Light and Clock Expression of the Neurospora Clock Gene
frequency
Is
Differentially Driven by but Dependent on WHITE COLLAR-2
Michael A. Collett,*
,†,1Norm Garceau,*
,2Jay C. Dunlap
†and Jennifer J. Loros*
,†,3*Department of Biochemistry, Dartmouth Medical School, Hanover, New Hampshire 03755 and
†Department of Genetics, Dartmouth Medical School, Hanover, New Hampshire 03755
Manuscript received August 6, 2001 Accepted for publication October 9, 2001
ABSTRACT
Visible light is thought to reset the Neurospora circadian clock by acting through heterodimers of the WHITE COLLAR-1 and WHITE COLLAR-2 proteins to induce transcription of the frequency gene. To characterize this photic entrainment we examinedfrqexpression in constant light, under which condition the mRNA and protein of this clock gene were strongly induced. In continuous illumination FRQ accumu-lated in a highly phosphoryaccumu-lated state similar to that seen at subjective dusk, the time at which a step from constant light to darkness sets the clock. Examination offrqexpression in severalwc-2 mutant alleles surprisingly revealed differential regulation whenfrqexpression was compared between constant light, following a light pulse, and darkness (clock-driven expression). Construction of awc-2null strain then demonstrated that WC-2 is absolutely required for both light and clock-drivenfrqexpression, in contrast to previous expectations based on presumptive nulls containing altered Zn-finger function. Additionally, we found thatfrq light signal transduction differs from that of other light-regulated genes. Thus clock and light-drivenfrqexpression is differentially regulated by, but dependent on, WC-2.
C
IRCADIAN rhythms are self-sustaining oscillations information, allowing prediction and measurement of daily and seasonal changes in the external environment. generated at the cellular level with a period ofⵑ24Environmental signals, such as light, are thought to hr. They are found in a wide range of organisms and
synchronize the molecular oscillations by acting to alter serve a predictive function, allowing an organism to
the levels of the clock components and hence their anticipate daily and seasonal environmental oscillations
position in the oscillation. In fungi and mammals light (Zatz1992;Pittendrigh1993). Daily cycles in
environ-acts to rapidly induce levels of clock gene transcripts mental variables such as light and temperature provide
(Crosthwaiteet al.1995, 1997;Albrechtet al.1997; reference points that synchronize circadian clocks—
Shearmanet al. 1997;Shigeyoshi et al. 1997); in the thus circadian clocks are sensitive to light and
tempera-case of Drosophila this occurs through photic destruc-ture (Edmunds1988). Genetic and molecular analyses
tion of tim (Hunter-Ensor et al. 1996; Myers et al.
have identified a number of genes that are thought
1996;Zenget al. 1996;Ceriani et al. 1999;Naidooet
to encode components of mammalian, insect, fungal,
al.1999). plant, and cyanobacterial clocks (reviewed inDunlap
In Neurospora, the speed, magnitude, and sensitiv-1999; Cermakianand Sassone-Corsi 2000; Johnson
ity of photic entrainment and photic induction of frq
2001;WilliamsandSehgal2001). Such studies have
message correlate precisely (Crosthwaiteet al.1995). established that circadian rhythms are based in part
Moreover, in constant light (LL) there is an override of upon transcription-translation-based negative feedback
negative feedback by FRQ protein on its own transcript loops. In each case, circadian oscillations in the
tran-levels such that frqmRNA levels remain elevated over script levels of specific clock genes (frequencyin fungi,
dark levels. Upon removal of the light stimulus, levels of
kaiAand kaiBC in cyanobacteria, period andtimeless in
frq transcript drop rapidly as FRQ negatively feeds back flies, and themperandmcrygenes in mammals) appear
on its message levels, resetting the clock to a time in the to play a central role in the generation of circadian
cycle that corresponds to the low point of frq mRNA, rhythms (Dunlap1999). The state of the clock protein
subjective dusk. These and other data (Crosthwaite
within the oscillation provides the cell with temporal
et al. 1995) have served as an important paradigm for understanding how light resets the circadian clock of higher eukaryotes (Albrechtet al.1997;Shearmanet
1Present address:New Zealand Dairy Research Institute, Palmerston
North, Private Bag 11029, New Zealand. al.1997;Shigeyoshiet al.1997). However, several
de-2Present address:Pfizer Discovery Technology Center, Cambridge,
tails of this model remain incomplete, particularly the
MA 02138.
response of FRQ to light.
3Corresponding author:Departments of Biochemistry and Genetics,
Mutants of the white collar genes were studied for
Dartmouth Medical School, Hanover, NH 03755.
E-mail: [email protected] their effect on frq light induction to determine their
involvement in light resetting of the Neurospora clock. of plant PAS domain proteins in both light signaling and Thewhite collar-1andwhite collar-2(wc-1andwc-2) loci the circadian clock is well known (Huala et al. 1997; were originally identified as mutations resulting in Somers et al. 1998, 2000;Gu et al. 2000; Briggset al.
blindness for all photoresponses measured (Harding 2001;Jarilloet al.2001).
and Turner 1981; Linden et al. 1997a). It has been Here we characterize the response of FRQ protein to shown that a photoblind allele ofwc-1results in loss of light, finding FRQ strongly induced by light; in constant induction offrqby a light pulse. However, a presumptive light the protein accumulates in a phosphorylated state
wc-2null allele, wc-2(ER33), allowed partial induction similar to that seen at dusk orcircadiantime 12 (CT12) of frq transcription by a light pulse. Thus it was con- in constant dark (DD). The induction mimicked frq
cluded that WC-1 was required for induction offrq by mRNA, with a significant lag between the peak of frq
light, but WC-2 was not (Crosthwaite et al. 1997). mRNA and peak of FRQ, as has also been observed for Despite the induction offrqtranscription by light associ- frqcycles in DD. Examination of light-induced expres-ated with this allele ofwc-2, cycling infrqmRNA or FRQ sion offrqtranscript and protein in awc-2allelic series never followed, leading to the prediction that WC-2 is found the null allele ofwc-2(⌬wc-2), generated by gene a component of the Neurospora circadian clock (Cros- disruption, to have extremely low levels offrqtranscript thwaiteet al.1997). The finding that a partially func- and protein in the dark and to completely lack photore-tional allele ofwc-2 results in period and temperature sponsiveness. Alleles with mutations in the Zn-finger compensation defects concomitant with reduced but DNA-binding domain (Lindenet al.1997a;Collettet rhythmicfrqexpression (Collettet al.2001) and that al.2001) are shown to have partial function dependent FRQ and WC-2 interact in vitroand in vivo(Chenget on the severity of the mutation for photo-induced frq al. 2001; Denault et al. 2001; Merrow et al. 2001) gene expression but not for another light-responsive confirms a clock-critical role for WC-2. gene. Thusfrqinduction by light is dependent on WC-2,
Thewc-1andwc-2loci encode putative transcription
but partially independent of the Zn-finger, suggesting factors containing potential transcriptional activation
that light induction offrqoccurs by a different mecha-domains and GATA-type zinc-fingers (Zn-fingers)
capa-nism from that regulating other light-induced genes in ble of binding DNA sequences in the promoter of the
Neurospora and from that regulatingfrqin the dark.
albino-3(al-3) gene necessary for light induction of its transcript (Ballario et al. 1996;Linden andMacino
1997). WC-1 and WC-2 are nuclear proteins (Talora
MATERIALS AND METHODS
et al.1999;SchwerdtfegerandLinden2000;Cheng
et al.2001;Denaultet al.2001). In addition, they have Strains and growth conditions:General conditions for growth PAS domains (Ballario and Macino 1997; Cros- and manipulation of Neurospora are described elsewhere thwaiteet al.1997;Guet al.2000), which are required (DavisanddeSerres1970;Davis2000). Liquid culture ex-periments were performed as previously described (Luoet al.
for these proteins to form homo- and heterodimersin
1998) with the exception that 1⫻Vogel’s salts were used in all
vitro(Ballarioet al.1998). Additionally, WC-1 and WC-2
experiments. Light treatments were performed as described
associate with one anotherin vivo(Taloraet al.1999;
previously (Crosthwaiteet al.1995).
Cheng et al. 2001; Denault et al. 2001). These data AllNeurospora crassastrains used, includingwc-2(ER24);bd, have led to a model in which heterodimers of WC-1 wc-2(ER44);bd,wc-2(ER33);bd, andwc-2⫹;bd, were generated
and WC-2 regulate the majority of light-induced gene in this laboratory from strains provided by the Fungal Genetics Stock Center (FGSC; ER24 from FGSC4406, ER44 from FGSC
expression in Neurospora (LindenandMacino1997;
4410, and ER33 from FGSC 4408; Degli-Innocenti and
Talora et al. 1999). In darkness WC-1 and WC-2 are
Russo1984a; http://www.fgsc.net), Department of
Microbiol-predicted to cooperate in increasing the levels of frq
ogy, University of Kansas Medical Center (Kansas City, KS).
transcript, consistent with roles as positive-acting com- Construction of strain⌬wc-2; bdis described herein. Thebd ponents of the Neurospora clock (Crosthwaiteet al. mutation, referred to as wild type (WT) throughout, has two
1997; Collett et al. 2001). Similar models based on clear phenotypes, reduced growth rate and increased
conid-iation, and allows clear visualization of circadian rhythmicity
PAS:PAS heterodimer formation of the circadian
tran-on race tubes without affecting the underlying clock
mecha-scriptional activators CLOCK:CYCLE and CLOCK:BMAL
nism (Perkinset al.1982). All our laboratory stocks carry this
have been elucidated in Drosophila and mouse,
respec-mutation and it is not included in strain names in the text.
tively (Alladaet al.1998;Darlingtonet al.1998;
Gek-RNA and protein analysis:RNA analysis was performed as
akis et al. 1998; Rutila et al. 1998). More recently, described previously (Crosthwaiteet al.1995). Western blot VIVID, a small protein of the PAS superfamily that pos- analysis was performed as previously described (Garceauet al. 1997). X-ray films of Northern and Western blots were
sesses most similarity to the PAS domain of WC-1, has
scanned and densitometry was performed using NIH Image
been identified as a negative component of the
Neuro-1.59. For some experiments that gave a wide range of signal
spora light signal transduction pathway, possibly acting
strengths densitometry was performed on long and short
expo-via interaction with WC-1 and/or WC-2 (Schwerdt- sures of blots to obtain readings in the linear range of the film fegerandLinden2000;Heintzenet al.2001;Pando and scanner; these values were then normalized to reference
andSassone-Corsi2001;Shrodeet al.2001).In addi- samples and hence to each other.
Recombinant DNA procedures:Standard recombinant DNA
techniques were carried out according to standard protocols and long forms of FRQ previously observed for FRQ (Sambrooket al.1989). For generation of thewc-2deletion synthesized in DD (Garceauet al.1997).
construct the genomicwc-2clone (X7:12G) was isolated from
The lag between peaks offrqmRNA and FRQ
follow-an ordered cosmid library (Orbach1994) and the 6.75-kb
ing lights on is consistent with the lag observed between
SmaI fragment was cloned into pBM61 (Margolinet al.1997)
to give pABC4b. This plasmid was tested forwc-2function by the peak infrqtranscript and FRQ in free-running
cul-its ability to rescue banding when transformed into strain tures of Neurospora grown in constant darkness ( Gar-his-3 wc-2(ER33); bdand then was digested withEcoRI, and ceauet al.1997) and with the lag in FRQ levels observed fragments corresponding to sequences flanking thewc-2open
whenfrqtranscript is induced from a heterologous
pro-reading frame (ORF) were religated to remove the ORF and
moter (Merrowet al. 1997). Thus this delay between
give pABC5a. The pABC5a construct was then cut withSmaI
and the fragment containing sequences from thewc-2locus the peak infrqmRNA and peak in FRQ appears to be a
was ligated into pZErO-2 (Invitrogen, San Diego) to give general feature of processes regulating FRQ expression. pABC8b, which was partially digested withBglII and ligated to Differential regulation of frq and FRQ in constant aBamHI fragment of pCSN44 carrying thehphgene encoding
dark, constant light, or following a light pulse:To gain
hygromycin resistance (Stabenet al.1989) to give pBP2a. The
further insight into the regulation offrqexpression in
pBP2a construct was then transformed into conidia of
Neuro-spora strainbd;a(87-3) by electroporation and hygromycin- response to light, we examined four different alleles of
resistant transformants were screened for the presence of the wc-2:wc-2⫹,wc-2(ER24),wc-2(ER33), andwc-2(ER44).
deletion allele by PCR with primers BDA13 (AGCACTCGT Alleleswc-2(ER24) andwc-2(ER44) had been identified CCGAGGGCAAA) and LZ1 (CGCCTATCGATAGGAGGAGA).
as probable temperature-sensitive alleles ofwc-2(
Degli-Phosphatase treatment:Protein extracts were incubated in
InnocentiandRusso1984b). The allele wc-2(ER24)
50l of phosphatase buffer alone or with 1000 unitsPPase
(New England Biolabs, Beverly, MA) for 1 hr before Western has a mutation, L489I, which converts a highly
con-blot analysis. served leucine in the WC-2 Zn-finger to an isoleucine.
This mutation results in reduced dark levels offrqmRNA
RESULTS and FRQ and a lengthened period of the circadian clock
(Collettet al.2001). Thewc-2(ER44) allele possesses
FRQ is induced in constant light and progressively
a mutation in the lariat sequence of the first intron of
phosphorylated:A prediction arising from the model
wc-2, which results in almost allwc-2transcripts having for light resetting of the Neurospora clock (
Cros-an unspliced first intron Cros-and drastically reduced levels
thwaiteet al.1995) is that the response of FRQ protein
of WC-2 protein (Collettet al. 2001; D. L.Denault
to light should, following a lag, mimic that offrqmRNA.
and M. A.Collett, unpublished data). Thewc-2(ER33) We found that, broadly speaking, this was the case (Figure
allele has a mutation in the Zn-finger that converts a 1). When Neurospora cultures were placed in LL andfrq
highly conserved glycine into a glutamic acid, almost mRNA and protein were collected at intervals for 24 hr,
certainly rendering the Zn-finger nonfunctional (
Lin-consistent with previous observations (Crosthwaiteet al.
denandMacino1997). Strains carrying this allele are 1995),frqmRNA (Figure 1, A and C) was at high levels
photoblind for most measured light responses (Nelson
within 15 min of lights on. Following the initial strong
et al.1989;Arpaiaet al.1993, 1995b) but have (weak) induction of frq mRNA by the light step, RNA levels
induction of frq mRNA in response to a light pulse drop and on average are higher than levels found in
and low levels of frqmRNA and FRQ in constant dark DD but exhibit a high degree of variability, as reported
(Crosthwaiteet al.1997). previously for frq mRNA in continuous light (
Cros-The levels offrqmRNA and FRQ protein in constant
thwaite et al. 1995). An increase in the quantity of
darkness (see Figures 2 and 3; frq mRNA in DD was FRQ was apparent within 30 min of lights on (a
low-visible only on very long exposures in ER24, ER33, and molecular-weight FRQ band being visible after 30 min
ER44, data not shown) reflected the race tube pheno-in LL, correspondpheno-ing to newly synthesized FRQ, Figure
type of these mutants reported previously (Russo1988; 1B). However, while the quantity offrqmRNA was at a
Crosthwaiteet al.1997;Collettet al.2001). In DD, peak after 15 min in LL, the peak in FRQ quantities
expression in ER33 and ER44 was approximately equiva-was not observed until 4–8 hr after lights on (Figure 1,
lent, slightly lower than the level seen in ER24. Follow-B and D). Experiments performed at other circadian
ing a light pulse (Figure 2) the strains containing alleles times gave results forfrqmRNA and FRQ similar to these
wc-2 (ER33) and wc-2(ER44) both showed a similar re-(data not shown), consistent with previous findings that
sponse: There was an induction offrqmRNA and protein
frq mRNA is light induced at all times of day (
Cros-to a similar level in these strains, but the amount offrq
thwaiteet al.1995).
and FRQ induced was only 40–50% of that observed in A progressive decrease in the mobility of FRQ
synthe-wild type. Wild type andwc-2(ER24) responded almost sized in LL is apparent, as is observed for FRQ in DD.
identically to a light pulse in frq and FRQ induction. To test whether this progressive change in mobility is
Thus, while the alleles wc-2 (ER33), wc-2 (ER24), and due to phosphorylation (as occurs in DD;Garceauet
wc-2 (ER44) all result in lowered expression of frq in
al.1997) we treated Neurospora protein extracts from
constant dark, in response to a light pulse the different LL- and DD-grown cultures withprotein phosphatase
alleles lead to a range offrqexpression levels, withwc-2
(Figure 1E). Phosphatase reduced the smear of FRQ
Figure1.—FRQ is induced by constant light. (A) Representative Northern blots of frq mRNA (and rRNA) in cultures of bd; wc-2⫹. Cultures were incubated in constant light for at least 4 hr, shifted to DD for 21 hr (until CT11), and then either illuminated with 1000 lux of constant light (LL) for the indicated times or held in DD before tissue was vested. Cultures were treated such that, at har-vesting, all cultures had been grown for a simi-lar length of time. (B) Representative Western analysis of FRQ from identical cultures to those in A. The amido black-stained membrane is shown below the FRQ blots to visualize loading. (C) Densitometric analysis of data from A, plot-ting the mean offrqmRNA divided by rRNA⫾ SEM (n⫽3). Open and closed symbols repre-sent LL and DD cultures, respectively. Data from the three experiments were normalized to the DD 0 samples. The DD 0 sample was arbitrarily set at 1.0. (D) Densitometric analysis of data from B, plotting the mean of FRQ divided by amido black⫾ SEM (n⫽ 2). Data from the experiments were normalized to the LL8 sample. Open and closed symbols represent LL and DD samples, respectively. Hours in constant light or circadian time for controls held in darkness are plotted on thex-axis (LL or CT, respectively). (E)protein phosphatase treatment of protein extracts grown in DD or LL. The protein extracts were either held on ice (0⬚) or incubated at 30⬚ in the presence of phosphatase buffer and MnCl2 alone (⫺) or withprotein phosphatase (⫹). DD protein extracts (100g) and LL extracts (50g) were analyzed.
Levels offrqmRNA and FRQ were also monitored in able from wild type in light. The wc-2 (ER33) strain showed reduced frqexpression compared to wild type strains grown in constant light for 24 hr (Figure 3). The
wc-2 (ER33) strain was elevated 10–25% in LLvs. DD under all conditions examined, but exhibited weaker
frqexpression in LL compared to that seen following a compared to the corresponding wild-type response,
which was weaker than induction from a light pulse. light pulse. The wc-2 (ER33) mutation has been re-ported to be blind for induction of all other light-regu-Strainwc-2 (ER44) induction levels in LL were ⵑ50%
of those observed in wild type. The LL levels of frq lated transcripts examined (Nelsonet al.1989;Sommer
et al. 1989;Arpaiaet al. 1993, 1995b;Liand
Schmid-mRNA and FRQ were much higher than DD levels in
the wc-2 (ER24) strain, similar to or greater than LL hauser 1995). This raised several possibilities: Either
wc-2(ER33) possessed the true null phenotype ofwc-2, levels in the wild-type strain. Hence, the regulation of
frqexpression in constant light appears to differ from and WC-2 was not critical forfrqlight induction, or the Zn-finger of WC-2 was less important forfrqexpression the regulation of frqexpression in response to a light
pulse. Specifically the strain containingwc-2(ER33) dis- in light than it is for other light-regulated genes and
wc-2 (ER33) still possessed some function in the light played a very weak expression offrqmRNA and FRQ in
LL but was capable of much stronger expression in signal transduction pathway leading to frq expression. To address this we generated a definitivewc-2null allele response to a light pulse.
These data demonstrate clear differences in the regu- by targeted gene replacement.
Photoinduction offrqexpression requires WC-2:All
lation offrqexpression between cultures grown in DD,
LL, or in response to a light pulse. In thewc-2 (ER24) the alleles of wc-2 that were available to us had the potential to produce WC-2 protein, making it difficult strain frq expression compared to wild type is greatly
Figure2.—Levels offrqmRNA and protein in strains containing variouswc-2alleles following a light pulse (LP). (A) Northern blots offrqmRNA in strains containing wc-2 alleles ER33, ER24, ER44, and wild type. Ethidium bromide (EtBr) staining of rRNA bands on the blotted membrane is shown below the Northern blot. Cultures were treated such that at harvesting all cultures had been grown for a similar length of time. DD con-trols were treated identically to the LP samples, but received no LP. Time in DD varied for each strain dependent on strain period length such that the time of LP fell at CT18. Wild type was held in DD for 28 hr, ER24 for 37 hr, and ER33 and ER44, which are arrhythmic, for the same length of time as wild type. Also included is an ER24 DD28 control (the first ER24 DD sample). All samples were grown at 25⬚. Light pulses were given to groups of four cultures and were stag-gered by 3 min for logistical reasons; thus each lane represents RNA from an individual culture, but the samples for ER33 and WT are duplicated on the left and right blots as reference samples. Due to the high level of variability in amplitude of the response, LP samples are shown in tripli-cate. (B) Western blot of FRQ in strains con-taining wc-2alleles ER33, ER44, ER24, and wild type. Two different exposures are shown to reveal FRQ in DD controls. The amido black-stained membrane is shown below the FRQ blots. Cultures were treated as in A, but tissue was harvested 4 hr after the LP. Each lane represents protein from an individual culture. (C) Densitometric analysis of data in A, relevant samples from Figure 4A and other experiments plotting the amount offrqmRNA normalized against EtBr-stained rRNA. (D) Densito-metric analysis of data in B, relevant LP samples from Figure 4B and other experiments plotting the amount of FRQ normalized against amido black-stained total protein. For C and D,n⫽3–5 for most samples and values shown are the mean⫾SEM. DD samples were quantified from longer exposures of the blots shown and then normalized to reference samples. Solid bars correspond to DD, hatched bars to LP.
generated a null allele ofwc-2by targeted gene disrup- Thus the Zn-finger ofwc-2appears to play a limited role in the induction offrqby light. However, the Zn-finger tion. This disrupted gene (⌬wc-2) deletes the entirewc-2
ORF and replaces a fragment of DNA thought to span clearly plays some role in light-driven expression offrq, as strains containingwc-2(ER33), encoding a substan-the transcriptional start site (LindenandMacino1997)
with a gene encoding hygromycin resistance. Ten pri- tially altered WC-2 Zn-finger, have the most reducedfrq
expression in response to light. mary transformant strains were characterized and 3 of
the 10 were found to be homokaryotic for the⌬wc-2 Long exposures of Western blots comparing protein extracts fromfrq10
(which has the entirefrqORF replaced replacement. Southern analysis revealed these strains
lacked DNA encoding thewc-2ORF and Western analy- byhphand thus produces no FRQ;Aronsonet al.1994) to⌬wc-2revealed trace quantities of FRQ in⌬wc-2(data sis demonstrated a lack of any detectable WC-2 (data
not shown). not shown), indicating that very limitedfrqtranscription still occurs in the absence of WC-2.
Analysis offrqtranscript and FRQ (Figure 4, A and B,
respectively) in a strain containing⌬wc-2demonstrated Alleles of wc-2photoinducible for frq are blind for
another light-induced transcript:Theal-3locus encodes
that WC-2 is absolutely necessary for photic induction
offrqexpression. Unlike the otherwc-2alleles examined a light-responsive gene involved in carotenoid biosyn-thesis. It encodes two transcripts,al-3(c) andal-3(m), herein, no detectable increase in levels offrqmRNA or
protein was observed in this strain either following a driven by two independent promoters (Arpaia et al.
1995a). Theal-3(m) mRNA is expressed specifically in light pulse or in constant light. The previously analyzed
alleles of wc-2, although reported as photoblind, are the mycelia and is induced rapidly by light, with induc-tion kinetics similar tofrq (Arpaia et al. 1995a). This therefore not blind for thefrqlight induction pathway,
Figure3.—Levels in constant light offrqmRNA and protein inwc-2allelic strains. Experimental procedures are as in Figure 2 except where noted. (A) Northern blots offrqmRNA in strains con-tainingwc-2alleles ER33, ER24, ER44, and wild type grown in constant light. Cultures were grown for 4 hr in LL, transferred to DD for 12 hr, re-turned to LL for 24 hr, and then harvested. DD samples were treated identically to LL samples but kept in DD for 36 hr, except for wild type and ER24, which were harvested at times expected to reflect peak dark levels offrq mRNA (DD12 for WT and DD16 for ER24). Each lane represents RNA from an individual culture but the samples for ER33 and WT are duplicated on the left and right blots as reference samples. (B) Western blot of FRQ in strains containingwc-2 alleles ER33, ER44, ER24, and wild type. Two exposures of the blot are shown. Cultures were treated as in A except for DD samples of wild type and ER24, which were harvested at times expected to reflect trough (WT, DD32; ER24, DD41, first DD sam-ples) or peak (WT, DD40; ER24, DD32, second DD samples) dark levels of FRQ. Each lane repre-sents protein from an individual culture. (C) Den-sitometric analysis of data in A and relevant LL samples from Figure 4A, plotting the amount of frqmRNA normalized against EtBr-stained rRNA. (D) Densitometric analysis of data in B and rele-vant LL samples from Figure 4B, plotting the amount of FRQ normalized against amido black-stained total protein. For C and D,n⫽ 3–5 for most samples and values shown are the mean⫾ SEM. DD samples were quantified from longer exposures of the blots shown and then normalized to reference samples. Solid bars correspond to DD, open bars to LL.
taining thewc-2(ER33) allele (Nelsonet al.1989;Som- have shown here that, as expected, FRQ is also strongly induced in response to light, detectable within minutes
meret al.1989;Arpaiaet al.1993, 1995b;Liand
Schmid-hauser 1995), leading to the expectation that these of exposure to light, although full induction takes sev-eral hours. The lag between the peak levels offrqmRNA strains were photoblind. However, given that frqis still
light induced inwc-2(ER33) strains we were interested and protein is similar to that seen for dark expression in comparing the induction ofal-3(m) inwc-2(ER33), (Garceauet al.1997;Merrowet al.1997); thus it
ap-wc-2 (ER24), ⌬wc-2, and wild-type strains following a pears to be a characteristic property of frqexpression. light pulse (Figure 5). The wc-2 (ER33),wc-2 (ER24), Similar lags are also seen in the expression of other clock and⌬wc-2-containing strains were all photoblind when genes [e.g., PER and TIM in Drosophila and mPER1 in assayed usingal-3(m) transcript as a reporter even though, the mouse suprachiasmatic nucleus (SCN); Young
as previously demonstrated herein,frq was induced in 1998;Hastingset al.1999] and most likely play impor-response to light in strains containingwc-2(ER33) and tant roles in the generation of a robust rhythm (Scheper
wc-2(ER24). Therefore, the mechanisms regulatingfrq et al.1999).
in response to light appear to be distinct from those FRQ protein remains elevated over prelight levels for regulatingal-3(m), and the Zn-finger of WC-2 appears at least 24 hr in LL, consistent with the behavioral ar-to be of less importance in frqlight induction than in rhythmicity observed for Neurospora in LL (Sargent
the induction of other light-regulated genes. andBriggs1967). The highly phosphorylated state of FRQ in LL corresponds to the phosphorylation state of FRQ found in late afternoon to early evening in DD
DISCUSSION
circadian time, just prior to its precipitous degradation (Liuet al.2000), and fits well with entrainment of the It was previously demonstrated thatfrqmRNA is
rap-Neurospora clock by LL to DD steps, which set the clock idly and strongly induced in response to a light pulse
to CT12 or dusk. A major difference is thatfrqmRNA and that frq is continuously elevated in constant light
Figure5.—Photoinduction ofal-3(m) transcript is lost in wc-2alleles that remain photoinducible forfrq.Northern blots of the light-induciblefrqandal-3transcripts inbdstrains con-taining alleles (A)wc-2(ER33),wc-2(ER24), andwc-2⫹and (B) wc-2(ER33), ⌬wc-2, and WT are shown. Samples were treated essentially as in Figure 2. EtBr staining of rRNA bands on the blotted membrane is shown below the Northern blot.
sunset, ⵑ12 hr later. FRQ, however, peaks ⵑ4–8 hr after sunrise and is present predominately in a highly phosphorylated state by sunset, at which point it
de-Figure4.—Photoinducible frqexpression is lost in⌬wc-2. grades over several hours, following which frq mRNA
(A) Northern blots of frq mRNA in strains containing wc-2 begins to rise again in anticipation of sunrise. The ele-(ER33);bd,⌬wc-2;bdandwc-2⫹;bd(WT), either following a vated levels of FRQ in LL imply elevated FRQ for the light pulse or grown in constant light. EtBr staining of rRNA
light portion of full photoperiods. This could be
impor-bands on the blotted membrane is shown below the Northern
tant for an organism adapting to different
photoperi-blot. Light-pulsed cultures and LL cultures were treated as in
Figures 2 and 3, respectively, except duplicate cultures were ods. Short days and long nights would lead to a narrower
analyzed. (B) Western blots of FRQ in strains listed in A either peak of FRQ expression, while long days and short following a light pulse or grown in constant light. The positions nights would give a broader peak of FRQ expression. of the long and short FRQ proteins on the gel correspond to
These differences in FRQ expression would also likely
the FRQ label and are just below faint nonspecific bands seen
alter the expression pattern of clock-controlled genes.
in all lanes. The amido black-stained membrane is shown
below the FRQ blots. Light-pulsed cultures and LL cultures Neurospora has proven to be paradigmatic for
under-were treated as in Figures 2 and 3, respectively, except dupli- standing how light resets the mouse circadian clock: cate cultures were analyzed.
Rapid light induction of a clock gene transcript (frqin Neurospora, mPer1 in mice) rapidly phase shifts the clock by changing the phase of the oscillation of this is beginning to drop from peak levels, while in LL the
transcript (Crosthwaite et al. 1995; Albrecht et al.
transcript and protein levels are both elevated. Thus it
1997; Shearman et al. 1997; Shigeyoshi et al. 1997). appears that, rather than the level offrqtranscript alone,
As in Neurospora wherefrqmRNA is elevated over dark the phosphorylation state of FRQ protein is also
respon-levels in LL,mPer1transcript is also elevated over dark sible for setting the phase of the clock following the
levels in constant bright light. However, unlike the situa-light-to-dark step. Only one-half a circadian cycle after
tion in Neurospora wherefrq transcript shows no sig-the light-to-dark shiftfrqmRNA levels are peaking;
how-nificant cycling in LL (Crosthwaite et al. 1995), a ever, it takes a full circadian cycle for the protein to
rhythm inmPer1transcript is apparent in constant bright reach the same phosphorylation state as it had in LL.
light (Shigeyoshi et al. 1997). We have shown here If one extends these data to the context of a full
photo-that FRQ mimics its transcript and remains constantly period, however, the timing of the state of message and
elevated in LL. This has obvious implications for the protein appears more appropriate for a circadian cycle:
waveform of FRQ oscillations in photoperiods of differing Lights on leads to an immediate peak in mRNA, the
output. In a similar manner the waveform ofmPer1tran- to a light pulse and in LL. In addition, wc-2 (ER33) reveals a differential response offrqto a light pulse and script and mPER1 protein differs between LD cycles and
DD. In DD these cycles have a more transient peak than in LL.
An analogy among the circadian systems of Neuro-those found in LD, where a broader peak in message
and protein is observed (Hastingset al. 1999). Thus, spora, Drosophila, and mice is the finding that mice homozygous for mutations in the PAS domain transcrip-much as in Neurospora, light appears to have a sustained
effect on clock gene expression in mice. tion factor CLOCK and flies homozygous for mutations in the PAS domain transcription factors dCLOCK and
White collar-2, along withwc-1, was originally identified
genetically as a component of the light signal transduc- dBMAL have altered photoresponses. This similarity may not be completely unexpected as it is known that tion pathway in Neurospora (HardingandTurner1981).
Several saturating genetic screens for Neurospora mu- WC-1 from Neurospora and BMAL proteins from ani-mals share sequence similarity over the entire BMAL tants blocked in induced carotenogenesis, or
light-induced transcription from theal-3(m) promoter, have amino acid sequence and must share a common evolu-tionary progenitor (Leeet al.2000). Mice lacking fully repeatedly identified onlywc-1andwc-2, making it likely
these are the only nonredundant, nonessential genes functional CLOCK have reduced photoinduction of
mPer1, mPer2, and c-fos in the SCN (Shearman et al.
positively regulating light-induced carotenogenesis in
Neurospora (Degli-InnocentiandRusso1984b;Lin- 1999), while flies mutant fordClockanddBmallack the peak in locomotor activity observed in flies immediately
denet al.1997b). Mutants ofwc-1 andwc-2blocked in
light-induced carotenogenesis have been shown to be following lights on in an LD cycle. This response is not lost in a per or tim null mutant (Allada et al. 1998; blocked in almost all photoresponses, with one notable
exception: Transcripts of the central clock component, Rutilaet al.1998). Within the mouse and Drosophila circadian system these proteins perform an analogous
frequency, are still photoinduced in awc-2mutant blind
for most other measured photoresponses (Cros- function to WC-1 and WC-2, being a positive component of the molecular circadian loop. Thus, like WC-1 and
thwaiteet al.1997). This suggested that light
informa-tion signaling into the clock in Neurospora acted pri- WC-2, these PAS domain-containing transcription fac-tors may be involved in regulating clock-related photore-marily throughwc-1. We have demonstrated herein that
wc-2is also essential forfrqexpression in the light and sponses in mice and flies.
Several lines of evidence suggest that WC-1 and WC-2 dark.
Analyses of fourwc-2alleles uncovered differences in regulate photoresponses as a heterodimeric transcrip-tion factor. Along with their varied roles in light re-the regulation offrqexpression in DD, LL, and in
re-sponse to a light pulse. The⌬wc-2 allele revealed that sponses they are also both involved in regulating frq
expression in the dark. How can the function of WC-1 WC-2 is absolutely necessary forfrqlight induction and
expression in DD. As expected, this allele is also blind and WC-2 infrqlight responses, general light responses (e.g.,al-3transcription), and in regulatingfrqin DD be for induction of al-3 (m). However, wc-2 alleles with
mutations in residues of the Zn-finger, although blind separated? Presumably if WC-1 and WC-2 were solely responsible for induction of light-regulated transcripts for induction of al-3 (m), are photoinducible for frq
expression. This demonstrates a surprising complexity and solely responsible for induction of frq in DD as part of the circadian clock, then all fast light-induced in light-regulated gene expression in Neurospora and
suggests that distinct mechanisms regulate, for instance, transcripts might also be clock regulated, assuming they had comparable stability. However, not all transcripts
al-3 and frq photoinduction. It appears that the role
of the WC-2 Zn-finger in frqphotoinduction is limited that are photoregulated by WC-1 and WC-2 are clock-regulated transcripts [e.g., the al-3 (m) transcript; whereas it may be essential for other light-induced
tran-scripts. Further differences between the regulation of Arpaiaet al.1995a]. Additionally, light and clock regula-tion of eas (ccg-2) transcript act through separate
ele-frqand other light-responsive genes have recently been
demonstrated (Merrow et al. 2001) and are perhaps ments in the eas (ccg-2) promoter (Bell-Pedersen et al.1996a). It is also established that a number of WC-not surprising, as the regulation offrqin LL differs from
other fast light-regulated genes; frq mRNA is continu- dependent clock-regulated genes are not photoinduc-ible (Bell-Pedersen et al.1996b). Also, mutants have ously elevated over dark levels in LL; however, the
tran-scripts of other fast light-regulated genes drop to pre- been isolated that are impaired in only one light re-sponse but not others, indicating the existence of sepa-light levels afterⵑ100 min in LL (Linden et al.1999;
Merrowet al.2001). rate pathways for blue-light responses in Neurospora
(Lindenet al.1997a), and Neurospora has been shown In addition to the differences betweenal-3(m) and
frqphotic regulation, there appear to be differences in to have a bifurcated light input pathway for conidiation and carotenogenesis (Merrow et al. 2001). In agree-the regulation offrqexpression in DD, LL, or following
a light pulse. Thewc-2(ER24) allele, which has reduced ment with these observations, data presented herein reveal that photic regulation of frqis distinct from an-expression of frq in DD (data presented herein and
LOV domains of Neurospora crassa white collar proteins. Mol.
WC-2, and demonstrate distinct regulation offrqin DD,
Microbiol.29:719–729.
LL, and following a light pulse. Hence WC-1 and WC-2 Bell-Pedersen, D., J. C. DunlapandJ. J. Loros, 1996a Distinct cis-appear to be involved in a number of distinct mecha- acting elements mediate clock, light, and developmental regula-tion of theNeurospora crassa eas(ccg-2) gene. Mol. Cell. Biol.16:
nisms regulating gene expression in Neurospora.
As-513–521.
suming heterodimers of WC-1 and WC-2 are solely re- Bell-Pedersen, D., M. Shinohara, J. LorosandJ. C. Dunlap, 1996b sponsible for light-induced expression ofal-3(m) and Circadian clock-controlled genes isolated fromNeurospora crassa
are late night to early morning specific. Proc. Natl. Acad. Sci.
other carotenogenic genes (supported by the lack of other
USA93:13096–13101.
mutants blocked in this pathway despite several saturating Briggs, W. R., C. F. Beck, A. R. Cashmore, J. M. Christie, J. Hughes genetic screens;Degli-InnocentiandRusso1984b;Lin- et al., 2001 The phototropin family of photoreceptors. Plant
Cell13:993–997. denet al.1997b), we could expect a distinct mechanism
Ceriani, M. F., T. K. Darlington, D. Staknis, P. Mas, A. A. Petti
for regulating the clock-specific expression offrq. This et al., 1999 Light-dependent sequestration of TIMELESS by may be mediated by specific transcription factors be- CRYPTOCHROME. Science285:553–556.
Cermakian, N., andP. Sassone-Corsi, 2000 Multilevel regulation
sides WC-1 and WC-2, and additional factors could be
of the circadian clock. Nat. Rev. Mol. Cell Biol.1:59–67.
involved in the light regulation of frq. For instance,
Cheng, P., Y. Yang, C. HeintzenandY. Liu, 2001 Coiled-coil
do-WC-1 and WC-2 could recognize other transcription main-mediated FRQ-FRQ interaction is essential for its circadian function in Neurospora. EMBO J.20:101–108.
factors (e.g., VIVID) that are specific for certain
light-Collett, M. A., J. C. DunlapandJ. J. Loros, 2001 Circadian
clock-regulated genes. This would allow WC-1 and WC-2 to
specific roles for the light response protein WHITE COLLAR-2.
function in light responses, yet also play a role in the Mol. Cell. Biol.21:2619–2628.
Crosthwaite, S. C., J. J. Loros andJ. C. Dunlap, 1995
Light-dark regulation of the clock, and impart specificity on
induced resetting of a circadian clock is mediated by a rapid
the transcription of the appropriate groups of genes.
increase infrequencytranscript. Cell81:1003–1012.
Alternatively, WC-1 and WC-2 could have several mecha- Crosthwaite, S. C., J. C. DunlapandJ. J. Loros, 1997 Neurospora
wc-1andwc-2: transcription, photoresponses, and the origins of
nisms of action, each specific to the regulation of a distinct
circadian rhythmicity. Science276:763–769.
set of genes. Whatever the case, regulation offrq
expres-Darlington, T. K., K. Wager-Smith, M. F. Ceriani, D. Stankis, N.
sion in Neurospora is clearly complex, and WC-2 plays Gekakiset al., 1998 Closing the circadian loop: CLOCK induced an essential role in this process. transcription of its own inhibitors,perandtim. Science280:1599–
1603.
We thank Lina Zhang, Anne Cole, and Brenda Parsons for assistance Davis, R. H., 2000 NEUROSPORA.Oxford University Press, Lon-in constructLon-ing thewc-2deletion allele and members of our laboratory don/New York/Oxford.
for scientific discussion and comments on this manuscript. This work Davis, R. L., andD. deSerres, 1970 Genetic and microbial research was supported by grants from the National Science Foundation (MCB- techniques forNeurospora crassa. Methods Enzymol.27A:79–143. Degli-Innocenti, F., andV. E. A. Russo, 1984a Genetic analysis of 0084509 to J.J.L.), the National Institutes of Health (MH44651 to
blue light-induced responses inNeurospora crassa, pp. 213–219 J.C.D. and J.J.L.; MH01186 and GM34985 to J.C.D.), and the Norris
inBlue Light Effects in Biological Systems, edited by H. Senger. Cotton Cancer Center core grant at Dartmouth Medical School.
Springer-Verlag, Berlin.
Degli-Innocenti, F., andV. Russo, 1984b Isolation of new white collar mutants ofNeurospora crassaand studies on their behavior in the blue light-induced formation of protoperithecia. J. Bacteriol.
LITERATURE CITED 159:757–761.
Denault, D., J. LorosandJ. Dunlap, 2001 WC-2 mediates WC-1-Albrecht, U., Z. Sun, G. EicheleandC. Lee, 1997 A differential
FRQ interaction within the PAS protein-linked circadian feed-response of two putative mammalian circadian regulators,mper1
back loop ofNeurospora. EMBO J.20:109–117. andmper2,to light. Cell91:1055–1064.
Dunlap, J., 1999 Molecular bases for circadian clocks. Cell96:271– Allada, R., N. E. White, W. V. So, J. C. HallandM. Rosbash,
290. 1998 A mutantDrosophilahomolog of mammalianClockdisrupts
Edmunds, Jr., L. N., 1988 Cellular and Molecular Bases of Biological
circadian rhythms and transcription ofperiodandtimeless. Cell
Clocks. Springer-Verlag, New York.
93:791–804.
Garceau, N., Y. Liu, J. J. LorosandJ. C. Dunlap, 1997 Alternative Aronson, B. D., K. A. JohnsonandJ. C. Dunlap, 1994 The circadian
initiation of translation and time-specific phosphorylation yield clock locus frequency: A single ORF defines period length and
multiple forms of the essential clock protein FREQUENCY. Cell temperature compensation. Proc. Natl. Acad. Sci. USA91:7683–
89:469–476. 7687.
Gekakis, N., D. Staknis, H. B. Nguyen, F. C. Davis, L. D. Wilsbacher Arpaia, G., J. J. Loros, J. C. Dunlap, G. MorelliandG. Macino,
et al., 1998 Role of the CLOCK protein in the mammalian circa-1993 The interplay of light and the circadian clock:
indepen-dian mechanism. Science280:1564–1569. dent dual regulation of clock-controlled geneccg-2 (eas). Plant
Gu, Y.-Z., J. B. HogeneschandC. A. Bradfield, 2000 The PAS Physiol.102:1299–1305.
superfamily: sensors of environmental and developmental signals. Arpaia, G., A. CarattoliandG. Macino, 1995a Light and
develop-Annu. Rev. Pharmacol. Toxicol.40:519–561. ment regulate the expression of thealbino-3gene inNeurospora
Harding, R. W., andR. V. Turner, 1981 Photoregulation of the
crassa. Dev. Biol.170:626–635.
carotenoid biosynthetic pathways inalbinoandwhite collarmutants Arpaia, G., J. J. Loros, J. C. Dunlap, G. MorelliandG. Macino,
ofNeurospora crassa. Plant Physiol.68:745–749. 1995b The circadian clock-controlled geneccg-1is induced by
Hastings, M. H., M. D. Field, E. S. Maywood, D. R. WeaverandS. M. light. Mol. Gen. Genet.247:157–163.
Reppert, 1999 Differential regulation of mPER1 and mTIM Ballario, P., andG. Macino, 1997 White collar proteins: PASsing
proteins in the mouse suprachiasmatic nuclei: new insights into the light signal inNeurospora crassa. Trends Microbiol.5:458–462.
a core clock mechanism. J. Neurosci.19:RC11. Ballario, P., P. Vittorioso, A. Magrelli, C. Talora, A. Cabibbo
Heintzen, C., J. J. LorosandJ. C. Dunlap, 2001 The PAS protein
et al., 1996 White collar-1, a central regulator of blue-light
re-VIVID defines a clock-associated feedback loop that represses sponses inNeurospora crassa, is a zinc-finger protein. EMBO J.15:
light input, modulates gating, and regulates clock resetting. Cell 1650–1657.
104:453–464. Ballario, P., C. Talora, D. Galli, H. LindenandG. Macino, 1998
Arabidopsis NPH1: a protein kinase with a putative redox-sensing Russo, V., 1988 Blue light induces circadian rhythms in thebd mu-tant ofNeurospora: double mutantsbd, wc-1andbd, wc-2are blind. domain. Science278:2120–2123.
Hunter-Ensor, M., A. OusleyandA. Sehgal, 1996 Regulation J. Photochem. Photobiol. B2:59–65.
Rutila, J. E., V. Suri, M. Le, W. V. So, M. Rosbashet al., 1998 CYCLE of theDrosophilaprotein TIMELESS suggests a mechanism for
resetting the circadian clock by light. Cell84:677–685. is a second bHLH-PAS clock protein essential for circadian rhyth-micity and transcription ofDrosophila periodandtimeless. Cell93:
Jarillo, J. A., J. Capel, R. H. Tang, H. Q. Yang, J. M. Alonsoet al.,
2001 An Arabidopsis circadian clock component interacts with 805–813.
Sambrook, H., E. F. FritschandT. Maniatis, 1989 Molecular
Clon-both CRY1 and phyB. Nature410:487–490.
Johnson, C. H., 2001 Endogenous timekeepers in photosynthetic ing: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
organisms. Annu. Rev. Physiol.63:695–728.
Lee, K., J. Loros andJ. Dunlap, 2000 Interconnected feedback Sargent, M. L., andW. R. Briggs, 1967 The effect of light on a circadian rhythm of conidiation inNeurospora. Plant Physiol.42:
loops in the Neurospora circadian system. Science289:107–110.
Li, C., andT. J. Schmidhauser, 1995 Developmental and photoreg- 1504–1510.
Scheper, T. O., D. Klinkenberg, J. van PeltandC. Pennartz, 1999 ulation ofal-1andal-2structural genes for two enzymes essential
for carotenoid biosynthesis inNeurospora. Dev. Biol.169:90–95. A model of molecular circadian clocks: multiple mechanisms for phase shifting and a requirement for strong nonlinear interac-Linden, H., andG. Macino, 1997 White collar-2, a partner in
blue-light signal transduction, controlling expression of blue-light-regu- tions. J. Biol. Rhythms14:213–220.
Schwerdtfeger, C., andH. Linden, 2000 Localization and light-lated genes inNeurospora crassa. EMBO J.16:98–109.
Linden, H., P. BallarioandG. Macino, 1997a Blue light regulation dependent phosphorylation of white collar 1 and 2, the two central components of blue light signaling in Neurospora crassa. inNeurospora crassa. Fungal Genet. Biol.22:141–150.
Linden, H., M. Rodriguez-FrancoandG. Macino, 1997b Mutants Eur. J. Biochem.267:414–422.
Shearman, L. P., M. J. Zylka, D. R. Weaver, L. F. Kolakowski, ofNeurospora crassadefective in regulation of blue light
percep-tion. Mol. Gen. Genet.254:111–118. Jr. andS. M. Reppert, 1997 Two period homologs: circadian
expression and photic regulation in the suprachiasmatic nuclei. Linden, H., P. Ballario, G. ArpaiaandG. Macino, 1999 Seeing
the light: news inNeurosporablue light signal transduction. Adv. Neuron19:1261–1269.
Shearman, L. P., M. J. Zylka, S. M. ReppertandD. R. Weaver, 1999 Genet.41:35–54.
Liu, Y., J. LorosandJ. Dunlap, 2000 Phosphorylation of theNeuro- Expression of basic helix-loop-helix/PAS genes in the mouse suprachiasmatic nucleus. Neuroscience89:387–397.
sporaclock protein FREQUENCY determines its degradation rate
Shigeyoshi, Y., K. Taguchi, S. Yamamoto, S. Takeida, L. Yanet al., and strongly influences the period length of the circadian clock.
1997 Light-induced resetting of a mammalian circadian clock Proc. Natl. Acad. Sci. USA97:234–239.
is associated with rapid induction of themPer1transcript. Cell Luo, C., J. J. LorosandJ. C. Dunlap, 1998 Nuclear localization is
91:1043–1053. required for function of the essential clock protein FREQUENCY.
Shrode, L. B., Z. A. Lewis, L. D. White, D. Bell-PedersenandD. J. EMBO J.17:1228–1235.
Ebbole, 2001 vvdis required for light adaptation of conidiation-Margolin, B. S., M. FreitagandE. U. Selker, 1997 Improved
specific genes of Neurospora crassa, but not circadian conid-plasmids for gene targeting at the his-3 locus ofNeurospora crassa
iation. Fungal Genet. Biol.32:169–181. by electroporation. Fungal Genet. Newsl.44:34–36.
Somers, D. E., P. F. DevlinandS. A. Kay, 1998 Phytochromes and Merrow, M., N. GarceauandJ. C. Dunlap, 1997 Dissection of a
cryptochromes in the entrainment of the Arabidopsis circadian circadian oscillation into discrete domains. Proc. Natl. Acad. Sci.
clock. Science282:1488–1490. USA94:3877–3882.
Somers, D. E., T. F. Schultz, M. MilnamowandS. A. Kay, 2000 Merrow, M., L. Franchi, Z. Dragovic, M. Gorl, J. Johnsonet al.,
ZEITLUPE encodes a novel clock-associated PAS protein from 2001 Circadian regulation of the light input pathway in
Neu-Arabidopsis. Cell101:319–329. rospora crassa. EMBO J.20:307–315.
Sommer, T., J. A. A. Chambers, J. Eberle, F. R. LauterandV. E. A. Myers, M., K. Wager-Smith, A. Rothenfluh-Hilfiker and M.
Russo, 1989 Fast light-regulated genes ofNeurospora crassa. Nu-Young, 1996 Light-induced degradation of TIMELESS and
en-cleic Acids Res.17:5713–5723. trainment of theDrosophilacircadian clock. Science271:1736–
Staben, C., B. Jensen, M. Singer, J. Pollack, M. Schechtmanet al., 1740.
1989 Use of a bacterial Hygromycin B resistance gene as a Naidoo, N., W. Song, M. Hunter-EnsorandA. Sehgal, 1999 A
dominant selectable marker in Neurospora crassa transforma-role for the proteasome in the light response of the timeless
tion. Fungal Genet. Newsl.36:79–81. clock protein. Science285:1737–1741.
Talora, C., L. Franchii, H. Linden, P. BallarioandG. Macino, Nelson, M. A., G. Morelli, A. Carattoli, N. RomanoandG. Mac- 1999 Role of a white collar-1-white collar-2 complex in
blue-ino, 1989 Molecular cloning of aNeurospora crassacarotenoid light signal transduction. EMBO J.18:4961–4968.
biosynthetic gene (albino-3) regulated by blue light and the prod- Williams, J. A., andA. Sehgal, 2001 Molecular components of the ucts of thewhite collarlocus. Mol. Cell. Biol.9:1271–1276. circadian system in Drosophila. Annu. Rev. Physiol.63:729–755. Orbach, M. J., 1994 A cosmid with a HyR marker for fungal library Young, M. W., 1998 The molecular control of circadian behavioral construction and screening. Gene150:159–162. rhythms and their entrainment inDrosophila. Annu. Rev. Bio-Pando, M. P., andP. Sassone-Corsi, 2001 Molecular clocks. A vivid chem.67:135–152.
loop of light. Nature410:311–313. Zatz, M. (Editor), 1992 Circadian Rhythms. Elsevier, Amsterdam. Perkins, D. D., A. Radford, D. NewmeyerandM. Bjorkman, 1982 Zeng, H., Z. Qian, M. MyersandM. Rosbash, 1996 A
light-entrain-Chromosomal loci ofNeurospora crassa. Microbiol. Rev.46:426– ment mechanism for theDrosophilacircadian clock. Nature380:
570. 129–135.
Pittendrigh, C. S., 1993 Temporal organization: reflections of a
