Human Adenosine Deaminase

(1)

THE JOURNAL OF BIOLOGICAL CHEMISTRY

0 1984 by The American Society of Biological Chemists, Inc.

Vol. 259, No. 19, Issue of October 10, pp. 12101-12106,1984 Printed in U.S.A.

Human Adenosine Deaminase

cDNA AND COMPLETE PRIMARY AMINO ACID SEQUENCE*

(Received for publication, March 7, 1984) Peter E. Daddona$, Donna S. ShewachSQ, William N. KelleyS, Patrick Argosll,

Alexander F. MarkhamII, and Stuart H. Orkin**$$

From the $Departments of Internal Medicine and Biological Chemistry, University of Michigan Medical Center, Ann Arbor, Michigan 48109, the Q Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907,

11

Imperial Chemical Industries, Pharmaceutical Diuision, Mereside, Alderly Park, Macclesfield, Cheshire, United Kingdom, and the **Division of Hemutology-Oncology, Children’s Hospital and the Dana Farber Cancer Institute, Department of Pediatrics, Harvard Medical School, Boston, Massachusetts 021 15

A previously cloned partial adenosine deaminase cDNA insert (0.8 kilobase) was used to clone additional nucleotide sequences from human HPB ALL cDNA libraries. cDNA encompassing the entire coding, and 3’-untranslated regions as well as nearly all of the 5’- untranslated region was obtained. The complete amino acid sequence of the enzyme deduced from the cDNA sequence and protein sequencing consists of 362 amino acids, excluding the initiator Met, and accounts for M,

=

40,638. Secondary structure predictions assign adenosine deaminase to the a]D class of proteins. North- ern blot analysis with a cDNA probe showed adenosine deaminase mRNA to be present in normal to above normal amounts in B-lymphoblasts derived from aden- osine deaminase-deficient patients with severe com- bined immunodeficiency disease. Knowledge of the cDNA and primary amino acid sequence of adenosine deaminase will be pivotal in further defining the ge- netic abnormality and its functional consequences in adenosine deaminase expression defects.

Adenosine deaminase is a purine catabolic enzyme which irreversibly deaminates adenosine and deoxyadenosine. The importance of this enzyme to the hematopoietic system is suggested by the following observations. First, in humans a severe genetic deficiency of adenosine deaminase is causally associated with an autosomal recessive form of severe com- bined immunodeficiency disease (1-3). Second, a marked in- crease in adenosine deaminase has been associated with acute lymphoblastic leukemia and with a hereditary form of hemo- lytic anemia (4-7). These findings have stimulated an intense interest in the structure, function, and expression of this enzyme and its gene.

Human adenosine deaminase exists as either a large and/ or small molecular form in various tissues. The small form is a catalytically active protein (Mr = 36,000-38,000) (7). The

large form

(M,

= 298,000) is a complex of the small form and

a nonenzymatic binding protein (8). The adenosine deami-

*This work was supported by Grants ROI-HD-GM 18128 and RO1-AM 19045 from the National Institutes of Health and Grant RO1-CA 26284 from the National Cancer Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “adver- tisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

5

Fellow of the Arthritis Foundation.

$$Recipient of a Research Career Development Award of the National Institutes of Health.

nase-binding protein may function to regulate the clearance of adenosine deaminase from serum and further may anchor

the enzyme to the external surface of the cell membrane

where it can function in regulating plasma adenosine concen-

trations and/or purine nucleoside transport (9,lO). Adenosine

deaminase purified from human erythrocytes is a soluble

monomeric protein with an estimated M , = 38,000 (11, 12).

The enzyme is coded for at a single genetic locus on the long arm of chromosome 20 (13, 14).

An inherited deficiency of adenosine deaminase in its most

extreme form is associated with severe combined immunodeficiency disease. These patients have undetectable enzyme activity in erythrocytes and lymphocytes but may have vari-

able amounts of adenosine deaminase immunoreactive protein

in other tissues (15). A partial genetic deficiency of adenosine deaminase is associated with undetectable enzyme activity in senescent erythrocytes and with partial activity (1-20% of noimal) in peripheral lymphocytes; these subjects are immu- nologically healthy. In these latter cases, mutations in the enzyme have been associated with an electrophoretically al-

tered (16) or an unstable adenosine deaminase protein (17,

18). Recent preliminary studies suggest that an above normal level of adenosine deaminase mRNA is present in a B-lymphoblast cell line derived from a severely and from a partially adenosine deaminase-deficient subject. Further, in both subjects, the mutation appears to be associated with an unstable adenosine deaminase protein (19, 20). For further studies, it will be necessary to have a knowledge of the complete adenosine deaminase amino acid sequence and its gene sequence

to define and understand structural alterations and functional

abnormalities of enzyme variants isolated from patients with partial enzyme deficiency, and to study the structure and expression of the adenosine deaminase gene and mutations leading to immunodeficiency.

We have previously reported the isolation of a partial human adenosine deaminase cDNA gene sequence (0.8-kilobase insert) from a T-cell library using amino acid sequence data to construct a mixed oligonucleotide probe (21). Subse- quently, adenosine deaminase cDNA sequences have been cloned by others from deoxycoformycin-resistant rat hepa- toma (22) and mouse T-lymphoblast (23) cell lines and from

human T-lymphoblast cDNA libraries (20,24). Here we report

an essentially complete human adenosine deaminase cDNA sequence, the complete amino acid sequence and protein secondary structure predictions.

EXPERIMENTAL PROCEDURES

Construction of cDNA Clones-mRNA was used to construct an

12101

(2)

12102

Adenosine Deaminase

Sequence

HPB ALL cDNA library inserted into the PstI site of pBR322 plasmid as described previously (21). Aliquots of the library were screened with DNA fragments prepared from the original cDNA clone (21), from additional adenosine deaminase cDNAs, or with synthetic 17- mer oligonucleotides (see below). Plasmid DNAs were isolated by routine procedures (25). DNA sequencing was performed according to Maxam and Gilbert (26). Primer extension analysis and S1 nu- clease mapping were carried out according to Treisman et al. (27).

Adenosine Deaminase Protein Sequencing and Analysis-Human erythrocytic adenosine deaminase was purified 800,000-fold from 400 units of pooled blood obtained from the American Red Cross (12). The purified enzyme (512 pmol/min/mg) was >95% pure as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. For protein digest, purified erythrocyte adenosine deaminase was reduced and S-pyridylethylated. Enzyme (0.75-2 mg, 18-60 nmol) was di- gested with ~-l-tosylamido-2-phenylethyl chloromethyl ketone- treated trypsin or with cyanogen bromide as previously described (21). Peptides were isolated by reverse-phase high-pressure liquid chromatography and were assessed for purity by NHg-terminal analysis. Manual Edman degradation was performed on purified peptides according to the methods of Tarr (28,29). Amino acid analysis of the intact protein was performed as previously described (12).

RNA Isolation and Quantitation-Total RNA was isolated from

cultured human B-lymphoblast cell lines derived from normal indi- viduals (GM 333 and GM 558), from patients with adenosine deaminase deficiency and severe combined immunodeficiency disease (GM 4258, 2825, 1715, 2756, 2471, and 2606) and from a patient with adenosine deaminase deficiency and null cell leukemia (DHL-9) (30). The GM-designated lymphoblast cell lines were obtained from the Human Genetic Mutant Cell Repository, Camden, NJ. All cell lines were cultured in RPMI 1640 medium containing 10% horse serum and harvested during log phase growth. Total RNA was isolated by the method of Palmiter (31). mRNA was isolated by oligo(dT) chro- matography according to Aviv and Leder (32). Total mRNA was fractionated on a 1% agarose-formaldehyde gel with Northern blot- ting performed according to Maniatis et al. (25). The blot was hybridized to the nick-translated insert fragment of pHADA-1 (21) and visualized by autoradiography. mRNA bands were quantitated using an Ortec 4310 scanning densitometer. Blots were stripped according to Thomas (33) and reprobed to quantitate phosphoglycerate kinase mRNA using the nick-translated cDNA probe, pHPGK-7e (34).

Adenosine Deaminase Secondary Structure Prediction+”he predicted adenosine deaminase secondary structural regions were determined from smoothed curves of the amino acid conformational pref- erence parameters as calculated by Palau et al. (35). The structural potentials are ratios of an amino acid’s composition within a given secondary structural type to that of the entire protein data base. The data sample consisted of 44 known tertiary structures (determined by x-ray crystallographic techniques) comprised of 8898 residues. The potentials for each amino acid are, by definition, normalized to 1.00 such that values greater than 1.00 suggest a residue’s preference to be within a particular secondary structure while those less than 1.00 indicate a general avoidance. Plots of the adenosine deaminase amino acid sequence number uersw the corresponding residue’s potential for each of the three secondary structural types were smoothed by calculation of the best least-squares line through all successive five- point clusters ((i) to (i

+

4)); the smoothing process consisted of three cycles, each utilizing the least-squares values calculated from the previous cycle. The two N- and the two C-terminal values were respectively determined from the lines calculated for points 1 to 5 and 358 to 362.

RESULTS AND DISCUSSION

The complete primary protein structure has been deduced from sequences of cloned adenosine deaminase cDNAs combined with direct peptide sequencing analysis.

Adenosine Deaminase cDNA Sequences-cDNA clones used in assembling the adenosine deaminase sequence are illus-

trated in Fig. 1. From the 0.8-kb’ insert previously cloned and

described (21), designated Dl, in Fig. 1, a 3’ 170 PstI fragment

was used to rescreen the HPB ALL-cDNA library. Several

clones were chosen and sequenced at their 3’ end. Clone C10 contained a short poly(A) tail preceded by a poly(A) addition

~ ~

The abbreviations used are: kb, kilobase; bp, base pair.

5’

-

coding region 3’ ”

a

-4o+

-

“

4-4 w Dl

-

CIO

-

A 3

E3

-

200 bp

FIG. 1. Linear map of adenosine deaminase cDNA clones. The coding region from the initiator ATG (nucleotides 77-79 of Fig.

2) to the translation terminator is hatch-marked. Dl, ClO, A3, and

E3 refer to various isolated cDNA clones. Restriction sites from

which Maxam-Gilbert sequencing were performed are indicated. 0, sites labeled at the 3’ ends of the DNA. 0, labeled at the 5’ ends. The bold portion of the restriction map includes those sequences belonging to adenosine deaminase mRNA. The 5’-most 250 nucleo- tides of clone E3 are derived from another unknown mRNA species via a cloning artifact (see text).

signal AATAAA (36). This clone therefore completes the entire 3’-untranslated region which totals 313 nucleotides (see Fig. 2). Where C10 overlapped the original cDNA clone, no differences in the DNA sequence were found. Using the larger of the two PsB plus BglII fragments of clone D l as probe, clone A3 was isolated. A unique 17-mer oligonucleotide complementary to the sequence GCCTATGAGTTTGTAGA, which was contained within this clone at nucleotides 324-340

in Fig. 2 was used as a primer on MOLT-4 mRNA as template.

A major extension product of about 350 nucleotides was observed (not shown). Direct sequencing of this transcript yielded a sequence identical to that found in clone A3 (shown by the open box and arrow in Fig. 1). With this unique 17- mer as probe, the cDNA library was rescreened and clone E3 was isolated.

The entire cDNA insert of clone E3 was sequenced (Fig. 1).

When aligned with the sequence of clone A3 and Dl, it was apparent that its 5‘ extent was unexpectedly large given the primer extension findings above. To resolve this discrepancy, primer extension analysis of MOLT-4 mRNA was repeated using a restriction fragment from clone E3 and S1 nuclease- mapping experiments were performed. Primer extension analysis using a 5’-end labeled BanHI-NcoI fragment of clone E3 yielded a transcript of 150 nucleotides (Fig. 3, lane I). Second, S1 nuclease mapping using a fragment 5’-end labeled at the BamHI site and extending to the PstI site at the 5‘ end of the

cloned insert yielded protected fragments of about 136 nu-

cleotides in length (Fig. 3, lane 2). These results demonstrate that the 5’-most 250 nucleotides of clone E3 were not derived from adenosine deaminase mRNA but represented a cloning artifact, presumably arising during second strand synthesis. In support of this conclusion, a 17-mer oligonucleotide complementary to nucleotides 25-40 of the 5’ end of clone E3 hybridized to a 1.2-kb mRNA species present in both MOLT- 4 and HeLa cells, but not to the 1.6-1.8-kb adenosine deaminase mRNA (see below for adenosine deaminase Northern

blots). Only 10-15 nucleotides at the extreme 5‘ end of

(3)

Adenosine Deaminase Sequence

12103 1 97 193 289 385 48 1 511 673 769 865 96 1 1057 1153 1249 1345 1441 CGACAAGCCCAAAGTAGAACTGCATCTCCACCTAGACGGATCCATCAAGCCTGAAACCATCTTATACTATGGCAGGAGGAGAGGGATCGCCCTCCC A ~ p L y r P r o L y s V ~ 1 G l u L e u R i ~ V ~ l ~ i ~ L ~ u A s p G l y S e r I l ~ L y s P r o G l ~ T h ~ I l ~ L ~ ~ T y ~ T y ~ G l y A I ~ A 1 ~ A ~ ~ G l y I l e A l ~ L ~ n P ~ 0 AGCTAACACAGCAGAGGGGCTGCTGAACGTCATTGGCATGGACAAGCCGCTCACCCTTCCAGACTTCCTGGCCAAATTTGACTACTACATGCCTGC A l ~ A s n T h r A l ~ G 1 u G l y L e u L c u A s n V ~ 1 I l c G l y M c t A s p L y ~ P r o L c u T h r L e u P r o A ~ p P h c L e u A 1 ~ L ~ ~ l P h e A ~ p T y r T y r M c t , ~ o A l ~ L

"""""_

"""

-"

TATCGCGGGCTGCCGGGAGGCTATCAAAAGGATCGCCTATGAGTTTGTAGAGATGAAGGCCAAAGAGGGCGTGGTGTATGTGGAGGTGCGGTACAG X l e A l ~ G l i ; C y r A r g C l u A l ~ I l c L y s A r ~ I l e A l ~ T y r G l u P h ~ V ~ l G l y ~ e t L y s A l s L y s G l u G l y V ~ l V ~ l T y r V ~ t G l ~ V ~ l A r ~ ~ y r S e r "" l-1" I """J" "1 T C C G C A C C T G C T G G C C A A C T C C A A A G T G G A G C C A A T C C C C T G G A A C C A G G C T G A A G G G G A C C T C A C C C C A G A C G A G G T G G T G G C C C T A G T G G G C C A P r o A i r L e u L e u A l . A s n S e r L y s V . 1 C l u P r o l l e P r o T r p A s n G l n A l ~ G l u G l y A ~ p l L e n T h r P ~ o A s p G l u V ~ l ~ ~ l A l ~ L e n V ~ l G l y G l n G G G C C T G C A G G A G G G G G A G C G A G A C T T C G G G G T C A A G G C C C G G T C C A T C ~ T G l G C T G C A T ~ C G C C A C C A G C C C A A C T G G T C C C C C A A G G T G G T G G A G l y L e u G l n C l u C 1 ~ C l u A r ~ A s p ~ h e G l y V . 1 L y r A l a A r ~ S e r I l e L e u C y s C y s ~ ~ e t A r g ~ i s G l n P r o A s n T r p S ~ ~ P r o L y s ~ ~ l V ~ l G l u

,

G C T G T G T A A G A A C T A C C A G C A G C A C A C C G T G ~ T A ~ C C A T T G A C C T G G C T G ~ A ~ A T G A ~ A C C A T C C C A G G A A G C A G C C T C T T G C C T G G A C A T G T C C A L e n C p s L y r L y s ~ ~ r G l n C l n C l n T h r V ~ l V a l A l ~ I l e A s p L e u A l ~ G l y A s p G l u T h r l l e P r o G l y S e r S e r L e u ~ ~ n P r o G l y R i s V ~ l G l n G G C C T A C C A G G A G G C T G T G A A G A G C G 6 C A T T C A C C G T A C T G l C ~ A C G C C G G G ~ A G G T G G G C T C G G C C G A A G T A G T A A A A G A G G C T G T G G A C A T A C T A l ~ T y r C l ~ G l u A l ~ V ~ l L y s S e r ~ l y I l ~ R i s A r ~ T ~ ~ V ~ l R i s A l ~ G l y G l u V ~ l G l y S ~ r A l ~ G l u V ~ ~ V ~ l L y ~ G l ~ A l ~ V ~ l A s ~ I l ~ L ~ ~ C A A G A C A G A G C G G C T G G G A C A C G G C T A C C A C A C C C T G C A A ~ A C C A G G C C C T T T A T A A C A G G C T G C G G C A G G A A A A C A T G C A C T T C G A G A T C T G C C C ~ T h r G 1 u A r g L e u G l y A i r G l y T y r R i s T h r L e u G l o A s p G 1 n A l a L e u T y r A s n A r g L e u A r ( l G l n G 1 u A s n ~ c t A i s P h c C l u I 1 e C y s P r o C T G G T C C A G C T A C C T C A C T G C 1 G C C T G C A A G T T C G A C A C G 6 A ~ C A T G C A G T C A T T C G G C T C A A A A A T G A C C A G G C T A A C T A C T C G C T C A A C A C A G A T r p S e r S e r T y r L e u T h r G l y A l ~ T r p L y r P r o A s p T h ~ G l u U i s A l ~ V ~ l l l e A r g L e u L y s A ~ n A s p G l n A l ~ A ~ n T y I S e ~ L e n A s n T h r A S p I T G A C C C G C T C A T C T T C A A G T C C A C C C T G G A C A C T G A T T A C C A C A T G A C C A A A C G G G A C A T G G G C T T T A C T G A A G A G G A G T T T A A A A G G C T G A A C A T A s p P r o L c n I l e P h c L y r S e r ~ ~ h r L e u A s p T h r A s p T y r G I n M e t T h r L y s A r g , A s p ~ ~ e t G l y P b e T h r G l u G l u G l u P h e L y s A r ( l ~ e n A s n I l e CAATGCGGCCAAATrTAGlTTCCTCCChCAAGATGAAAAGAGGGAGCTTCTCGACCTGCTCTATAAAGCCTATGGGATGCCACCTTCAGCCTCTGC

-

- -

- - - -

-

- - -

" A ~ n A l s A l ~ L y s S e r S e r P h e L e u P r o ~ l u A s p G l u L y s A r g G l u L e u L e u A s p L e u L e u T y r L y s A l ~ T y r G l y M e t P r o P r o S e r A l ~ S e r A l ~

"_

- AGGGCAGAACCTCTGAAGACGCCACTCCTCCAAGCCTTCACCCTGTGGAGTCACCCCAACTCTGTGGGGCTGAGCAACATTTTTACATTTATTCCT

""-

GlyGlnAsnLe3Ter TCCAAGAAGACCATGATCTCAATAGTCAGTTACTGATGCTCCTGAACCCTATGTGTCCATTTCTGCACACACGTATACCTCGGCATGGCCGCGTCA CTTCTCTGATTATGTGCCCTGGCAGGGACCAGCGCCCTTGCACATGGGCATGGTTGAATCTGAAACCCTCCTTCTGTGGCAACTTGTACTGAAAAT C T G G T G C T C A A G C C C A T G G C T G C T G C C A T G C 1478

FIG. 2. cDNA and primary amino acid sequence of adenosine deaminase. The DNA sequence of the strand corresponding to the mRNA is displayed above the protein sequence. The poly(A) nucleotide tail is not shown. Experimentally determined amino acid sequences of purified erythrocyte adenosine deaminase peptides Droduced from either t m t i c (-) or CNBr (- - -) cleavage are indicated by bracketed lines. The poly(A) addition

96 192 zaa 384 480 576 6 7 2 768 8 6 4 9 6 0 1056 1 1 5 2 1248 1344 1440

signal is indicated by an-open box.

fore, not represented in our cDNA clones.

Fig. 2 presents the entire adenosine deaminase cDNA sequence from the first nucleotide of clone E3 unequivocally present on the basis of the S1 nuclease mapping to the end of clone C10. Restriction sites, from which sequencing by the method of Maxam and Gilbert (26) was performed, are indi-

cated in Fig. 1. An open reading frame begins at the ATG of

nucleotides 77-79 of Fig. 2 and extends through the previously

identified translation terminator (21). No upstream ATGs

were present. The sequence surrounding the initiator Met codon conforms well to the consensus sequence CC(A or G)CCAUG (G) suggested by Kozak for translation start sites (37). The DNA sequence predicted a StuI restriction site which could not be cleaved in plasmid DNA. Direct sequenc-

ing revealed that this StuI site overlaps a methylated BstNI

site which prevents cleavage. Overall no differences were identified between the sequences of the various cDNAs where they overlapped and in all cases agreed with available experimentally determined amino acid sequence data. The nearly complete adenosine deaminase cDNA sequence, depicted in Fig. 2, is 1478 nucleotides in length not including the poly(A) tail. This is consistent with the size of the mRNA determined by Northern blot analysis in other laboratories (20, 38).

Adenosine Deaminuse mRNA Analyses-Northern blot

analysis (Fig. 4) of mRNA derived from normal lymphoblast

cell lines indicates that the major adenosine deaminase

mRNA transcript is 1.8 kb when sized against ribosomal RNA markers. The major transcript size is 1.6 kb when compared

against X DNA markers. A minor and variable RNA hybrid-

izing species is also present at 5.8 kb and has been observed in mouse T-cell, MOLT-4, HeLa, and B-lymphoblast mRNA

by others (20,22,23,38). The 5.8-kb hybridizing RNA species

is too small to be a primary precursor RNA of the mature adenosine deaminase mRNA since a minimum estimate for the human adenosine deaminase gene is 23 kb (21). It is possible that this RNA species could be a minor second processed transcript of adenosine deaminase; however, the relative amount of this high molecular weight RNA species is variable relative to the 1.8-kb adenosine deaminase mRNA under stringent hybridization and washing conditions sug- gesting minimal shared sequence homology between the two species. As shown in Fig. 4, mRNA from an adenosine deaminase-deficient null cell line (DHL-9) shows no detectable 1.8-kb transcript, but the presence of 5.8-kb RNA. Lympho- blast cell lines derived from six unrelated patients with adenosine deaminase deficiency and immunodeficiency disease all have apparently normal to above normal levels of adenosine deaminase mRNA. The level of phosphoglycerate kinase mRNA (2.0 kb) was identical in all normal and adenosine deaminase-deficient cell lines tested and was used as an internal standard for adenosine deaminase mRNA recovery and quantitation. Relative to the two normal B-lymphoblast cell lines, five of the enzyme-deficient cell lines had a normal level of 1.8-kb mRNA, while GM 2606 had four times the normal adenosine deaminase mRNA content. These findings suggest, at least in these cases, that the molecular defect is

(4)

12104

G A T C 1 2

Adenosine Deaminase Sequence

FIG. 3. Primer extension analysis and S1 nuclease mapping of the 6’ end of adenosine deaminase mRNA. T w o restriction fragments, 5’-end labeled at the BamHI site shown in Fig. 1, were prepared from clone E3. A 58-bp BamHI-NcoI fragment was used to prime cDNA transcripts on MOLT-4 mRNA as template by previously described methods (27). The extended products were electro- phoresed in an 8% urea-acrylamide gel (26) for 2.5 h (lane I) . A 400- bp BamHI-PstI fragment was hybridized to MOLT-4 mRNA and digested with S1 nuclease (27). The protected fragments were electro- phoresed in lane 2. Chemical sequencing reactions (26) of the BamHI- PstI fragment were electrophoresed to align the S1-protected frag- ments with the DNA sequence (lanes G, A, T, and C). The more

rapidly migrating and intense S1 protected fragment was used to assign the first unequivocal adenosine deaminase mRNA-derived nucleotide of clone E3 and the initial G shown in Fig. 2. Size markers

of plasmid pBR322 digested with HinfI are shown to the right (lane

M).

not a gene deletion, not at the level of transcription and not due to mRNA instability. Recent studies by Wiginton et

al.

(20) and Valerio et

al.

(38) support this observation.

Adenosine Deaminase Amino Acid Sequence-From the complete amino acid sequence shown in Fig. 2, the mature adenosine deaminase protein, excluding the NH2-terminal Met, is 362 amino acid residues with a calculated

M,

= 40,638. This value is in good agreement with previously published experimentally determined values (11, 12, 39).The NH2-ter- mind amino acid in the mature polypeptide is shown by cDNA sequencing to be Ala. Determination of the NH2- terminal sequence of adenosine deaminase was not possible because the NH2-terminal amino acid residue in the intact protein was blocked to Edman degradation. Many other sol-

uble cytoplasmic enzymes are also blocked at the NH2 ter- minus and have been shown in many cases to be acetylated

-

5.8 Kb

-

1.8

FIG. 4. Northern blot analysis of mRNA from human lym- phoblast cell lines. mRNA was electrophoresed on a 1% agarose, 2.2 M formaldehyde gel, blot transferred to nitrocellulose, and hybrid- ized with 32P-labeled cDNA as described under “Experimental Pro- cedures.” GM 333 and GM 558 represent normal B-lymphoblast cell lines. GM 4258, GM 2825, GM 1715, GM 2756, GM 2606, and GM 2471 are adenosine deaminase-deficient B-lymphoblast cell lines derived from immunodeficient patients. DHL-9 is an adenosine deaminase-deficient null lymphoblast cell line derived from a patient with null cell leukemia and represents a negative control. In each case, 2.5 pg of mRNA/lane was electrophoresed. The size of hybridized RNA species (kilobases) was estimated with heavy and light subunit ribosomal RNA markers. The adenosine deaminase mRNA is estimated to be 1.6 kb using X DNA markers.

(40). The carboxyl-terminal amino acid residue is shown by both cDNA and amino acid sequencing to be Leu. The amino acid composition determined for the intact purified erythrocyte protein and that predicted from the DNA sequencing are in good agreement (Table I). No discrepancies were found between the experimentally determined amino acid sequence and the sequence deduced from DNA sequencing.

Predicted Adenosine Deaminase Secondary Structure-The predicted secondary structural spans for adenosine deaminase were elicited from the smoothed curves (Fig. 5 ) by the following rules. (i) A residue was assigned to a particular secondary structural type (helix, @-strand, or turn configuration) according to the largest of the three smoothed potential values, one of which must be greater than 1.OOO. (ii) A helical segment was not assigned unless at least five contiguous values satis- fying rule (i) were found; the minimum length requirement for strand and turn regions were three and four residues, respectively. (iii) A proline or glycine was allowed to be within the first four N-terminal residues of a predicted a-helix as observed in known protein structures (41); the two amino acids were not allowed to appear within any other region of

(5)

Adenosine Deaminase Sequence

12105

.ml

0.0 20.0 w.0 110.0 m.0 1a0.0 120.0 1w.a

t&.iEfwr,&.

No.nb.a &.a &.a A.0 Xa.0 &.a m.0 m . 0 m.0

-

7

FIG. 5. Smoothed curves showing the adenosine deaminase residue conformational preference. The parameters are shown as helix (-), @-strand (- - -), and reverse turn or coil (- -).

TABLE I

Amino acid composition of human adenosine deaminase

Amino acid ana- Deduced from cDNA lysis" sequenceb Amino acid Ala GlY His Ile Leu LYS Met Phe Pro Thr Ser Trp TYr Val

nmol amino acid/nmol total protein

30 31 17 17 33

;;

}

34 ND 5 45 24

;:

24

}

45 10 11 15 17 34 36 23 24 8 8 10 10 22 21 18 17 17 17 ND 4 16 16 24 25

a Composition of purified erythrocyte adenosine deaminase. Anal-

ysis performed after 24-h 6 N HCl hydrolysis at 110 "C; serine increased by 10% and threonine increased by 5% to compensate for destruction by acid. One crystal of phenol added before acid hydrolysis. Nanomoles of amino acid residue are rounded to nearest whole integer. ND, not determined.

*

Initiator Met not included in the amino acid composition data. The secondary structural predictions for adenosine deami-

nase (Table 11) clearly suggest the a/P structural class

(roughly alternating strand and helical configurations (42). The predicted Bao-like pattern, especially as found in the 200

or so N-terminal residues (Table 11), could indicate a possible

nucleotide-binding tertiary fold (43) with its six parallel

P-

strands generally connected by helical right-handed cross- overs, perhaps forming an adenosine-binding pocket. The strands are generally connected by 20-residue segments, again typical of the nucleotide fold (44).

With the complete sequence of the codingportion of human adenosine deaminase cDNA, it will now be possible to fully characterize both mRNA and DNA in adenosine deaminase deficiency. As noted, all adenosine deaminase-deficient cell

TABLE I1

Predicted secondary structwat residue spans for human adenosine

deaminase

Secondary'

structure Amino acid region

t t t ff P P o! t t ff P P ff t t t ff P P P ff t ff P t t (Y P ff t t t t t ff P ff (Y 1-7 8-18 19-23 24-29 30-36 37-43 44-50 51-55 56-64 65-67 68-72 73-92 93-102 103-112 113-125 126-133 134-145 146-155 156-162 163-171 172-179 180-195 196-205 206-212 213-218 219-235 236-239 240-259 260-265 266-273 274-284 285-296 297-302 303-313 314-331 332-335 336-348 349-362

Secondary structure (a, helix; P, strand; t, reverse turn or coil) predicted for adenosine deaminase using the conformational preference curves of Fig. 4.

lines derived from patients with immunodeficiency studied to date are mRNA positive. This will permit further mRNA

(6)

of adenosine deaminase cDNA from cDNA libraries derived from each of these cell lines. Further, knowledge of the primary structure of normal human adenosine deaminase will be important in defining structural mutations leading to functional defects in enzyme variants from subjects with partial adenosine deaminase deficiency and for understanding the genetic mechanisms and functional consequences of mutations in its structural gene. With the entire cloned coding region for human adenosine deaminase available, gene trans- fer and expression can now be approached.

After the submission of our manuscript for publication, Hutton and associates (45) reported the cDNA and the de- duced amino acid sequence for human adenosine deaminase. Their data agrees well with our findings and confirms the adenosine deaminase sequences.

Acknowledgments-We would like to thank Sabra C. Goff and

Teresa Newherry for their fine technical assistance. REFERENCES

1. Giblett, E. R., Anderson, J. E., Cohen, F., Pollara, B., and Meuwissen, H. J. (1972) Lancet 2, 1067-1069 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17.

Martin, D. W., Jr., and Gelfand, E. W. (1981) Annu. Rev.

Mitchell, B. S., and Kelley, W. N. (1980) Ann. Intern. Med. 92,

Smyth, J. F., Poplack, D. G., Holiman, B. J., Leventhal, B. G., Meier, J., Coleman, M. S., and Hutton, J. J. (1976) Br. J. Cancer

Valentine, W. N., Paglia, D. E., Tartaglia, A. P., and Gilsanz, F. Van der Weyden, M. B., and Kelley, W. N. (1976) J. Bwl. Chem.

Daddona, P. E., and Kelley, W. N. (1979) Biochim. Biophys. Acta

Schrader, W. P., Harder, C. M., Schrader, D. K., and West, C. A. Andy, R. J., and Kornfeld, R. (1982) J. Biol. Chem. 2 5 7 , 7922-

Schrader, W. P., Stacy, A. R., and Pollara, B. (1976) J. Biol.

Daddona, P. E., and Kelley, W. N. (1977) J. Biol. Chem. 2 5 2 ,

Creagan, R. P., Tischfield, J. A., Nichols, E. A., and Ruddle, F.

H. (1974) Lancet 2 , 1449

Tischfield, J. A., Creagan, R. P., Nichols, E. A., and Ruddle, F.

R. (1974) Hum. Hered. 2 4 , 1-11

Daddona, P. E., Frohman, M. A., and Kelley, W. N. (1980) J.

Biol. Chem. 255,5681-5687

Daddona, P. E., Mitchell, B. S., Meuwissen, H. J., Davidson, B. L., Wilson, J. M., and Koller, C. A. (1983) J. Clin. Znuest. 7 2 ,

Hirschhorn, R., Roegner, V., Jenkins, T., Seaman, C., Piomelli, S., and Borkowsky, W. (1979) J. Clin. Znuest. 64,1130-1139

Biochem. 5 0 , 845-877 826-831

and Yarhro, G. (1978) J. Clin. Inuest. 6 2 , 710-712 33,312-319

(1977) Science (Wash. D. C.) 195, 783-785

25 1,5448-5456 580,302-311

(1983) Comp. Biochem. Physwl. 7 5 B , 119-126

7925

Chem. 251,4026-4032

110-115

483-492

18. Hirschhorn, R., Martiniuk, F., Roegner-Maniscalco, V., Ellen- bogen, A., Perignon, J-L., and Jenkins, T. (1983) J. Clin. Invest.

19. Adrian, G. S., and Hutton, J. J. (1983) Proc. Natl. Acud. Sei. U.

S. A. 80, 7481-7485

20. Wiginton, D. A., Adrian, G. S., Friedman, R. L., Suttle, D. P., and Hutton, J. J. (1983) Proc. Natl. Acud. Sci. U. S. A. 80, 7481-7485

21. Orkin, S. H., Daddona, P. E., Shewach, D. S., Markham, A. F., Bruns, G. A., Goff, S. C., and Kelley, W. N. (1983) J. Bwl. Chem. 2 5 8 , 12753-12756

22. Hunt, S. W., 111, and Hoffee, P. A. (1983) J. Bwl. Chem. 2 5 8 , 23. Yeung, C-Y., Frayne, E. G., Al-Ubaidi, M. R., Hook,A. G., Ingolia, D. E., Wright, D. A., and Kellems, R. E. (1983) J. Biol. Chem.

24. Valerio, D., Duyvesteyn, M. G. C., Meera Khan, P., Geurts van Kessel, A., de Waard, A., and van der Eb, A. J. (1983) Gene

25. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor,

NY

26. Maxam, A., and Gilbert, W. (1980) Methods Enzymol. 6 5 , 499- 560

27. Treisman, R., Proudfoot, N. J., Shander, M., and Maniatis, T.

(1982) Cell 29,903-911

28. Tarr, G. E. (1982) Anal. Biochem. 111, 27-32

29. Tarr, G. E. (1982) in Methods in Protein Sequence Analysis

(Elzinga, M., ed) pp. 223-232, Humana Press Inc., Clifton, NJ

30. Kubota, M., Kamatani, N., Daddona, P. E., and Carson, D. A.

(1983) Cancer Res. 43,2606-2610

31. Palmiter, R. D. (1974) Biochemistry 13,3606-3615

32. Aviv, H., and Leder, P. (1972) Proc. Natl. Acud. Sci. U. S. A. 69, 33. Thomas, P. S. (1983) Methoods Enzymol. 100B, 255-266 34. Michelson, A. M., Markham, A. F., and Orkin, S. H. (1983) Proc.

35. Palau, J., Argos, P., and Puigdomenech, P. (1982) Znt. J. Peptide

36. Proudfoot, N. J., andBrownlee, G. G. (1976) Nature (Lord.) 263, 37. Kozak, M. (1984) Nucleic Acids Res. 12,857-872

38. Valerio, D., Duyvesteyn, M. G. C., van Ormondt, H., Meera Khan, P., and van der Eb, A. J. (1984) Nucleic Acids Res. 1 2 , 1015-

1024

39. Wiginton, D. A., Coleman, M. S., and Hutton, J. J. (1981)

Biochem. J. 195,389-397

40. Schroeder, W. A. (1968) The Primary Structure of Proteins, pp.

78-79, Harper and Row, New York

41. Argos, P., and Palau, J. (1982) Znt. J. Peptide Protein Res. 1 9 , 42. Levitt, M., and Chothia, C. (1976) Nature (Lord.) 261,552-558 43. Rossmann, M. G., Liljas, A., Branden, C. I., and Banaszak, L. J.

(1975) in The Enzymes (Boyer, P. D., ed) Vol. 111, pp. 21-132,

Academic Press, New York

44. Argos, P., Hanei, M., Wilson, J. M., and Kelley, W. N. (1983) J.

Biol. Chem. 258,6450-6457

45. Wiginton, D. A., Adrian, G. S., and Hutton, J. J. (1984) Nucleic

Acids Res. 12,2439-2446 71,1887-1892 13185-13192 258,15179-15185 25,231-240 1408-1412

Natl. Acud. Sci. U. S. A. 80,472-476

Protein Res. 19, 394-401

211-214