• No results found

Light and Clock Expression of the Neurospora Clock Gene frequency Is Differentially Driven by but Dependent on WHITE COLLAR-2

N/A
N/A
Protected

Academic year: 2020

Share "Light and Clock Expression of the Neurospora Clock Gene frequency Is Differentially Driven by but Dependent on WHITE COLLAR-2"

Copied!
10
0
0

Loading.... (view fulltext now)

Full text

(1)

Light and Clock Expression of the Neurospora Clock Gene

frequency

Is

Differentially Driven by but Dependent on WHITE COLLAR-2

Michael A. Collett,*

,†,1

Norm Garceau,*

,2

Jay C. Dunlap

and Jennifer J. Loros*

,†,3

*Department of Biochemistry, Dartmouth Medical School, Hanover, New Hampshire 03755 and

Department of Genetics, Dartmouth Medical School, Hanover, New Hampshire 03755

Manuscript received August 6, 2001 Accepted for publication October 9, 2001

ABSTRACT

Visible light is thought to reset the Neurospora circadian clock by acting through heterodimers of the WHITE COLLAR-1 and WHITE COLLAR-2 proteins to induce transcription of the frequency gene. To characterize this photic entrainment we examinedfrqexpression in constant light, under which condition the mRNA and protein of this clock gene were strongly induced. In continuous illumination FRQ accumu-lated in a highly phosphoryaccumu-lated state similar to that seen at subjective dusk, the time at which a step from constant light to darkness sets the clock. Examination offrqexpression in severalwc-2 mutant alleles surprisingly revealed differential regulation whenfrqexpression was compared between constant light, following a light pulse, and darkness (clock-driven expression). Construction of awc-2null strain then demonstrated that WC-2 is absolutely required for both light and clock-drivenfrqexpression, in contrast to previous expectations based on presumptive nulls containing altered Zn-finger function. Additionally, we found thatfrq light signal transduction differs from that of other light-regulated genes. Thus clock and light-drivenfrqexpression is differentially regulated by, but dependent on, WC-2.

C

IRCADIAN rhythms are self-sustaining oscillations information, allowing prediction and measurement of daily and seasonal changes in the external environment. generated at the cellular level with a period ofⵑ24

Environmental signals, such as light, are thought to hr. They are found in a wide range of organisms and

synchronize the molecular oscillations by acting to alter serve a predictive function, allowing an organism to

the levels of the clock components and hence their anticipate daily and seasonal environmental oscillations

position in the oscillation. In fungi and mammals light (Zatz1992;Pittendrigh1993). Daily cycles in

environ-acts to rapidly induce levels of clock gene transcripts mental variables such as light and temperature provide

(Crosthwaiteet al.1995, 1997;Albrechtet al.1997; reference points that synchronize circadian clocks—

Shearmanet al. 1997;Shigeyoshi et al. 1997); in the thus circadian clocks are sensitive to light and

tempera-case of Drosophila this occurs through photic destruc-ture (Edmunds1988). Genetic and molecular analyses

tion of tim (Hunter-Ensor et al. 1996; Myers et al.

have identified a number of genes that are thought

1996;Zenget al. 1996;Ceriani et al. 1999;Naidooet

to encode components of mammalian, insect, fungal,

al.1999). plant, and cyanobacterial clocks (reviewed inDunlap

In Neurospora, the speed, magnitude, and sensitiv-1999; Cermakianand Sassone-Corsi 2000; Johnson

ity of photic entrainment and photic induction of frq

2001;WilliamsandSehgal2001). Such studies have

message correlate precisely (Crosthwaiteet al.1995). established that circadian rhythms are based in part

Moreover, in constant light (LL) there is an override of upon transcription-translation-based negative feedback

negative feedback by FRQ protein on its own transcript loops. In each case, circadian oscillations in the

tran-levels such that frqmRNA levels remain elevated over script levels of specific clock genes (frequencyin fungi,

dark levels. Upon removal of the light stimulus, levels of

kaiAand kaiBC in cyanobacteria, period andtimeless in

frq transcript drop rapidly as FRQ negatively feeds back flies, and themperandmcrygenes in mammals) appear

on its message levels, resetting the clock to a time in the to play a central role in the generation of circadian

cycle that corresponds to the low point of frq mRNA, rhythms (Dunlap1999). The state of the clock protein

subjective dusk. These and other data (Crosthwaite

within the oscillation provides the cell with temporal

et al. 1995) have served as an important paradigm for understanding how light resets the circadian clock of higher eukaryotes (Albrechtet al.1997;Shearmanet

1Present address:New Zealand Dairy Research Institute, Palmerston

North, Private Bag 11029, New Zealand. al.1997;Shigeyoshiet al.1997). However, several

de-2Present address:Pfizer Discovery Technology Center, Cambridge,

tails of this model remain incomplete, particularly the

MA 02138.

response of FRQ to light.

3Corresponding author:Departments of Biochemistry and Genetics,

Mutants of the white collar genes were studied for

Dartmouth Medical School, Hanover, NH 03755.

E-mail: [email protected] their effect on frq light induction to determine their

(2)

involvement in light resetting of the Neurospora clock. of plant PAS domain proteins in both light signaling and Thewhite collar-1andwhite collar-2(wc-1andwc-2) loci the circadian clock is well known (Huala et al. 1997; were originally identified as mutations resulting in Somers et al. 1998, 2000;Gu et al. 2000; Briggset al.

blindness for all photoresponses measured (Harding 2001;Jarilloet al.2001).

and Turner 1981; Linden et al. 1997a). It has been Here we characterize the response of FRQ protein to shown that a photoblind allele ofwc-1results in loss of light, finding FRQ strongly induced by light; in constant induction offrqby a light pulse. However, a presumptive light the protein accumulates in a phosphorylated state

wc-2null allele, wc-2(ER33), allowed partial induction similar to that seen at dusk orcircadiantime 12 (CT12) of frq transcription by a light pulse. Thus it was con- in constant dark (DD). The induction mimicked frq

cluded that WC-1 was required for induction offrq by mRNA, with a significant lag between the peak of frq

light, but WC-2 was not (Crosthwaite et al. 1997). mRNA and peak of FRQ, as has also been observed for Despite the induction offrqtranscription by light associ- frqcycles in DD. Examination of light-induced expres-ated with this allele ofwc-2, cycling infrqmRNA or FRQ sion offrqtranscript and protein in awc-2allelic series never followed, leading to the prediction that WC-2 is found the null allele ofwc-2(wc-2), generated by gene a component of the Neurospora circadian clock (Cros- disruption, to have extremely low levels offrqtranscript thwaiteet al.1997). The finding that a partially func- and protein in the dark and to completely lack photore-tional allele ofwc-2 results in period and temperature sponsiveness. Alleles with mutations in the Zn-finger compensation defects concomitant with reduced but DNA-binding domain (Lindenet al.1997a;Collettet rhythmicfrqexpression (Collettet al.2001) and that al.2001) are shown to have partial function dependent FRQ and WC-2 interact in vitroand in vivo(Chenget on the severity of the mutation for photo-induced frq al. 2001; Denault et al. 2001; Merrow et al. 2001) gene expression but not for another light-responsive confirms a clock-critical role for WC-2. gene. Thusfrqinduction by light is dependent on WC-2,

Thewc-1andwc-2loci encode putative transcription

but partially independent of the Zn-finger, suggesting factors containing potential transcriptional activation

that light induction offrqoccurs by a different mecha-domains and GATA-type zinc-fingers (Zn-fingers)

capa-nism from that regulating other light-induced genes in ble of binding DNA sequences in the promoter of the

Neurospora and from that regulatingfrqin the dark.

albino-3(al-3) gene necessary for light induction of its transcript (Ballario et al. 1996;Linden andMacino

1997). WC-1 and WC-2 are nuclear proteins (Talora

MATERIALS AND METHODS

et al.1999;SchwerdtfegerandLinden2000;Cheng

et al.2001;Denaultet al.2001). In addition, they have Strains and growth conditions:General conditions for growth PAS domains (Ballario and Macino 1997; Cros- and manipulation of Neurospora are described elsewhere thwaiteet al.1997;Guet al.2000), which are required (DavisanddeSerres1970;Davis2000). Liquid culture ex-periments were performed as previously described (Luoet al.

for these proteins to form homo- and heterodimersin

1998) with the exception that 1⫻Vogel’s salts were used in all

vitro(Ballarioet al.1998). Additionally, WC-1 and WC-2

experiments. Light treatments were performed as described

associate with one anotherin vivo(Taloraet al.1999;

previously (Crosthwaiteet al.1995).

Cheng et al. 2001; Denault et al. 2001). These data AllNeurospora crassastrains used, includingwc-2(ER24);bd, have led to a model in which heterodimers of WC-1 wc-2(ER44);bd,wc-2(ER33);bd, andwc-2;bd, were generated

and WC-2 regulate the majority of light-induced gene in this laboratory from strains provided by the Fungal Genetics Stock Center (FGSC; ER24 from FGSC4406, ER44 from FGSC

expression in Neurospora (LindenandMacino1997;

4410, and ER33 from FGSC 4408; Degli-Innocenti and

Talora et al. 1999). In darkness WC-1 and WC-2 are

Russo1984a; http://www.fgsc.net), Department of

Microbiol-predicted to cooperate in increasing the levels of frq

ogy, University of Kansas Medical Center (Kansas City, KS).

transcript, consistent with roles as positive-acting com- Construction of strainwc-2; bdis described herein. Thebd ponents of the Neurospora clock (Crosthwaiteet al. mutation, referred to as wild type (WT) throughout, has two

1997; Collett et al. 2001). Similar models based on clear phenotypes, reduced growth rate and increased

conid-iation, and allows clear visualization of circadian rhythmicity

PAS:PAS heterodimer formation of the circadian

tran-on race tubes without affecting the underlying clock

mecha-scriptional activators CLOCK:CYCLE and CLOCK:BMAL

nism (Perkinset al.1982). All our laboratory stocks carry this

have been elucidated in Drosophila and mouse,

respec-mutation and it is not included in strain names in the text.

tively (Alladaet al.1998;Darlingtonet al.1998;

Gek-RNA and protein analysis:RNA analysis was performed as

akis et al. 1998; Rutila et al. 1998). More recently, described previously (Crosthwaiteet al.1995). Western blot VIVID, a small protein of the PAS superfamily that pos- analysis was performed as previously described (Garceauet al. 1997). X-ray films of Northern and Western blots were

sesses most similarity to the PAS domain of WC-1, has

scanned and densitometry was performed using NIH Image

been identified as a negative component of the

Neuro-1.59. For some experiments that gave a wide range of signal

spora light signal transduction pathway, possibly acting

strengths densitometry was performed on long and short

expo-via interaction with WC-1 and/or WC-2 (Schwerdt- sures of blots to obtain readings in the linear range of the film fegerandLinden2000;Heintzenet al.2001;Pando and scanner; these values were then normalized to reference

andSassone-Corsi2001;Shrodeet al.2001).In addi- samples and hence to each other.

Recombinant DNA procedures:Standard recombinant DNA

(3)

techniques were carried out according to standard protocols and long forms of FRQ previously observed for FRQ (Sambrooket al.1989). For generation of thewc-2deletion synthesized in DD (Garceauet al.1997).

construct the genomicwc-2clone (X7:12G) was isolated from

The lag between peaks offrqmRNA and FRQ

follow-an ordered cosmid library (Orbach1994) and the 6.75-kb

ing lights on is consistent with the lag observed between

SmaI fragment was cloned into pBM61 (Margolinet al.1997)

to give pABC4b. This plasmid was tested forwc-2function by the peak infrqtranscript and FRQ in free-running

cul-its ability to rescue banding when transformed into strain tures of Neurospora grown in constant darkness ( Gar-his-3 wc-2(ER33); bdand then was digested withEcoRI, and ceauet al.1997) and with the lag in FRQ levels observed fragments corresponding to sequences flanking thewc-2open

whenfrqtranscript is induced from a heterologous

pro-reading frame (ORF) were religated to remove the ORF and

moter (Merrowet al. 1997). Thus this delay between

give pABC5a. The pABC5a construct was then cut withSmaI

and the fragment containing sequences from thewc-2locus the peak infrqmRNA and peak in FRQ appears to be a

was ligated into pZErO-2 (Invitrogen, San Diego) to give general feature of processes regulating FRQ expression. pABC8b, which was partially digested withBglII and ligated to Differential regulation of frq and FRQ in constant aBamHI fragment of pCSN44 carrying thehphgene encoding

dark, constant light, or following a light pulse:To gain

hygromycin resistance (Stabenet al.1989) to give pBP2a. The

further insight into the regulation offrqexpression in

pBP2a construct was then transformed into conidia of

Neuro-spora strainbd;a(87-3) by electroporation and hygromycin- response to light, we examined four different alleles of

resistant transformants were screened for the presence of the wc-2:wc-2,wc-2(ER24),wc-2(ER33), andwc-2(ER44).

deletion allele by PCR with primers BDA13 (AGCACTCGT Alleleswc-2(ER24) andwc-2(ER44) had been identified CCGAGGGCAAA) and LZ1 (CGCCTATCGATAGGAGGAGA).

as probable temperature-sensitive alleles ofwc-2(

Degli-Phosphatase treatment:Protein extracts were incubated in

InnocentiandRusso1984b). The allele wc-2(ER24)

50␮l of phosphatase buffer alone or with 1000 units␭PPase

(New England Biolabs, Beverly, MA) for 1 hr before Western has a mutation, L489I, which converts a highly

con-blot analysis. served leucine in the WC-2 Zn-finger to an isoleucine.

This mutation results in reduced dark levels offrqmRNA

RESULTS and FRQ and a lengthened period of the circadian clock

(Collettet al.2001). Thewc-2(ER44) allele possesses

FRQ is induced in constant light and progressively

a mutation in the lariat sequence of the first intron of

phosphorylated:A prediction arising from the model

wc-2, which results in almost allwc-2transcripts having for light resetting of the Neurospora clock (

Cros-an unspliced first intron Cros-and drastically reduced levels

thwaiteet al.1995) is that the response of FRQ protein

of WC-2 protein (Collettet al. 2001; D. L.Denault

to light should, following a lag, mimic that offrqmRNA.

and M. A.Collett, unpublished data). Thewc-2(ER33) We found that, broadly speaking, this was the case (Figure

allele has a mutation in the Zn-finger that converts a 1). When Neurospora cultures were placed in LL andfrq

highly conserved glycine into a glutamic acid, almost mRNA and protein were collected at intervals for 24 hr,

certainly rendering the Zn-finger nonfunctional (

Lin-consistent with previous observations (Crosthwaiteet al.

denandMacino1997). Strains carrying this allele are 1995),frqmRNA (Figure 1, A and C) was at high levels

photoblind for most measured light responses (Nelson

within 15 min of lights on. Following the initial strong

et al.1989;Arpaiaet al.1993, 1995b) but have (weak) induction of frq mRNA by the light step, RNA levels

induction of frq mRNA in response to a light pulse drop and on average are higher than levels found in

and low levels of frqmRNA and FRQ in constant dark DD but exhibit a high degree of variability, as reported

(Crosthwaiteet al.1997). previously for frq mRNA in continuous light (

Cros-The levels offrqmRNA and FRQ protein in constant

thwaite et al. 1995). An increase in the quantity of

darkness (see Figures 2 and 3; frq mRNA in DD was FRQ was apparent within 30 min of lights on (a

low-visible only on very long exposures in ER24, ER33, and molecular-weight FRQ band being visible after 30 min

ER44, data not shown) reflected the race tube pheno-in LL, correspondpheno-ing to newly synthesized FRQ, Figure

type of these mutants reported previously (Russo1988; 1B). However, while the quantity offrqmRNA was at a

Crosthwaiteet al.1997;Collettet al.2001). In DD, peak after 15 min in LL, the peak in FRQ quantities

expression in ER33 and ER44 was approximately equiva-was not observed until 4–8 hr after lights on (Figure 1,

lent, slightly lower than the level seen in ER24. Follow-B and D). Experiments performed at other circadian

ing a light pulse (Figure 2) the strains containing alleles times gave results forfrqmRNA and FRQ similar to these

wc-2 (ER33) and wc-2(ER44) both showed a similar re-(data not shown), consistent with previous findings that

sponse: There was an induction offrqmRNA and protein

frq mRNA is light induced at all times of day (

Cros-to a similar level in these strains, but the amount offrq

thwaiteet al.1995).

and FRQ induced was only 40–50% of that observed in A progressive decrease in the mobility of FRQ

synthe-wild type. Wild type andwc-2(ER24) responded almost sized in LL is apparent, as is observed for FRQ in DD.

identically to a light pulse in frq and FRQ induction. To test whether this progressive change in mobility is

Thus, while the alleles wc-2 (ER33), wc-2 (ER24), and due to phosphorylation (as occurs in DD;Garceauet

wc-2 (ER44) all result in lowered expression of frq in

al.1997) we treated Neurospora protein extracts from

constant dark, in response to a light pulse the different LL- and DD-grown cultures with␭protein phosphatase

alleles lead to a range offrqexpression levels, withwc-2

(Figure 1E). Phosphatase reduced the smear of FRQ

(4)

Figure1.—FRQ is induced by constant light. (A) Representative Northern blots of frq mRNA (and rRNA) in cultures of bd; wc-2⫹. Cultures were incubated in constant light for at least 4 hr, shifted to DD for 21 hr (until CT11), and then either illuminated with 1000 lux of constant light (LL) for the indicated times or held in DD before tissue was vested. Cultures were treated such that, at har-vesting, all cultures had been grown for a simi-lar length of time. (B) Representative Western analysis of FRQ from identical cultures to those in A. The amido black-stained membrane is shown below the FRQ blots to visualize loading. (C) Densitometric analysis of data from A, plot-ting the mean offrqmRNA divided by rRNA⫾ SEM (n⫽3). Open and closed symbols repre-sent LL and DD cultures, respectively. Data from the three experiments were normalized to the DD 0 samples. The DD 0 sample was arbitrarily set at 1.0. (D) Densitometric analysis of data from B, plotting the mean of FRQ divided by amido black⫾ SEM (n⫽ 2). Data from the experiments were normalized to the LL8 sample. Open and closed symbols represent LL and DD samples, respectively. Hours in constant light or circadian time for controls held in darkness are plotted on thex-axis (LL or CT, respectively). (E)␭protein phosphatase treatment of protein extracts grown in DD or LL. The protein extracts were either held on ice (0⬚) or incubated at 30⬚ in the presence of phosphatase buffer and MnCl2 alone (⫺) or with␭protein phosphatase (⫹). DD protein extracts (100␮g) and LL extracts (50␮g) were analyzed.

Levels offrqmRNA and FRQ were also monitored in able from wild type in light. The wc-2 (ER33) strain showed reduced frqexpression compared to wild type strains grown in constant light for 24 hr (Figure 3). The

wc-2 (ER33) strain was elevated 10–25% in LLvs. DD under all conditions examined, but exhibited weaker

frqexpression in LL compared to that seen following a compared to the corresponding wild-type response,

which was weaker than induction from a light pulse. light pulse. The wc-2 (ER33) mutation has been re-ported to be blind for induction of all other light-regu-Strainwc-2 (ER44) induction levels in LL were ⵑ50%

of those observed in wild type. The LL levels of frq lated transcripts examined (Nelsonet al.1989;Sommer

et al. 1989;Arpaiaet al. 1993, 1995b;Liand

Schmid-mRNA and FRQ were much higher than DD levels in

the wc-2 (ER24) strain, similar to or greater than LL hauser 1995). This raised several possibilities: Either

wc-2(ER33) possessed the true null phenotype ofwc-2, levels in the wild-type strain. Hence, the regulation of

frqexpression in constant light appears to differ from and WC-2 was not critical forfrqlight induction, or the Zn-finger of WC-2 was less important forfrqexpression the regulation of frqexpression in response to a light

pulse. Specifically the strain containingwc-2(ER33) dis- in light than it is for other light-regulated genes and

wc-2 (ER33) still possessed some function in the light played a very weak expression offrqmRNA and FRQ in

LL but was capable of much stronger expression in signal transduction pathway leading to frq expression. To address this we generated a definitivewc-2null allele response to a light pulse.

These data demonstrate clear differences in the regu- by targeted gene replacement.

Photoinduction offrqexpression requires WC-2:All

lation offrqexpression between cultures grown in DD,

LL, or in response to a light pulse. In thewc-2 (ER24) the alleles of wc-2 that were available to us had the potential to produce WC-2 protein, making it difficult strain frq expression compared to wild type is greatly

(5)

Figure2.—Levels offrqmRNA and protein in strains containing variouswc-2alleles following a light pulse (LP). (A) Northern blots offrqmRNA in strains containing wc-2 alleles ER33, ER24, ER44, and wild type. Ethidium bromide (EtBr) staining of rRNA bands on the blotted membrane is shown below the Northern blot. Cultures were treated such that at harvesting all cultures had been grown for a similar length of time. DD con-trols were treated identically to the LP samples, but received no LP. Time in DD varied for each strain dependent on strain period length such that the time of LP fell at CT18. Wild type was held in DD for 28 hr, ER24 for 37 hr, and ER33 and ER44, which are arrhythmic, for the same length of time as wild type. Also included is an ER24 DD28 control (the first ER24 DD sample). All samples were grown at 25⬚. Light pulses were given to groups of four cultures and were stag-gered by 3 min for logistical reasons; thus each lane represents RNA from an individual culture, but the samples for ER33 and WT are duplicated on the left and right blots as reference samples. Due to the high level of variability in amplitude of the response, LP samples are shown in tripli-cate. (B) Western blot of FRQ in strains con-taining wc-2alleles ER33, ER44, ER24, and wild type. Two different exposures are shown to reveal FRQ in DD controls. The amido black-stained membrane is shown below the FRQ blots. Cultures were treated as in A, but tissue was harvested 4 hr after the LP. Each lane represents protein from an individual culture. (C) Densitometric analysis of data in A, relevant samples from Figure 4A and other experiments plotting the amount offrqmRNA normalized against EtBr-stained rRNA. (D) Densito-metric analysis of data in B, relevant LP samples from Figure 4B and other experiments plotting the amount of FRQ normalized against amido black-stained total protein. For C and D,n⫽3–5 for most samples and values shown are the mean⫾SEM. DD samples were quantified from longer exposures of the blots shown and then normalized to reference samples. Solid bars correspond to DD, hatched bars to LP.

generated a null allele ofwc-2by targeted gene disrup- Thus the Zn-finger ofwc-2appears to play a limited role in the induction offrqby light. However, the Zn-finger tion. This disrupted gene (⌬wc-2) deletes the entirewc-2

ORF and replaces a fragment of DNA thought to span clearly plays some role in light-driven expression offrq, as strains containingwc-2(ER33), encoding a substan-the transcriptional start site (LindenandMacino1997)

with a gene encoding hygromycin resistance. Ten pri- tially altered WC-2 Zn-finger, have the most reducedfrq

expression in response to light. mary transformant strains were characterized and 3 of

the 10 were found to be homokaryotic for the⌬wc-2 Long exposures of Western blots comparing protein extracts fromfrq10

(which has the entirefrqORF replaced replacement. Southern analysis revealed these strains

lacked DNA encoding thewc-2ORF and Western analy- byhphand thus produces no FRQ;Aronsonet al.1994) to⌬wc-2revealed trace quantities of FRQ in⌬wc-2(data sis demonstrated a lack of any detectable WC-2 (data

not shown). not shown), indicating that very limitedfrqtranscription still occurs in the absence of WC-2.

Analysis offrqtranscript and FRQ (Figure 4, A and B,

respectively) in a strain containing⌬wc-2demonstrated Alleles of wc-2photoinducible for frq are blind for

another light-induced transcript:Theal-3locus encodes

that WC-2 is absolutely necessary for photic induction

offrqexpression. Unlike the otherwc-2alleles examined a light-responsive gene involved in carotenoid biosyn-thesis. It encodes two transcripts,al-3(c) andal-3(m), herein, no detectable increase in levels offrqmRNA or

protein was observed in this strain either following a driven by two independent promoters (Arpaia et al.

1995a). Theal-3(m) mRNA is expressed specifically in light pulse or in constant light. The previously analyzed

alleles of wc-2, although reported as photoblind, are the mycelia and is induced rapidly by light, with induc-tion kinetics similar tofrq (Arpaia et al. 1995a). This therefore not blind for thefrqlight induction pathway,

(6)

Figure3.—Levels in constant light offrqmRNA and protein inwc-2allelic strains. Experimental procedures are as in Figure 2 except where noted. (A) Northern blots offrqmRNA in strains con-tainingwc-2alleles ER33, ER24, ER44, and wild type grown in constant light. Cultures were grown for 4 hr in LL, transferred to DD for 12 hr, re-turned to LL for 24 hr, and then harvested. DD samples were treated identically to LL samples but kept in DD for 36 hr, except for wild type and ER24, which were harvested at times expected to reflect peak dark levels offrq mRNA (DD12 for WT and DD16 for ER24). Each lane represents RNA from an individual culture but the samples for ER33 and WT are duplicated on the left and right blots as reference samples. (B) Western blot of FRQ in strains containingwc-2 alleles ER33, ER44, ER24, and wild type. Two exposures of the blot are shown. Cultures were treated as in A except for DD samples of wild type and ER24, which were harvested at times expected to reflect trough (WT, DD32; ER24, DD41, first DD sam-ples) or peak (WT, DD40; ER24, DD32, second DD samples) dark levels of FRQ. Each lane repre-sents protein from an individual culture. (C) Den-sitometric analysis of data in A and relevant LL samples from Figure 4A, plotting the amount of frqmRNA normalized against EtBr-stained rRNA. (D) Densitometric analysis of data in B and rele-vant LL samples from Figure 4B, plotting the amount of FRQ normalized against amido black-stained total protein. For C and D,n⫽ 3–5 for most samples and values shown are the mean⫾ SEM. DD samples were quantified from longer exposures of the blots shown and then normalized to reference samples. Solid bars correspond to DD, open bars to LL.

taining thewc-2(ER33) allele (Nelsonet al.1989;Som- have shown here that, as expected, FRQ is also strongly induced in response to light, detectable within minutes

meret al.1989;Arpaiaet al.1993, 1995b;Liand

Schmid-hauser 1995), leading to the expectation that these of exposure to light, although full induction takes sev-eral hours. The lag between the peak levels offrqmRNA strains were photoblind. However, given that frqis still

light induced inwc-2(ER33) strains we were interested and protein is similar to that seen for dark expression in comparing the induction ofal-3(m) inwc-2(ER33), (Garceauet al.1997;Merrowet al.1997); thus it

ap-wc-2 (ER24), ⌬wc-2, and wild-type strains following a pears to be a characteristic property of frqexpression. light pulse (Figure 5). The wc-2 (ER33),wc-2 (ER24), Similar lags are also seen in the expression of other clock and⌬wc-2-containing strains were all photoblind when genes [e.g., PER and TIM in Drosophila and mPER1 in assayed usingal-3(m) transcript as a reporter even though, the mouse suprachiasmatic nucleus (SCN); Young

as previously demonstrated herein,frq was induced in 1998;Hastingset al.1999] and most likely play impor-response to light in strains containingwc-2(ER33) and tant roles in the generation of a robust rhythm (Scheper

wc-2(ER24). Therefore, the mechanisms regulatingfrq et al.1999).

in response to light appear to be distinct from those FRQ protein remains elevated over prelight levels for regulatingal-3(m), and the Zn-finger of WC-2 appears at least 24 hr in LL, consistent with the behavioral ar-to be of less importance in frqlight induction than in rhythmicity observed for Neurospora in LL (Sargent

the induction of other light-regulated genes. andBriggs1967). The highly phosphorylated state of FRQ in LL corresponds to the phosphorylation state of FRQ found in late afternoon to early evening in DD

DISCUSSION

circadian time, just prior to its precipitous degradation (Liuet al.2000), and fits well with entrainment of the It was previously demonstrated thatfrqmRNA is

rap-Neurospora clock by LL to DD steps, which set the clock idly and strongly induced in response to a light pulse

to CT12 or dusk. A major difference is thatfrqmRNA and that frq is continuously elevated in constant light

(7)

Figure5.—Photoinduction ofal-3(m) transcript is lost in wc-2alleles that remain photoinducible forfrq.Northern blots of the light-induciblefrqandal-3transcripts inbdstrains con-taining alleles (A)wc-2(ER33),wc-2(ER24), andwc-2⫹and (B) wc-2(ER33), ⌬wc-2, and WT are shown. Samples were treated essentially as in Figure 2. EtBr staining of rRNA bands on the blotted membrane is shown below the Northern blot.

sunset, ⵑ12 hr later. FRQ, however, peaks ⵑ4–8 hr after sunrise and is present predominately in a highly phosphorylated state by sunset, at which point it

de-Figure4.—Photoinducible frqexpression is lost in⌬wc-2. grades over several hours, following which frq mRNA

(A) Northern blots of frq mRNA in strains containing wc-2 begins to rise again in anticipation of sunrise. The ele-(ER33);bd,⌬wc-2;bdandwc-2⫹;bd(WT), either following a vated levels of FRQ in LL imply elevated FRQ for the light pulse or grown in constant light. EtBr staining of rRNA

light portion of full photoperiods. This could be

impor-bands on the blotted membrane is shown below the Northern

tant for an organism adapting to different

photoperi-blot. Light-pulsed cultures and LL cultures were treated as in

Figures 2 and 3, respectively, except duplicate cultures were ods. Short days and long nights would lead to a narrower

analyzed. (B) Western blots of FRQ in strains listed in A either peak of FRQ expression, while long days and short following a light pulse or grown in constant light. The positions nights would give a broader peak of FRQ expression. of the long and short FRQ proteins on the gel correspond to

These differences in FRQ expression would also likely

the FRQ label and are just below faint nonspecific bands seen

alter the expression pattern of clock-controlled genes.

in all lanes. The amido black-stained membrane is shown

below the FRQ blots. Light-pulsed cultures and LL cultures Neurospora has proven to be paradigmatic for

under-were treated as in Figures 2 and 3, respectively, except dupli- standing how light resets the mouse circadian clock: cate cultures were analyzed.

Rapid light induction of a clock gene transcript (frqin Neurospora, mPer1 in mice) rapidly phase shifts the clock by changing the phase of the oscillation of this is beginning to drop from peak levels, while in LL the

transcript (Crosthwaite et al. 1995; Albrecht et al.

transcript and protein levels are both elevated. Thus it

1997; Shearman et al. 1997; Shigeyoshi et al. 1997). appears that, rather than the level offrqtranscript alone,

As in Neurospora wherefrqmRNA is elevated over dark the phosphorylation state of FRQ protein is also

respon-levels in LL,mPer1transcript is also elevated over dark sible for setting the phase of the clock following the

levels in constant bright light. However, unlike the situa-light-to-dark step. Only one-half a circadian cycle after

tion in Neurospora wherefrq transcript shows no sig-the light-to-dark shiftfrqmRNA levels are peaking;

how-nificant cycling in LL (Crosthwaite et al. 1995), a ever, it takes a full circadian cycle for the protein to

rhythm inmPer1transcript is apparent in constant bright reach the same phosphorylation state as it had in LL.

light (Shigeyoshi et al. 1997). We have shown here If one extends these data to the context of a full

photo-that FRQ mimics its transcript and remains constantly period, however, the timing of the state of message and

elevated in LL. This has obvious implications for the protein appears more appropriate for a circadian cycle:

waveform of FRQ oscillations in photoperiods of differing Lights on leads to an immediate peak in mRNA, the

(8)

output. In a similar manner the waveform ofmPer1tran- to a light pulse and in LL. In addition, wc-2 (ER33) reveals a differential response offrqto a light pulse and script and mPER1 protein differs between LD cycles and

DD. In DD these cycles have a more transient peak than in LL.

An analogy among the circadian systems of Neuro-those found in LD, where a broader peak in message

and protein is observed (Hastingset al. 1999). Thus, spora, Drosophila, and mice is the finding that mice homozygous for mutations in the PAS domain transcrip-much as in Neurospora, light appears to have a sustained

effect on clock gene expression in mice. tion factor CLOCK and flies homozygous for mutations in the PAS domain transcription factors dCLOCK and

White collar-2, along withwc-1, was originally identified

genetically as a component of the light signal transduc- dBMAL have altered photoresponses. This similarity may not be completely unexpected as it is known that tion pathway in Neurospora (HardingandTurner1981).

Several saturating genetic screens for Neurospora mu- WC-1 from Neurospora and BMAL proteins from ani-mals share sequence similarity over the entire BMAL tants blocked in induced carotenogenesis, or

light-induced transcription from theal-3(m) promoter, have amino acid sequence and must share a common evolu-tionary progenitor (Leeet al.2000). Mice lacking fully repeatedly identified onlywc-1andwc-2, making it likely

these are the only nonredundant, nonessential genes functional CLOCK have reduced photoinduction of

mPer1, mPer2, and c-fos in the SCN (Shearman et al.

positively regulating light-induced carotenogenesis in

Neurospora (Degli-InnocentiandRusso1984b;Lin- 1999), while flies mutant fordClockanddBmallack the peak in locomotor activity observed in flies immediately

denet al.1997b). Mutants ofwc-1 andwc-2blocked in

light-induced carotenogenesis have been shown to be following lights on in an LD cycle. This response is not lost in a per or tim null mutant (Allada et al. 1998; blocked in almost all photoresponses, with one notable

exception: Transcripts of the central clock component, Rutilaet al.1998). Within the mouse and Drosophila circadian system these proteins perform an analogous

frequency, are still photoinduced in awc-2mutant blind

for most other measured photoresponses (Cros- function to WC-1 and WC-2, being a positive component of the molecular circadian loop. Thus, like WC-1 and

thwaiteet al.1997). This suggested that light

informa-tion signaling into the clock in Neurospora acted pri- WC-2, these PAS domain-containing transcription fac-tors may be involved in regulating clock-related photore-marily throughwc-1. We have demonstrated herein that

wc-2is also essential forfrqexpression in the light and sponses in mice and flies.

Several lines of evidence suggest that WC-1 and WC-2 dark.

Analyses of fourwc-2alleles uncovered differences in regulate photoresponses as a heterodimeric transcrip-tion factor. Along with their varied roles in light re-the regulation offrqexpression in DD, LL, and in

re-sponse to a light pulse. The⌬wc-2 allele revealed that sponses they are also both involved in regulating frq

expression in the dark. How can the function of WC-1 WC-2 is absolutely necessary forfrqlight induction and

expression in DD. As expected, this allele is also blind and WC-2 infrqlight responses, general light responses (e.g.,al-3transcription), and in regulatingfrqin DD be for induction of al-3 (m). However, wc-2 alleles with

mutations in residues of the Zn-finger, although blind separated? Presumably if WC-1 and WC-2 were solely responsible for induction of light-regulated transcripts for induction of al-3 (m), are photoinducible for frq

expression. This demonstrates a surprising complexity and solely responsible for induction of frq in DD as part of the circadian clock, then all fast light-induced in light-regulated gene expression in Neurospora and

suggests that distinct mechanisms regulate, for instance, transcripts might also be clock regulated, assuming they had comparable stability. However, not all transcripts

al-3 and frq photoinduction. It appears that the role

of the WC-2 Zn-finger in frqphotoinduction is limited that are photoregulated by WC-1 and WC-2 are clock-regulated transcripts [e.g., the al-3 (m) transcript; whereas it may be essential for other light-induced

tran-scripts. Further differences between the regulation of Arpaiaet al.1995a]. Additionally, light and clock regula-tion of eas (ccg-2) transcript act through separate

ele-frqand other light-responsive genes have recently been

demonstrated (Merrow et al. 2001) and are perhaps ments in the eas (ccg-2) promoter (Bell-Pedersen et al.1996a). It is also established that a number of WC-not surprising, as the regulation offrqin LL differs from

other fast light-regulated genes; frq mRNA is continu- dependent clock-regulated genes are not photoinduc-ible (Bell-Pedersen et al.1996b). Also, mutants have ously elevated over dark levels in LL; however, the

tran-scripts of other fast light-regulated genes drop to pre- been isolated that are impaired in only one light re-sponse but not others, indicating the existence of sepa-light levels afterⵑ100 min in LL (Linden et al.1999;

Merrowet al.2001). rate pathways for blue-light responses in Neurospora

(Lindenet al.1997a), and Neurospora has been shown In addition to the differences betweenal-3(m) and

frqphotic regulation, there appear to be differences in to have a bifurcated light input pathway for conidiation and carotenogenesis (Merrow et al. 2001). In agree-the regulation offrqexpression in DD, LL, or following

a light pulse. Thewc-2(ER24) allele, which has reduced ment with these observations, data presented herein reveal that photic regulation of frqis distinct from an-expression of frq in DD (data presented herein and

(9)

LOV domains of Neurospora crassa white collar proteins. Mol.

WC-2, and demonstrate distinct regulation offrqin DD,

Microbiol.29:719–729.

LL, and following a light pulse. Hence WC-1 and WC-2 Bell-Pedersen, D., J. C. DunlapandJ. J. Loros, 1996a Distinct cis-appear to be involved in a number of distinct mecha- acting elements mediate clock, light, and developmental regula-tion of theNeurospora crassa eas(ccg-2) gene. Mol. Cell. Biol.16:

nisms regulating gene expression in Neurospora.

As-513–521.

suming heterodimers of WC-1 and WC-2 are solely re- Bell-Pedersen, D., M. Shinohara, J. LorosandJ. C. Dunlap, 1996b sponsible for light-induced expression ofal-3(m) and Circadian clock-controlled genes isolated fromNeurospora crassa

are late night to early morning specific. Proc. Natl. Acad. Sci.

other carotenogenic genes (supported by the lack of other

USA93:13096–13101.

mutants blocked in this pathway despite several saturating Briggs, W. R., C. F. Beck, A. R. Cashmore, J. M. Christie, J. Hughes genetic screens;Degli-InnocentiandRusso1984b;Lin- et al., 2001 The phototropin family of photoreceptors. Plant

Cell13:993–997. denet al.1997b), we could expect a distinct mechanism

Ceriani, M. F., T. K. Darlington, D. Staknis, P. Mas, A. A. Petti

for regulating the clock-specific expression offrq. This et al., 1999 Light-dependent sequestration of TIMELESS by may be mediated by specific transcription factors be- CRYPTOCHROME. Science285:553–556.

Cermakian, N., andP. Sassone-Corsi, 2000 Multilevel regulation

sides WC-1 and WC-2, and additional factors could be

of the circadian clock. Nat. Rev. Mol. Cell Biol.1:59–67.

involved in the light regulation of frq. For instance,

Cheng, P., Y. Yang, C. HeintzenandY. Liu, 2001 Coiled-coil

do-WC-1 and WC-2 could recognize other transcription main-mediated FRQ-FRQ interaction is essential for its circadian function in Neurospora. EMBO J.20:101–108.

factors (e.g., VIVID) that are specific for certain

light-Collett, M. A., J. C. DunlapandJ. J. Loros, 2001 Circadian

clock-regulated genes. This would allow WC-1 and WC-2 to

specific roles for the light response protein WHITE COLLAR-2.

function in light responses, yet also play a role in the Mol. Cell. Biol.21:2619–2628.

Crosthwaite, S. C., J. J. Loros andJ. C. Dunlap, 1995

Light-dark regulation of the clock, and impart specificity on

induced resetting of a circadian clock is mediated by a rapid

the transcription of the appropriate groups of genes.

increase infrequencytranscript. Cell81:1003–1012.

Alternatively, WC-1 and WC-2 could have several mecha- Crosthwaite, S. C., J. C. DunlapandJ. J. Loros, 1997 Neurospora

wc-1andwc-2: transcription, photoresponses, and the origins of

nisms of action, each specific to the regulation of a distinct

circadian rhythmicity. Science276:763–769.

set of genes. Whatever the case, regulation offrq

expres-Darlington, T. K., K. Wager-Smith, M. F. Ceriani, D. Stankis, N.

sion in Neurospora is clearly complex, and WC-2 plays Gekakiset al., 1998 Closing the circadian loop: CLOCK induced an essential role in this process. transcription of its own inhibitors,perandtim. Science280:1599–

1603.

We thank Lina Zhang, Anne Cole, and Brenda Parsons for assistance Davis, R. H., 2000 NEUROSPORA.Oxford University Press, Lon-in constructLon-ing thewc-2deletion allele and members of our laboratory don/New York/Oxford.

for scientific discussion and comments on this manuscript. This work Davis, R. L., andD. deSerres, 1970 Genetic and microbial research was supported by grants from the National Science Foundation (MCB- techniques forNeurospora crassa. Methods Enzymol.27A:79–143. Degli-Innocenti, F., andV. E. A. Russo, 1984a Genetic analysis of 0084509 to J.J.L.), the National Institutes of Health (MH44651 to

blue light-induced responses inNeurospora crassa, pp. 213–219 J.C.D. and J.J.L.; MH01186 and GM34985 to J.C.D.), and the Norris

inBlue Light Effects in Biological Systems, edited by H. Senger. Cotton Cancer Center core grant at Dartmouth Medical School.

Springer-Verlag, Berlin.

Degli-Innocenti, F., andV. Russo, 1984b Isolation of new white collar mutants ofNeurospora crassaand studies on their behavior in the blue light-induced formation of protoperithecia. J. Bacteriol.

LITERATURE CITED 159:757–761.

Denault, D., J. LorosandJ. Dunlap, 2001 WC-2 mediates WC-1-Albrecht, U., Z. Sun, G. EicheleandC. Lee, 1997 A differential

FRQ interaction within the PAS protein-linked circadian feed-response of two putative mammalian circadian regulators,mper1

back loop ofNeurospora. EMBO J.20:109–117. andmper2,to light. Cell91:1055–1064.

Dunlap, J., 1999 Molecular bases for circadian clocks. Cell96:271– Allada, R., N. E. White, W. V. So, J. C. HallandM. Rosbash,

290. 1998 A mutantDrosophilahomolog of mammalianClockdisrupts

Edmunds, Jr., L. N., 1988 Cellular and Molecular Bases of Biological

circadian rhythms and transcription ofperiodandtimeless. Cell

Clocks. Springer-Verlag, New York.

93:791–804.

Garceau, N., Y. Liu, J. J. LorosandJ. C. Dunlap, 1997 Alternative Aronson, B. D., K. A. JohnsonandJ. C. Dunlap, 1994 The circadian

initiation of translation and time-specific phosphorylation yield clock locus frequency: A single ORF defines period length and

multiple forms of the essential clock protein FREQUENCY. Cell temperature compensation. Proc. Natl. Acad. Sci. USA91:7683–

89:469–476. 7687.

Gekakis, N., D. Staknis, H. B. Nguyen, F. C. Davis, L. D. Wilsbacher Arpaia, G., J. J. Loros, J. C. Dunlap, G. MorelliandG. Macino,

et al., 1998 Role of the CLOCK protein in the mammalian circa-1993 The interplay of light and the circadian clock:

indepen-dian mechanism. Science280:1564–1569. dent dual regulation of clock-controlled geneccg-2 (eas). Plant

Gu, Y.-Z., J. B. HogeneschandC. A. Bradfield, 2000 The PAS Physiol.102:1299–1305.

superfamily: sensors of environmental and developmental signals. Arpaia, G., A. CarattoliandG. Macino, 1995a Light and

develop-Annu. Rev. Pharmacol. Toxicol.40:519–561. ment regulate the expression of thealbino-3gene inNeurospora

Harding, R. W., andR. V. Turner, 1981 Photoregulation of the

crassa. Dev. Biol.170:626–635.

carotenoid biosynthetic pathways inalbinoandwhite collarmutants Arpaia, G., J. J. Loros, J. C. Dunlap, G. MorelliandG. Macino,

ofNeurospora crassa. Plant Physiol.68:745–749. 1995b The circadian clock-controlled geneccg-1is induced by

Hastings, M. H., M. D. Field, E. S. Maywood, D. R. WeaverandS. M. light. Mol. Gen. Genet.247:157–163.

Reppert, 1999 Differential regulation of mPER1 and mTIM Ballario, P., andG. Macino, 1997 White collar proteins: PASsing

proteins in the mouse suprachiasmatic nuclei: new insights into the light signal inNeurospora crassa. Trends Microbiol.5:458–462.

a core clock mechanism. J. Neurosci.19:RC11. Ballario, P., P. Vittorioso, A. Magrelli, C. Talora, A. Cabibbo

Heintzen, C., J. J. LorosandJ. C. Dunlap, 2001 The PAS protein

et al., 1996 White collar-1, a central regulator of blue-light

re-VIVID defines a clock-associated feedback loop that represses sponses inNeurospora crassa, is a zinc-finger protein. EMBO J.15:

light input, modulates gating, and regulates clock resetting. Cell 1650–1657.

104:453–464. Ballario, P., C. Talora, D. Galli, H. LindenandG. Macino, 1998

(10)

Arabidopsis NPH1: a protein kinase with a putative redox-sensing Russo, V., 1988 Blue light induces circadian rhythms in thebd mu-tant ofNeurospora: double mutantsbd, wc-1andbd, wc-2are blind. domain. Science278:2120–2123.

Hunter-Ensor, M., A. OusleyandA. Sehgal, 1996 Regulation J. Photochem. Photobiol. B2:59–65.

Rutila, J. E., V. Suri, M. Le, W. V. So, M. Rosbashet al., 1998 CYCLE of theDrosophilaprotein TIMELESS suggests a mechanism for

resetting the circadian clock by light. Cell84:677–685. is a second bHLH-PAS clock protein essential for circadian rhyth-micity and transcription ofDrosophila periodandtimeless. Cell93:

Jarillo, J. A., J. Capel, R. H. Tang, H. Q. Yang, J. M. Alonsoet al.,

2001 An Arabidopsis circadian clock component interacts with 805–813.

Sambrook, H., E. F. FritschandT. Maniatis, 1989 Molecular

Clon-both CRY1 and phyB. Nature410:487–490.

Johnson, C. H., 2001 Endogenous timekeepers in photosynthetic ing: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

organisms. Annu. Rev. Physiol.63:695–728.

Lee, K., J. Loros andJ. Dunlap, 2000 Interconnected feedback Sargent, M. L., andW. R. Briggs, 1967 The effect of light on a circadian rhythm of conidiation inNeurospora. Plant Physiol.42:

loops in the Neurospora circadian system. Science289:107–110.

Li, C., andT. J. Schmidhauser, 1995 Developmental and photoreg- 1504–1510.

Scheper, T. O., D. Klinkenberg, J. van PeltandC. Pennartz, 1999 ulation ofal-1andal-2structural genes for two enzymes essential

for carotenoid biosynthesis inNeurospora. Dev. Biol.169:90–95. A model of molecular circadian clocks: multiple mechanisms for phase shifting and a requirement for strong nonlinear interac-Linden, H., andG. Macino, 1997 White collar-2, a partner in

blue-light signal transduction, controlling expression of blue-light-regu- tions. J. Biol. Rhythms14:213–220.

Schwerdtfeger, C., andH. Linden, 2000 Localization and light-lated genes inNeurospora crassa. EMBO J.16:98–109.

Linden, H., P. BallarioandG. Macino, 1997a Blue light regulation dependent phosphorylation of white collar 1 and 2, the two central components of blue light signaling in Neurospora crassa. inNeurospora crassa. Fungal Genet. Biol.22:141–150.

Linden, H., M. Rodriguez-FrancoandG. Macino, 1997b Mutants Eur. J. Biochem.267:414–422.

Shearman, L. P., M. J. Zylka, D. R. Weaver, L. F. Kolakowski, ofNeurospora crassadefective in regulation of blue light

percep-tion. Mol. Gen. Genet.254:111–118. Jr. andS. M. Reppert, 1997 Two period homologs: circadian

expression and photic regulation in the suprachiasmatic nuclei. Linden, H., P. Ballario, G. ArpaiaandG. Macino, 1999 Seeing

the light: news inNeurosporablue light signal transduction. Adv. Neuron19:1261–1269.

Shearman, L. P., M. J. Zylka, S. M. ReppertandD. R. Weaver, 1999 Genet.41:35–54.

Liu, Y., J. LorosandJ. Dunlap, 2000 Phosphorylation of theNeuro- Expression of basic helix-loop-helix/PAS genes in the mouse suprachiasmatic nucleus. Neuroscience89:387–397.

sporaclock protein FREQUENCY determines its degradation rate

Shigeyoshi, Y., K. Taguchi, S. Yamamoto, S. Takeida, L. Yanet al., and strongly influences the period length of the circadian clock.

1997 Light-induced resetting of a mammalian circadian clock Proc. Natl. Acad. Sci. USA97:234–239.

is associated with rapid induction of themPer1transcript. Cell Luo, C., J. J. LorosandJ. C. Dunlap, 1998 Nuclear localization is

91:1043–1053. required for function of the essential clock protein FREQUENCY.

Shrode, L. B., Z. A. Lewis, L. D. White, D. Bell-PedersenandD. J. EMBO J.17:1228–1235.

Ebbole, 2001 vvdis required for light adaptation of conidiation-Margolin, B. S., M. FreitagandE. U. Selker, 1997 Improved

specific genes of Neurospora crassa, but not circadian conid-plasmids for gene targeting at the his-3 locus ofNeurospora crassa

iation. Fungal Genet. Biol.32:169–181. by electroporation. Fungal Genet. Newsl.44:34–36.

Somers, D. E., P. F. DevlinandS. A. Kay, 1998 Phytochromes and Merrow, M., N. GarceauandJ. C. Dunlap, 1997 Dissection of a

cryptochromes in the entrainment of the Arabidopsis circadian circadian oscillation into discrete domains. Proc. Natl. Acad. Sci.

clock. Science282:1488–1490. USA94:3877–3882.

Somers, D. E., T. F. Schultz, M. MilnamowandS. A. Kay, 2000 Merrow, M., L. Franchi, Z. Dragovic, M. Gorl, J. Johnsonet al.,

ZEITLUPE encodes a novel clock-associated PAS protein from 2001 Circadian regulation of the light input pathway in

Neu-Arabidopsis. Cell101:319–329. rospora crassa. EMBO J.20:307–315.

Sommer, T., J. A. A. Chambers, J. Eberle, F. R. LauterandV. E. A. Myers, M., K. Wager-Smith, A. Rothenfluh-Hilfiker and M.

Russo, 1989 Fast light-regulated genes ofNeurospora crassa. Nu-Young, 1996 Light-induced degradation of TIMELESS and

en-cleic Acids Res.17:5713–5723. trainment of theDrosophilacircadian clock. Science271:1736–

Staben, C., B. Jensen, M. Singer, J. Pollack, M. Schechtmanet al., 1740.

1989 Use of a bacterial Hygromycin B resistance gene as a Naidoo, N., W. Song, M. Hunter-EnsorandA. Sehgal, 1999 A

dominant selectable marker in Neurospora crassa transforma-role for the proteasome in the light response of the timeless

tion. Fungal Genet. Newsl.36:79–81. clock protein. Science285:1737–1741.

Talora, C., L. Franchii, H. Linden, P. BallarioandG. Macino, Nelson, M. A., G. Morelli, A. Carattoli, N. RomanoandG. Mac- 1999 Role of a white collar-1-white collar-2 complex in

blue-ino, 1989 Molecular cloning of aNeurospora crassacarotenoid light signal transduction. EMBO J.18:4961–4968.

biosynthetic gene (albino-3) regulated by blue light and the prod- Williams, J. A., andA. Sehgal, 2001 Molecular components of the ucts of thewhite collarlocus. Mol. Cell. Biol.9:1271–1276. circadian system in Drosophila. Annu. Rev. Physiol.63:729–755. Orbach, M. J., 1994 A cosmid with a HyR marker for fungal library Young, M. W., 1998 The molecular control of circadian behavioral construction and screening. Gene150:159–162. rhythms and their entrainment inDrosophila. Annu. Rev. Bio-Pando, M. P., andP. Sassone-Corsi, 2001 Molecular clocks. A vivid chem.67:135–152.

loop of light. Nature410:311–313. Zatz, M. (Editor), 1992 Circadian Rhythms. Elsevier, Amsterdam. Perkins, D. D., A. Radford, D. NewmeyerandM. Bjorkman, 1982 Zeng, H., Z. Qian, M. MyersandM. Rosbash, 1996 A

light-entrain-Chromosomal loci ofNeurospora crassa. Microbiol. Rev.46:426– ment mechanism for theDrosophilacircadian clock. Nature380:

570. 129–135.

Pittendrigh, C. S., 1993 Temporal organization: reflections of a

References

Related documents

For this reason, we add group dummies to this reduced form equation for the variance of male wages in the ENIGH sample to obtain a coefficient on the variance of ENEU wages is

In order to clarify our approach, it is important to note that we want to depict a situation in which national governments try to achieve their own interests in a federal assembly.

Enter the first User ID mailbox in which to create the fax application (default value = 7000).. The software creates 24 consecutively-numbered mailboxes, starting with the

A questionnaire was distributed to the library professionals in general, which consists of demographic details, physical and psychological effects, causes, comfort

Why don't you utilize your gizmo or other tool to save this downloaded and install soft data publication The Ultimate Psychometric Test Book By Mike Bryon Through this will

They did not test (statistically) any potential mediating effect of the variables. Even on the level of primary studies, there was frequently no consistent distinction between

CD34 + cells incubated in complement-rich human serum with daratumumab alone or with daratumumab and BRIC229, and then plated in progenitor cell assays, produced similar numbers

18 F-FCH: Fluorine 18- fluorocholine; 99m Tc-sestaMIBI: Technetium 99m- sestamibi; ABR: Adenoma background ratio; ALP: Alkaline phosphatase; BAP: Bone alkaline phosphatase; CKD: