDNA. The 5’ and 3’ designations distinguish between clones obtained from 5’-end and 3’-end amplification, respectively. R15/16 represents

a clone containing only the P100-coding region. Arrows show the sequencing strategy on both strands for each clone.

cDNA generated with this primer could not be predicted. To verify that the 1.5-kb product was from amplification of the correct mRNA, the cDNA was radiolabeled and used as a probe for Northern blot analysis. The 1.5-kb cDNA only hybridized to a 2.8-kb transcript restricted to early stage oocytes (Fig. 4B) which was identical to the hybridization pattern of the R1 oligonucleotide (Fig. 4A).

Partial nucleotide sequencing of this 3’-end cDNA pro- vided sequence information downstream of the 3’AP priming site. To amplify the remaining 5’ portion of PlOO cDNA, a

primer constructed from this sequence information (5’AP) and a primer specific for the 3’ end of the tailed transcript (dT16 -adaptor) were used (see Materials and Methods). A single 1.3-kb product was amplified (data not shown). Again, the radiolabeled polymerase-chain-reaction product hy- bridized solely to a 2.8-kb mRNA in early stage oocytes, identifying the 1.3-kb band as the 5‘ end of the PlOO cDNA (Fig. 4C).

The nucleotide sequence of Pst-1 digested subclones of the 5’ and 3‘ polymerase-chain-reaction amplified PlOO cDNA was determined for both strands (Fig. 5 ) . Since multiple rounds of polymerase-chain-reaction amplification are known to result in an occasional base error [26], the sequence of each region was verified by sequencing a different isolate generated from a separate polymerase chain reaction (data not shown).

Sequencing through the internal Pstl sites of clones containing the entire coding region of PlOO (R-15/16) showed that no fragments had been lost during subcloning.

The sequence of the PlOO cDNA consisted of 2640 bp including a 5‘-untranslated region of 60 bp and a 3‘-un- translated region of 381 bp (Fig. 6). This sequence contained an open reading frame coding for 733 amino acids beginning with the 5’-proximal ATG triplet. This putative initiation codon was preceded by the nucleotide sequence CAAAC, which conforms to the sequence motif for eukaryotic initiation sites [38]. The 3’-untranslated region contained a known processing/polyadenylation signal [39] 8 bp upstream of a 49- bp poly(A) tail (Fig. 6).

Computer analysis of the amino acid sequence deduced from the 2199-bp open reading frame predicted a protein with a molecular mass of 83478 Da and a PI of 5.3. The predicted size of this protein was smaller than the 100-kDa protein identified by immunoblot. The discrepancy could reflect an aberrant electrophoretic mobility or post-translational modi-

Fig. 6. Nucleotide and amino acid sequence of P100. The nucleotide sequence of PlOO is shown with the deduced amino acid sequence indicated by one letter codes. Base numbers are marked on the left and the amino acid number is indicated on the right. The initiating methionine was assigned to the first in-frame ATG codon. The stop codon is shown by an asterisk and the processing/polyadenylation signal is marked with double lines. The three underlined amino acid segments show the location of peptide sequences obtained from purified P100. The composite sequence represents allele A.

(7)

1 A C ? Y 3 T T ? T G m G G G G G ~ , C A G C C ~ G A C T G G T G A C A T T T C C G A A C A A A ~ C C A G A A G A T m

M N L G S E Q I L P E D F 1 3

100 T A C C T G G C A G A A G A G A G C C ' I T G C T A G A ~ ~ T G ~ ~ ~ C G A A G A G A ~ A ~ T G T A ~ n = A G ~ C ~ C ~ A G A C C ~ G A G T C T

Y L A E E G A L L E E M A E E D E E I D L Y N E W T F G L D Q E S 46

1 9 9 G A T G A A G A A C C T G T C A A A C T T G A A G A T G A C C A T A C A A A G C C T A T T C ~ T G C C ~ ~ G C A C C ~ ~ A A G A A G A G C C T G A A G ~ C T A C ~ C C T G T A A A G

D E E P V K L E D D H T K P I Q M P E A P K E E E P E A L Q P V K 7 9

298 G A A G C A A A A G G C T C A G A A A A G G C A C C A C T G C A ~ ~ G T A A A G A T ~ ~ G ~ ~ C C T C A ~ G A ~ A ~ T G G A T C T A T C C A T ~ A T T C ~ A G G T C A T

E A K G S E K A P L H E V K I V V E P H E D H V D L S I D S G G ~112

397 ACGATGAATTCAACCATGGATGATTCAGAGCTTGGAGACCCTGCAGTAATGAAGGCGTTTCATGG~CC~CAC~GAGAGT~GGACAGTGCAGTT

T M N S T M D D S E L G D P A V M K A F H G K P T L E S L D S A V 1 4 5

496 G T T C A G C C C G A C A G ~ G A A T T T C A A C A T G G A G T G A A C T G G T G G C C T ~ G G A G G C A T C T C C ~ ~ ~ T C C

V D S G I G S T W S E L D T D Y D Q S G M D S G L W E A S P K V S 1 7 8

595 A C G T A T G C A A C T G G G C T A T P G G A G G A T A A A G C A A T I Y T C T

T Y A T G Q I L E D K A I L R I M E R A P Y L P P T N L E F L G S 2 1 1

694 C C T C T G C A G A G A G G A m A T G C C ~ C ~ ~ T C C ~ ~ A C C A ~ ~ T G C T A ~ T C T C C C ~ G C C ~ A ~ G A C ~ ~ ~ A ~ A G G C A G C ~

P L Q R G F M P S Q R L Q G P E M G A M S P K P Y R P R F M R Q Q 2 4 4

793 T C A C C T C T T G T A C C A C G C T C A A T G C G T C C A T C A T A C C C C T ~ A C G C C A C C ~ G G A G A G G T C C A T C A G T C T ~ G C C C C A A A T C A G ~ T C C A ~ T T ~ T G

S P L V P R S M R P S Y P F T P P R R G P S V F A P N Q S P G F V 2 7 7

892 T C T C A G A C T C C C T T T A G G C C A A T G T C A C C C A A C C T C A G C A C C C C ~ C C C G A C C ~ T G A C T C C T ~ T G G ~ A G ~ ~ C A C T T ~ C C C ~ ~ T C T C C C

S Q T P F R P M S P N V S T P T R P M T P K M V R M H F G P M S P 3 1 0

9 9 1 AGCCCAAGCTTCTCCCCATTCTTCAGCCCCAGCCCCA~GTAA~CACTGC~GGTTT~GGTTCCAGG~ATG~ACACAGCTGCACCCACAGCATAGAAGG

S P S F S P F F S P M G N A L Q R F K V P G H V T Q L H P Q H R R 3 4 3

1090 A T A C T C A G T C A A C G T C A ~ ~ C ~ A G A G ~ ~ G T C ~ A ~ C A G ~ A ~ G T A ~ C C A ~ C C C ~ A C ~ G A G C T T A A T G T C ~ ~ ~ ~ A G

I L S Q R Q R P Q S S S R R Q W E S R P D P Y A S L M S Q K E K E 3 7 6

1 1 8 9 T G G G T A A T ~ C n = C ~ ~ T A C A G ' I T A C A A A G T G A

W V I K J s O M I O L O S E N P n J, D D Y Y Y O A Y Y E N Jt E R K L 409 1 2 8 8 T C G G A G G A A G A A T T T T T G G G A G A A C G C A A A A A A C G A G A G C C T A C ~ C T ~ T T A C A C C A T A C A T ~ ~ G G C A G A G A C C T A ~ A G T C A G ~ G T T C A C

S E E E F L G E R K K R E P T K L V T P Y I Q K A E T Y E S V V H 4 4 2

1 3 8 7 A T C G A G G G ~ C C C T T G G A C A A G T G G C T G T T T C T A C C ~ C T A C A G C C C A A ~ G A G C ~ T A G A ~ C ~ T T ~ C T A ~ C C A T G C C A G A T G A ~ C T A ? T A A A

I E G S L G Q V A V S T C Y S P R R A I D A V S Y A M P D E A I K 4 7 5

1 4 8 6 G C A C T T G G G T A C C A A A G A T A G ~ C T T A A A C A T G C T T T

A L G Y Q R L R V L K H A E K V F L M F L E V E E L A R K M S H I 5 0 8

1 5 8 5 C C A G A A G A A G A O C A T G T A C A C T T C C A G C A G C A C ~ G C A G A A C T A T ~ G T G C ~ G G A T A T A ~ A T G T C T T ~ G A T ~ C A C C C T G C C A T ~ ~ ~ G ~ G A A

P E E R H V H F O H K Q N Y K V Q R I Y D V L K I A P C H N E E E 5 4 1

1 6 8 4 T C ~ G ~ C A A C T C T A A G ~ ~ ~ C A A G ~ G ~ ~ C ~ ~ C ~ C ~ C A ~ C T A A G G A G T G A G C A ~ T A ~ A G A ~ T C T ~

S E F L Q L L Q V G K G K K L V A R L L P F L R S E Q A R E I L L 5 7 4

1 7 8 3 C T C G T A G T T C A G C A C T T A A C A T A A A G A A ~ A C T C T G C A ~ G A G T C C C ~ T G ~ T ~ A ~ A C C C C T T ~ C T A ~ ~ ~ T C

L V V Q H L T F L I K N D S A E E S L S V L Y G P L K T I F N G L 6 0 7

1 8 8 2 TCCTTCACTGAACTCATCGGAGTCACTCAAGAGCTCACGCTCACGC~CCG~CCAGAGTCTAATGACC~CCTCTTACACT~CG~TCAGAACCAG~GA

S F T E L I G V T Q E L T R P L P E S N D L P L T L A F Q N Q F G 6 4 0

1 9 8 1 A T C T C G C T A T T G T A ~ T T ~ ~ A ~ C A C G G T G A G C T T G C C T A T G G A G C C T T G C A T T G G A G A C T T ? T G G A C C G A T

I S L L Y C L L S H G E R L L S S D L P M E P C I G D F E K W T D 6 1 3

2 0 8 0 A C A G T T T T C A G C C C C C T G G T T G C T A A G G A G C T G T C T C A T G T C T C A A C G T

T V F L V A K E L S H V S K S S M V E P L F L P S N L L S L F C R 7 0 6

2 1 7 9 T A C C T G G A C A A G C A G A C T A T ~ A T T C A T A A A C r P G A G G A C A C

Y L D K Q T I H K L E D K M E C P V I P P Y T A V P S " 7 3 3

2 2 7 8 T T A A G A G G A G A C A A G A C T A T C C T A A C ~ C ~ A C T C A C C A C C A C ~ G ~ A ~ C ~ G ~ A G C ~ T G C ~ ~ A T A ~ ~ T A ~ A ~ C ~ ~ ~

2 3 7 7 A C C T T T T T T ~ ~ C T T T G T T T G T P C A G A C T C O G A T A A G T

2476 T C A C T T T C T G T ' I T A A A T G A T T T G A A A A G C A A G A A A T G T C G A ~ C ~ ~ T A C A G A T G T G T G ~ A G G ~ G G ~ T T G C ~ T ~ T T ~ C T T ~ T G T ~ G T G 2 57 5 TGCTAT'ITGCACAGCA'ITCACCCAATATCATGTACAGCAGCACTTGCWTAAACTGAAAGG ( p o l y A )

(8)

Table 2. PlOO allelic differences. The nucleotide sequence of PlOO allele A is shown in Fig. 6. Nucleic acid substitutions between a second PlOO allele (allele B) are shown along with any corresponding change in the predicted amino acid.

Base Allele A Allele B Amino acid change number

1587 1782 1864 1869 1962 2241 2445 2598

T A C A A A T G

silent silent

ThrlPro-nonconservative silent

silent silent

3’-untranslated 3’-untranslated

fication of the protein in the oocyte (see below). The deduced amino acid sequence contained all three peptide sequences obtained from tryptic peptide fragments of purified PlOO (Fig.

6). This provided definitive evidence that the cDNA amplified by the polymerase chain reaction encoded the isolated PlOO protein. No significant similarity was found between the DNA or amino acid sequence of PlOO and known sequences in nucleic acid and protein data bases, thus identifying PI00 as a novel protein.

Thirteen single-base differences were identified while ver- ifying the PlOO DNA sequence between clones generated from separate polymerase chain reactions. These differences were analyzed by sequencing regions of the R-15/16 clone (Fig. 5).

Initial evidence for allelic variants came from the observation that multiple base differences, occurring in a short region of DNA, were identical between R-15/16 and 3’B cDNA (Fig.

5). Additional R-15/16 clones were sequenced through the same region and two putative alleles (designated A and B) were identified. To distinguish between polymerase chain reaction base-incorporation errors and differences due to allelic vari- ation, each region containing a base difference was sequenced on both R-15/16 alleles (regions of sequence analysis of one R-15/16 allele is shown in Fig. 5). A total of five polymerase- chain-reaction errors were identified, giving an overall error frequency of 0.1 %. The rate of polymerase-chain-reaction error, considering that misincorporation events are propa- gated during each cycle of amplification, can be calculated by the formula e = 2Cf/d), wherefis the observed error frequency and d is the number of doublings or polymerase-chain-reac- tion cycles [40]. Assuming that the error rate was constant during 40 cycles of polymerase-chain-reaction amplification, an error rate of 5 x misincorporations

.

nucleotide-’

. cycle-’ was calculated. Of six allelic base substitutions iden- tified in the coding region, a transversion resulted in a single amino acid change (Table 2). Two additional allelic variations occurred in the 3’-untranslated region.

Expression of PlOO cDNA

To verify the identity of the cDNA clones obtained by the RACE method as P100, the R15/16 clone was expressed in a bacterial system. E. coli PR13Q was transformed with pUC18 containing the R-15/16 insert. A protein of 100 kDa, deter- mined by immunoblot, was expressed in bacteria containing the R-15/16 clone but not in bacteria containingpUC18 with- out an insert (Fig. 7). The expressed protein was recognized by affinity purified anti-P100 antibody (Fig. 7A, lane 2) and

Fig.7. Bacterial protein expression of PlOO cDNA. E. coli strain PR13Q was transformed with a plasmid construct of R-15/16 and whole cell lysates were made from a 24-h culture. These lysates were run on SDS/PAGE, followed by transfer to nitrocellulose. Lane 1 contains X . luevis ovary homogenate as a source of PIOO. Lane 2 contains whole-cell lysate from bacteria transformed with the R-I 5/

16 clone, while lane 3 contains lysate from bacteria transformed with pUCl8 without an insert. (A) Reactivity with affinity-purified anti- PlOO antibody; (B) reactivity with anti-PI00 scleroderma patient serum. C shows the reactivity with normal human serum. The molec- ular mass (kDa) is indicated on the left of the figure and the arrow represents the location of expressed PlOO protein.

Fig. 8. DNA-binding properties of P100. Xenopus ovary homogenate was incubated with single-stranded - DNA-cellulose, double-stranded- DNA - cellulose or cellulose alone. The absorbed homogenate was run on SDS/PAGE, transferred to nitrocellulose and reacted with affinity-purified anti-P100 antibody (A) or scleroderma patient serum with anti-PI00 reactivity (B). Lane 1 contains unabsorbed ovary homogenate while lanes 2, 3 and 4 contain homogenate previously absorbed with cellulose alone, single-stranded-DNA - cellulose or double-stranded-DNA - cellulose, respectively. Lanes 5 , 6 and 7 con- tain 2 M NaCl eluates from cellulose alone, single-stranded-DNA - cellulose and double-stranded-DNA - cellulose, respectively, after ab- sorptions. Numbers to the left of the figure represent protein size in kDa and the location of PlOO is shown on the right.

antibody PlOO patient serum (B, lane 2) but not by normal human serum (C, lane 2). The electrophoretic mobility of the expressed protein was indistinguishable from that of PlOO from X . luevis ovary homogenate (Fig. 7, lane 1). The predict- ed molecular mass of the bacterial expression protein was 85 000 Da, thus indicating an aberrant electrophoretic mi- gration for P100.

PlOO protein binds to DNA

In the course of designing experiments to purify P100, ion- exchange resins and DNA - cellulose were tested for their ability to bind P100. The protein failed to bind carboxymethyl

References

Related documents

The total coliform count from this study range between 25cfu/100ml in Joju and too numerous to count (TNTC) in Oju-Ore, Sango, Okede and Ijamido HH water samples as

Five hundred individuals with no history of liver disease, normal liver laboratory tests and normal image of liver on ultrasound examination were matched for age and sex

The small premature infant who has undergone a sur gical procedure and would have to be fed by gavage is much more easily and safely fed through a gastrostomy tube (Fig. 2)..

There are infinitely many principles of justice (conclusion). 24 “These, Socrates, said Parmenides, are a few, and only a few of the difficulties in which we are involved if

This study includes two different stages; the first one is about the effect of commercial feeding protocol on protease enzyme alteration and the second one is

To study the relationship between nitric oxide and sperm capacitation in vitro , and to provide a theoretical basis for the use of NO-related preparations in improving sperm

DHR: drug hypersensitivity reactions; DTH: non-immediate/delayed-type DHR; MPE: maculopapular eruptions; DRESS: drug reaction with eosinophilia and systemic symptoms;

It was decided that with the presence of such significant red flag signs that she should undergo advanced imaging, in this case an MRI, that revealed an underlying malignancy, which