University of Zurich
Zurich Open Repository and Archive
Winterthurerstr. 190 CH-8057 Zurich http://www.zora.uzh.ch
Year: 2009
Hepatocyte nuclear factor-4{alpha} and bile acids regulate
human concentrative nucleoside transporter-1 gene expression
Klein, K; Kullak-Ublick, G A; Wagner, M; Trauner, M; Eloranta, J J
Physiology. Gastrointestinal and Liver Physiology, 296(4):G936-G947. Postprint available at:
http://www.zora.uzh.ch
Posted at the Zurich Open Repository and Archive, University of Zurich. http://www.zora.uzh.ch
Originally published at:
American Journal of Physiology. Gastrointestinal and Liver Physiology 2009, 296(4):G936-G947.
Klein, K; Kullak-Ublick, G A; Wagner, M; Trauner, M; Eloranta, J J (2009). Hepatocyte nuclear factor-4{alpha} and bile acids regulate human concentrative nucleoside transporter-1 gene expression. American Journal of Physiology. Gastrointestinal and Liver Physiology, 296(4):G936-G947.
Postprint available at: http://www.zora.uzh.ch
Posted at the Zurich Open Repository and Archive, University of Zurich. http://www.zora.uzh.ch
Originally published at:
human concentrative nucleoside transporter-1 gene expression
Abstract
The concentrative nucleoside transporter-1 (CNT1) is a member of the solute carrier 28 (SLC28) gene family, and is expressed in the liver, intestine, and kidneys. CNT1 mediates the uptake of naturally occurring pyrimidine nucleosides, but also nucleoside analogues used in anticancer and antiviral therapy. Thus, expression levels of CNT1 may affect the pharmacokinetics of these drugs and the outcome of drug therapy. Because little is known about the transcriptional regulation of human CNT1 gene expression, we have characterized the CNT1 promoter with respect to DNA response elements and their binding factors. The transcriptional start site of the CNT1 gene was determined by 5'-RACE. In silico analysis revealed the existence of three putative binding sites for the nuclear receptor hepatocyte nuclear factor-4alpha (HNF-4alpha) within the CNT1 promoter. A luciferase reporter gene construct containing the CNT1 promoter region was transactivated by HNF-4alpha in human cell lines derived from the liver, intestine, and kidneys. Consistent with this, we showed in electromobility shift assays that HNF-4alpha specifically binds to two conserved direct repeat-1 (DR-1) motifs within the proximal CNT1 promoter. In cotransfection experiments, the transcriptional coactivator peroxisome
proliferator-activated receptor-gamma coactivator-1alpha (PGC-1alpha) further increased, whereas the bile acid-inducible corepressor small heterodimer partner (SHP) reduced, HNF-4alpha-dependent CNT1 promoter activity. Consistent with the latter phenomenon, CNT1 mRNA expression levels were
suppressed in primary human hepatocytes upon bile acid treatment. Supporting the physiological relevance and species-conservation of this effect, ileal Cnt1 mRNA expression was decreased upon bile acid feeding and increased upon bile duct ligation in mice. Key words: nucleoside transport, bile acids, transcriptional regulation, nuclear receptors.
Hepatocyte nuclear factor-4
αand bile acids regulate human concentrative
nucleoside transporter-1 gene expression
Kerstin Klein,1 Gerd A. Kullak-Ublick,1 Martin Wagner,2 Michael Trauner,2 and Jyrki J. Eloranta1
1Division of Clinical Pharmacology and Toxicology, Department of Internal Medicine,
University Hospital Zurich, Switzerland
2Laboratory of Experimental and Molecular Hepatology, Division of Gastroenterology and
Hepatology, Department of Internal Medicine, Medical University Graz, Austria
Running Head: CNT1 gene is regulated by HNF-4α and bile acids
Address for reprint requests and other correspondence: J. J. Eloranta, Division of Clinical Pharmacology and Toxicology, Department of Internal Medicine, University Hospital, Rämistrasse 100, CH-8091 Zurich, Switzerland (e-mail: [email protected]).
Tel. + 41 44 255 9632 Fax. + 41 44 255 4411
ABSTRACT
The concentrative nucleoside transporter-1 (CNT1) is a member of the solute carrier 28 (SLC28) gene family, and is expressed in the liver, intestine, and kidneys. CNT1 mediates the uptake of naturally occurring pyrimidine nucleosides, but also nucleoside analogues used in anticancer and antiviral therapy. Thus, expression levels of CNT1 may affect the pharmacokinetics of these drugs and the outcome of drug therapy. Because little is known about the transcriptional regulation of human CNT1 gene expression, we have characterized the CNT1 promoter with respect to DNA response elements and their binding factors. The transcriptional start site of the CNT1 gene was determined by 5`-RACE. In silico analysis revealed the existence of three putative binding sites for the nuclear receptor hepatocyte nuclear factor-4α (HNF-4α) within the CNT1 promoter. A luciferase reporter gene construct containing the CNT1 promoter region was transactivated by HNF-4α in human cell lines derived from the liver, intestine, and kidneys. Consistent with this, we showed in electromobility shift assays that HNF-4α specifically binds to two conserved direct repeat-1 (DR-1) motifs within the proximal CNT1 promoter. In cotransfection experiments, the transcriptional coactivator peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) further increased, whereas the bile acid-inducible corepressor small heterodimer partner (SHP) reduced, HNF-4α -dependent CNT1 promoter activity. Consistent with the latter phenomenon, CNT1 mRNA expression levels were suppressed in primary human hepatocytes upon bile acid treatment. Supporting the physiological relevance and species-conservation of this effect, ileal Cnt1 mRNA expression was decreased upon bile acid feeding and increased upon bile duct ligation in mice.
INTRODUCTION
The uptake of naturally occurring nucleosides as well as nucleoside analogue drugs into cells relies on equilibrative and concentrative plasma membrane nucleoside transporters, which are encoded by members of two distinct gene families, the solute carrier families SLC28 and SLC29. CNT1 (SLC28A1) is one of the three members of the solute carrier gene family SLC28 of active, concentrative, and Na+-dependent nucleoside transporters (21). While the
main physiological function of nucleoside transporters is to salvage nucleosides from blood, there is growing evidence that they are also involved in regulatory processes by modulating extracellular adenosine concentrations (27). CNT1 transports naturally occurring pyrimidine nucleosides (50). In addition, the transport substrates for CNT1 include several nucleoside analogue drugs used in antiviral and anticancer therapy, such as zidovudine, cytarabine, and gemcitabine (21). Detailed knowledge of the regulation of CNT1 gene expression may help us to understand the mechanisms that influence the pharmacokinetics of drugs transported by CNT1, and potentially enable us to modulate CNT1-mediated drug transport in a defined manner.
The CNT1 mRNA is most abundantly expressed in human liver and kidneys (45), and is also present in duodenum and ileum (37). The CNT1 protein is localized at the apical membranes of enterocytes and proximal tubules of the kidney (18). In human hepatocytes, CNT1 has been shown to be localized at both the basolateral and canalicular membranes (19). Whereas the transport characteristics of CNT1 have been studied extensively (43), little is known about the regulation of CNT1 expression levels, and no promoter analyses have been published to date. CNT1 expression has been shown to be altered in tumours of various tissue origin in comparison with normal tissue (45) and the loss of CNT1 protein expression has been
correlated with histological subtypes of gynaecological tumours characterized by poor prognosis (11). Furthermore, CNT1 expression is upregulated in adipose tissue of HIV-infected patients (22). The human CNT1 gene exhibits a high degree of genetic and functional variation. Many single nucleotide polymorphisms in the coding region appear to be tolerated, although genetic variants that alter gemcitabine transport kinetics have been described (20, 29). Cnt1 expression is higher in differentiated than undifferentiated rodent hepatocytes (6) and is increased after partial hepatectomy in rats (12). Further evidence that CNT1 expression is associated with cell maturation comes from immunohistochemistry of human duodenal biopsies that showed almost absent CNT1-specific staining of crypt cells, but readily detectable expression in mature enterocytes (18). Cnt1 expression levels are increased in jejunum of starved rats or rats fed a nucleotide-deficient diet, which indicates that substrate availability may modulate its expression (55). Moreover, Cnt1 mRNA expression is increased in hearts of streptozotocin-induced diabetic rats (44) and decreased upon insulin treatment in cultured cardiac fibroblast (46). Furthermore, hepatic CNT1/Cnt1 protein expression is increased by the cytokines TNF-α and IL-6 in cultured cells and in vivo in rats (14).
Our aim was to characterize the mechanisms by which the expression levels of the CNT1 gene are regulated in human cell lines derived from liver, intestine, and kidneys, as well as in primary human hepatocytes. We show that the promoter region of the CNT1 gene is regulated by the nuclear receptor HNF-4α, the transcriptional coactivator PGC-1α, and bile acids, and have identified the CNT1 promoter elements that mediate these regulatory events. Given the high conservation of these promoter elements between humans and rodents, we further studied, whether murine Cnt1 gene expression is regulated by bile acids in two different cholestatic mouse models.
MATERIALS AND METHODS
Chemicals. Deoxyadenosine 5’-[α-32P]-triphosphate (6000 Ci/mmol) was purchased
from Perkin Elmer (Schwerzenbach, Switzerland). Restriction enzymes were from Roche Diagnostics (Rotkreuz, Switzerland), PuRe Taq Ready-To-Go PCR beads from GE Healthcare (Glattbrugg, Switzerland) and T4 DNA Ligase from Promega (Dübendorf, Switzerland). The oligonucleotides were synthesized by Microsynth (Balgach, Switzerland). Other chemicals were purchased from Sigma-Aldrich (Buchs, Switzerland), unless stated otherwise.
Cell culture. The human hepatoma cell line Huh7 (JCRB Cell Bank, Japan) was cultured in RPMI-1640 medium (Sigma-Aldrich) supplemented with 10% fetal bovine serum (Sigma-Aldrich), 100 U/ml penicillin and 100 µg/ml streptomycin (Invitrogen, Basel, Switzerland). The human renal adenocarcinoma cell line ACHN (LGC Promochem, Wesel, Germany) was maintained in Eagle`s minimum essential medium (Sigma-Aldrich) supplemented with 10% fetal bovine serum, 100 U/ml penicillin (Invitrogen) and 100 µg/ml streptomycin (Invitrogen). The human colon carcinoma cell line Caco2 (LGC Promochem) was grown in Dulbecco`s modified Eagle`s medium (Sigma-Aldrich) supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Fresh primary human hepatocytes were purchased from Lonza (Verviers, Belgium). Upon arrival the cells were transferred into Hepatocyte Maintenance Medium (HMM) supplemented with HMM Single Quots (Lonza), 100 U/ml penicillin and 100 µg/ml streptomycin. Cells were cultured at +37°C in a humidified atmosphere containing 5% CO2.
5`-Rapid amplification of cDNA ends (5'-RACE). We carried out 5`-RACE using the SMART RACE cDNA Amplification Kit (Clontech, Saint-Germain-en-Laye, France) with one µg of total liver RNA (Clontech) as a template. The oligonucleotide primer used for
amplification of the cDNA is listed in Table 1. The PCR product was cloned into pGEM-T vector (Promega) and sequenced (Microsynth).
RNA isolation, reverse transcription, and real-time PCR. Fresh primary human hepatocytes were treated with 50 μM chenodeoxycholic acid (CDCA) or the vehicle DMSO for 16 hours. Total RNA was isolated using the TRIzol reagent (Invitrogen) and RNA was quantified spectrophotometrically at 260 nm (NanoDrop ND-1000, Witec AG, Littau, Switzerland). One μg of each RNA from primary human hepatocytes was reverse transcribed by random priming (Reverse Transcription System, Promega). Five μl of each cDNA, from final reaction volumes of 100 μl, were used for real-time PCR, which was performed on an 7900HT Fast Real-Time PCR System (Applied Biosystems, Rotkreuz, Switzerland) using the TaqMan Gene Expression Assays Hs00188418_m1, Hs00222677_m1, Hs00230853_m1, Hs00161820_m1, and Hs00251986_m1 for human CNT1, SHP, HNF-4α, NTCP, and OATP1B3 (Applied Biosystems), respectively. Constitutively expressed human β-actin was measured as an internal standard for sample normalization (#4310881E, Applied Biosystems). Mouse RNA was isolated as described (65). Three µg of RNAs derived from mouse ileum and kidneys were reverse transcribed as described above. Two μl of each cDNA, from final reaction volumes of 80 μl, were used for real-time PCR using the TaqMan Gene Expression Assays Mm01315366_g1, Mm00442278_m1, Mm00433964_m1, Mm00521531_m1, Mm00619242_m1, and Mm00488258_m1 for mouse Cnt1, Shp, Hnf-4α, Ostα, Ostβ, and Asbt (Applied Biosystems), respectively. Constitutively expressed mouse hypoxanthine guanine phosphoribosyl transferase 1 (Hprt1; Mm01318743_m1) in kidneys and mouse villin (Mm00494156_m1) in ileum were measured as internal standards for sample normalization (Applied Biosystems). The relative mRNA levels were calculated using the ΔΔCT (comparative
threshold cycle) method. Each PCR was performed in triplicate. Mean treshold cycle (Ct)
values for control samples are shown in Supplemental Table 1.
Electrophoretic mobility shift assays (EMSAs). Oligonucleotides used in EMSAs were designed to have a 5’-AGCT overhang in the top strand and 5'-GATC overhang in the bottom strand when annealed, allowing radioactive labelling by fill-in reactions. 50 ng of annealed oligonucleotides were labelled in 20 μl reactions containing 200 U Superscript II RNase H Reverse Transcriptase (Invitrogen), 1x First-Strand Buffer (Invitrogen), 10 mM DTT, 250 nM dGTP/dCTP/dTTP, and 20 μCi [α-32P]-dATP. Unincorporated nucleotides were removed
using Microspin G-25 columns (GE Healthcare, Otelfingen, Switzerland). 10 μg of Huh7 nuclear extracts prepared using the NE-PER extraction kit (Pierce, Lausanne, Switzerland) were used for DNA-binding reactions. Protein-DNA complexes were formed in binding buffer (20 mM Tris-HCl, pH 8.0; 60 mM KCl; 2 mM MgCl2 12% (v/v) glycerol; 0.3 mM DTT; 87.5
ng/μl poly(dI-dC)-poly(dI-dC)) in a total volume of 20 μl for 10 minutes at +30oC. After this,
approximately 50000 cpm (0.5-1.5 ng) of the radioactive probes were added to reactions. In supershift experiments, 1 μg of HNF-4α antibody (H-171x, Santa Cruz Biotechnology Inc., Heidelberg, Germany) was added to the extracts 1 hour prior to the probe, and incubated at +4oC. In competition experiments, a 50-fold, 100-fold, or 200-fold molar excess of the competing probes was added simultaneously with the radioactive probe. Immediately after the binding reactions, the samples were loaded onto pre-electrophoresed 5% (acrylamide/bis 30:1) native acrylamide gels and run at 200 V in 0.5xTBE for 1.5 hours. The gels were fixed in 10% (v/v) acetic acid for 10 minutes, dried onto Whatman DE81 paper under vacuum, and exposed to Kodak BioMax MR-1 films (Sigma-Aldrich) at -80oC.
Reporter gene constructs and expression vectors. Based on the sequence (NC_000015) available in the NCBI database and the 5`-RACE result reported here, fragments corresponding
to the putative promoter region of the human CNT1 gene were PCR-amplified using the oligonucleotide primers shown in Table 1. PCR products were cloned into the pGEM-T vector and subcloned into the luciferase vector pGL3basic (Promega) to generate the CNT1 reporter constructs. The 653/+110) reporter construct was obtained by digesting the CNT1(-2450/+110) construct with the restriction enzymes SacI and XhoI and subcloning the fragment into pGL3basic. Point mutations were introduced into the CNT1(-99/+110) construct using the QuikChange site-directed mutagenesis kit (Stratagene, Basel, Switzerland) and oligonucleotides listed in Table 1. The coding region of the human SHP and the human HNF-4α genes were obtained through PCR amplification using oligonucleotide primers listed in Table 1 and human universal cDNA (Clontech) as a template. PCR products were cloned into the pGEM-T vector and subcloned into the pcDNA3.1(+) (SHP) or pcDNA3.1(-) (HNF-4α) vectors (Invitrogen). The sequences of all constructs were verified by DNA sequencing (Microsynth). The mammalian expression plasmid pcDNA3.1-HA-PGC-1α was provided by Dr. A. Kralli (La Jolla, CA).
Transient transfections and reporter assays. HepG2, Caco2, and ACHN cells were seeded on 48-well plates at a density of 7x105 cells/well, and cotransfected with 400 ng of the luciferase reporter constructs and 200 ng of the expression plasmids, using FuGENE HD reagent (Roche Diagnostics), at a ratio of 3 μl FuGENE HD per 1 μg DNA. To normalize the amount of DNA transfected, the pcDNA3.1(-) vector was added where appropriate. To control for transfection efficiency, 100 ng of the renilla luciferase (phRG-TK) reporter plasmid (Promega) were cotransfected. Cells were harvested 36 hours after transfection, and luciferase activities determined using the Dual Luciferase assay system (Promega) in a Luminoskan Ascent microplate luminometer (Thermo Fisher Scientific, Wohlen, Switzerland). Reporter activities obtained for the empty pGL3basic corresponding to each test condition, as well as for
the test construct containing the test promoter in the control conditions, were set to one and fold activities shown relative to this. Transfection experiments were performed at least three times and results are shown as mean values ± standard deviations.
Animals. Male C57/BL6 mice were housed in a 12:12-hour light/dark cycle and permitted ad libitum consumption of water and a standard mouse diet. The experimental protocols were approved by the local Animal Care and Use Committee according to criteria outlined by the National Institute of Health (39).
Bile acid feeding. Mice were fed a diet supplemented with 0.5% or 1% (wt/wt) cholic acid (CA) for seven days. Control mice were fed a standard mouse diet for seven days. Kidneys and intestine were excised and processed as described (64). In each group three to five animals were studied.
Common bile duct ligation (CBDL). CBDL was performed as described (65). Kidneys and intestine were excised seven days after CBDL under general anesthesia with 10 mg intraperitoneal tribromomethanol (Avertin; Sigma-Aldrich) and immediately snap frozen and stored in liquid nitrogen until RNA extraction. In each group three to five animals were studied.
Statistical analysis. Data are reported as means ± standard deviations. Differences between experimental groups were analyzed by one-way ANOVA with Tukey`s post hoc test, using the GraphPad Prism (GraphPad Software, San Diego, CA) program. P values < 0.05 were considered significant.
RESULTS
Determination of the transcriptional start site of the human CNT1 gene by 5`-RACE. To study the function of the human CNT1 promoter in vitro, we first determined the transcriptional start site of the CNT1 gene by 5`-RACE using liver RNA as a template (Fig. 1A). The reverse primer used in the PCR was located in exon 3 (Fig. 1B). The obtained PCR product was cloned into the pGEM-T vector and sequenced. The transcriptional start site of CNT1 gene was identified 27 bp upstream of the predicted start of exon 1 according to the GenBank submission NM_004213 (Fig. 1C). As the ATG start codon of the CNT1 gene is located within the exon 2, the entire exon 1 and the first part of the exon 2 serve as a 5'-untranslated region.
Identification of putative HNF-4α response elements in the CNT1 promoter. In an attempt to identify putative regulatory regions within the human CNT1 promoter region, we performed in silico analyses using the NUBIScan algorithm (47) and the MatInspector software (3). Two proximal and one distal DR-1 elements located at positions between nucleotides -55/-43, -71/-59, and -1857/-1845 were identified (Fig. 2A). HNF-4α has been previously shown to preferentially bind to DR-1 and DR-2 motifs (16). The two proximal CNT1 DR-1 elements differ from the consensus DR-1 element by two nucleotides and the more distal DR-1 element by one nucleotide. The two proximal DR-1 motifs are located in an evolutionary conserved region identified by using the rVISTA 2.0 tool (33). The corresponding rodent DR-1 elements differ from the human sequence by one nucleotide each (Fig. 2B).
HNF-4α transactivates the human CNT1 promoter. To test whether HNF-4α is capable of activating human CNT1 gene expression we cloned a region of the CNT1 promoter between the nucleotides -2450 and +110. Huh7, Caco2, and ACHN cells were cotransfected with the reporter-linked CNT1 (-2450/+110) promoter, either with or without expression plasmid for
HNF-4α. Overexpression of HNF-4α significantly increased CNT1 promoter activity in all cell lines studied (Fig. 3A, 3B, 3C). To determine the region of the CNT1 promoter accountable for the HNF-4α-mediated effect, we created 5` deletions of the -2450/+110 fragment. Basal promoter activities of the CNT1 promoter deletion constructs in Huh7, Caco2, and ACHN cells are shown in Supplemental Figure 1. Deletion of the genomic region upstream of -341 bp did not significantly affect HNF-4α-mediated transactivation of the CNT1 promoter. A deletion to the nucleotide position of -99 slightly decreased HNF-4α-mediated upregulation of CNT1 promoter activity. However, we could not identify any HNF-4α binding sites in the promoter region between nucleotides -341 and -99, and we speculate that this decrease might be due to an indirect effect by HNF-4α on CNT1 promoter activity. A further deletion of the CNT1 promoter to the nucleotide position of -29 completely abolished the activation, whereas a promoter fragment containing nucleotides -99/+3 was still activated by HNF-4α. Thus, the HNF-4α-responsive region is located between the nucleotides -99 and -29 upstream of the CNT1 transcription start site, containing the two conserved proximal predicted HNF-4α-binding motifs. Next, we mutated (Fig. 2A) the proximal DR-1 elements in the CNT1(-99/+110) promoter construct, either together or separately, to test their functionality. Disruption of either DR-1 site alone was not sufficient to abolish HNF-4α-mediated increase in CNT1 promoter activity (Fig. 4). Only mutagenesis of both DR-1 elements together disrupted HNF-4α-mediated transactivation of the CNT1 promoter. These data demonstrate that both the -71/-59 and the -55/-43 DR-1 elements of the CNT1 promoter are functional mediators of the HNF-4α effect.
HNF-4α binds to the two DR-1 elements within the proximal CNT1 promoter. To verify whether HNF-4α can directly interact with the identified HNF-4α response elements in the CNT1 promoter, we performed electromobility shift assays using nuclear extracts from Huh7
cells and the CNT1 sequence containing the wild-type or mutated DR-1 elements as radiolabelled probes (Fig. 5A). Probes contained each of the two DR-1 elements separately or together. Nuclear proteins strongly bound to the double-stranded oligonucleotides spanning the CNT1 promoter region from -76 to -54 and -60 to -38, containing either DR-1 site separately, and from -76 to -38, containing both DR-1 sites together. The protein-DNA complexes were supershifted after addition of an HNF-4α antibody (Fig. 5A), whereas antibodies against other nuclear receptors (RXRα, PPARα, PPARβ, PPARγ, RAR) had no effect (data not shown). Mutagenesis of either one DR-1 motif, or both of the DR-1 elements simultaneously disrupted the HNF-4α binding.
To further confirm the specificity of HNF-4α-binding to the DR-1 elements we performed EMSA competition experiments (Fig. 5B), using the HNF-4α consensus binding site as a radiolabelled probe and increasing molar excesses of unlabelled competitor oligonucleotides. The binding of nuclear proteins to the HNF-4α consensus binding site was dose-dependently reduced after addition of CNT1 competitor probe containing each wild-type DR-1 element. Mutated DR-1 elements were not able to compete for binding of nuclear proteins to the HNF-4α consensus binding site. These data indicate that HNF-4α is capable of binding to both HNF-4α -responsive DR-1 elements in the proximal CNT1 promoter sequence in vitro.
PGC-1α coactivates CNT1 promoter activity via the HNF-4α response elements. The transcriptional cofactor PGC-1α is a known coactivator of HNF-4α in the context of the phosphoenolpyruvate carboxykinase (PEPCK) promoter (63). To test whether PGC-1α is also involved in the HNF-4α -dependent transcriptional regulation of CNT1 gene expression, we cotransfected Huh7 cells with reporter-linked CNT1 promoter constructs, either with or without expression plasmids for HNF-4α and PGC-1α (Fig. 6A). Cotransfection of PGC-1α increased
HNF-4α-mediated upregulation of the CNT1 promoter constructs -2450/+110 and -99/+110, whereas cotransfection of PGC-1α alone without HNF-4α did not affect the activity of the CNT1 promoter. Mutagenesis of the two identified DR-1 elements in the mut-99/+110 CNT1 promoter construct abolished the activation of promoter activity by HNF-4α and PGC-1α. These data show PGC-1α is a coactivator of HNF-4α in the context of the CNT1 promoter.
SHP represses CNT1 promoter activity via the HNF-4α response elements. The bile acid-inducible transcriptional corepressor SHP has been shown to suppress expression levels of several HNF-4α-regulated drug transporter genes (10). To study whether this regulatory mechanism is also involved in controlling CNT1 gene expression, we cotransfected Huh7 cells with reporter-linked CNT1 promoter constructs, either with or without expression plasmids for HNF-4α and SHP (Fig. 6B). Cotransfection of SHP reduced the HNF-4α-mediated increase of the CNT1 promoter constructs -2450/+110 and -99/+110. Cotransfection of SHP had no effect on the CNT1 promoter construct mut-99/+110, in which both DR-1 binding elements were mutated. Cotransfection of SHP alone without HNF-4α had no effect on CNT1 promoter activity. These results demonstrate that SHP is capable of repressing CNT1 promoter activity, in a manner dependent on the two intact DR-1 elements at positions -71/-59 and -55/-43.
Bile acids suppress CNT1 expression levels. SHP expression levels are known to be increased after bile acid treatment via a FXR/RXR-dependent pathway (52) To test whether bile acids are capable of regulating endogenous CNT1 gene expression, we treated primary human hepatocytes with or without the bile acid chenodeoxycholic acid (CDCA) for 16 hours and measured mRNA expression levels using quantitative TaqMan PCR (Fig. 7). The mRNA expression levels of CNT1 were significantly reduced after the CDCA treatment. As expected, bile acids induced endogenous SHP mRNA expression levels in primary human hepatocytes. HNF-4α mRNA expression levels were also negatively affected by bile acids, an effect that has
been previously observed in rat livers (62) and the liver-derived human cell line Huh7 (48). Furthermore, we measured mRNA expression levels of two known bile acid-regulated transporter genes NTCP and OATP1B3 as controls for the treatment. Our results are consistent with previously published data suggesting that human NTCP (9) and rat Ntcp (59) expression is suppressed upon CDCA treatment via a SHP-dependent mechanism, whereas OATP1B3 expression is known to be induced after bile acid treatment (26). These data are in agreement with our results from the cotransfection experiments, which showed that exogenous SHP expression represses CNT1 promoter activity.
Cnt1 expression levels are altered in ileum and kidneys in two mouse models of cholestasis. Our in silico analysis of the proximal CNT1/Cnt1 promoter indicated that the two identified bile acid-responsive DR-1 elements are conserved between humans and rodents (Fig. 2B). Therefore we investigated whether Cnt1 mRNA expression levels are altered in mice fed a cholic acid (CA)-enriched diet or in mice that underwent common bile duct ligation (CBDL). As Cnt1 mRNA expression levels in mouse liver samples were unexpectedly almost undetectable (data not shown), it was not feasible to analyze differences in hepatic mRNA expression levels in mice. In the ileum, mice fed a CA-enriched diet showed significantly decreased Cnt1 mRNA levels and a strong induction of Shp mRNA expression (Fig. 8A). Hnf-4α mRNA expression in ileum was not affected by CA feeding. To evaluate the efficacy of CA feeding we measured mRNA expression levels of the ileal bile acid transporters Asbt, Ostα, and Ostβ. The Asbt gene encodes for the apical sodium-dependent bile salt transporter in ileal enterocytes and its expression has been shown to be suppressed upon bile acid treatment in mice (5, 15, 58) and human cells (38). As expected, Asbt mRNA expression in ileum was suppressed by CA feeding. The Ostα and Ostβ genes encode the two subunits of the bile acid efflux system at the basolateral membrane of ileocytes. Both genes have been reported to be
coordinately regulated by bile acids in humans (28) and mice (66). However, we could not observe significant differences in ileal Ostα and Ostβ mRNA expression between bile acid- or control-fed mice, similarly to what has been described by Frankenberg and coauthors (15).
CBDL causes a decrease in the bile acid load to ileal enterocytes. Consistent with our proposed model, Cnt1 mRNA expression was elevated in the ileum in mice that underwent CBDL for one week compared to sham-operated (SOP) mice (Fig. 8B). Shp mRNA expression was strongly suppressed, whereas Hnf-4α mRNA expression was unaffected in CBDL mice. Ileal Asbt mRNA remained unchanged between SOP und CBDL mice, consistent with previous observations (2). Ostα and Ostβ mRNA levels were both significantly decreased in the ileum of mice that underwent CBDL.
Unlike in ileum, Cnt1 mRNA expression in kidneys was not affected by feeding mice a CA-enriched diet for one week (Fig. 9A). Furthermore, there were no significant differences in renal Shp and Hnf-4α mRNA expression between mice fed a control or CA-enriched diet, whereas Ostα and Ostβ mRNA levels were elevated in kidneys of CA fed mice, consistent with a previous study (66). Cnt1 mRNA expression was significantly suppressed in kidneys of mice after one week of CBDL (Fig. 9B), which is known to be associated with increased urinary bile acid excretion (36). Shp mRNA expression in the kidneys of SOP (mean threshold cycle value: 33.8) and CBDL (mean threshold cycle value: 35.1) mice was very low. There was no significant difference of Shp expression in kidneys of those two groups, possibly due to the high variation in the Shp expression levels within the CBDL group. There was a tendency for lower Hnf-4α mRNA expression in kidneys of mice that underwent CBDL, but this effect did not reach statistical significance. We could not observe significant differences in renal Ostα and Ostβ mRNA expression levels between SOP and CBDL mice.
DISCUSSION
In the current study we have shown that the human nucleoside transporter CNT1 gene is regulated by HNF-4α and bile acids. The promoter region of the CNT1 gene was cloned and investigated in detail, and the exact transcription start site of the CNT1 gene was defined by 5`-RACE (Fig.1). Two conserved DR-1 elements in the proximal CNT1 promoter region were identified that serve as binding sites for the nuclear receptor HNF-4α (Fig. 2 and 5), which transactivates luciferase reporter constructs containing the CNT1 promoter region in cell lines derived from human liver (Huh7), kidneys (ACHN) and colon (Caco2) (Fig. 3). Site-directed mutagenesis of the DR-1 elements located between nucleotides -71/-59 and -55/-43 resulted in a complete loss of HNF-4α-mediated induction of CNT1 promoter activity, whereas mutagenesis of either DR-1 element alone did not impair function (Fig. 4). An additional DR-1 element located between nucleotides -1857/-1845, which is not conserved between humans and rodents, emerged not to be required for HNF-4α-mediated regulation of the CNT1 gene (Fig. 3). Exogenous expression of other transcription factors shown to be capable of binding DR-1 elements such as PPARα, PPARγ and RXRα (1), did not affect CNT1 promoter activity (data not shown). Two cofactors of HNF-4α were shown to be involved in the transcriptional regulation of the CNT1 promoter: the coactivator PGC-1α (Fig. 6A) and the bile acid-inducible corepressor SHP (Fig. 6B). The transcriptional coactivator PGC-1α is a known cofactor for many nuclear receptors and controls a variety of metabolic pathways in several tissues (32). The action of both cofactors, PGC-1α and SHP, was shown to be dependent on the two intact HNF-4α binding elements in the proximal CNT1 promoter (Fig. 6). SHP gene expression has been reported to be activated upon increased bile acid concentrations via a FXR-dependent pathway (17, 34, 52). Our data show that endogenous CNT1 mRNA levels were suppressed,
while SHP mRNA levels were increased, in primary human hepatocytes upon CDCA treatment (Fig. 7).
This study adds CNT1 to the list of human drug transporter genes that are regulated by the nuclear receptor HNF-4α.. HNF-4α is abundantly expressed in adult liver, pancreas, kidneys, and intestine, and controls the expression of many genes involved in glucose, fatty acid, and cholesterol metabolism (4), (53). For years HNF-4α was considered an orphan member of the nuclear receptor family, but endogenous fatty acids were more recently identified to interact with its ligand-binding domain, rendering HNF-4α constitutively active (7), (60). HNF-4α binds as a homodimer to DR-1- and DR-2-type DNA-binding motifs in the promoter regions of target genes (16). Several members of the SLC gene family have been predicted to be such target genes of HNF-4α in human liver and pancreatic islets by a large scale approach using chromatin immunoprecipitations combined with promoter microarrays, although CNT1 was not amongst the listed HNF-4α-regulated candidate genes (40). A role of the nuclear receptor HNF-4α in the regulation of CNT1 expression has been previously suggested from studies on antisense HNF-4α-infected Bc2 cells, which undergo spontaneous differentiation in culture: inhibition of HNF-4α expression abolished upregulation of CNT1 mRNA expression during differentiation (13). The detailed mechanism of HNF-4α-mediated transactivation of human drug transporter genes has been described so far only for the OCT1 (SLC22A1) (51) and OAT2 (SLC22A7) (48) genes in the liver, and the OAT1 (SLC22A6) gene (41) in the kidney. Whereas HNF-4α mediates human OAT2 (48) and CNT1 promoter transactivation via binding to one or two DR-1 elements, respectively, the HNF-4α response elements in the human OCT1 promoter are of the DR-2-type (51). The integrity of the two adjacent DR-2 elements was shown to be required for maximal transactivation of the OCT1 promoter by HNF-4α (51), whereas in the current study the disruption of only one of the two
DR-1 elements in the proximal CNT1 promoter did not impair HNF-4α-mediated increase of promoter activity. Hnf-4α and Pgc-1α have been reported to mediate induction of basolateral hepatic uptake transporters of the Slc gene family upon fasting in rats (8). Having shown that CNT1 promoter activity is increased after cotransfection of HNF-4α and PGC-1α in a number of cell lines, we propose that these two factors may be responsible for the observed increase in Cnt1 expression in rat jejunum upon starvation (55).
Our model of bile acid-mediated regulation of CNT1 gene expression was further supported by in vivo data from mice that were fed a CA-enriched diet or underwent CBDL for one week (Fig. 8 and 9). Feeding with exogenous bile acids is a common model of experimental cholestasis, in which bile acid concentrations are increased selectively without affecting other bile constituents. CBDL is another widely-used cholestatic mouse model mimicking physical obstruction of the biliary tree (54). CA feeding strongly induced Shp mRNA expression and suppressed Cnt1 mRNA expression in mouse ileum.
Bile acids undergo efficient cycling between the liver and the intestine. CBDL results in reduced presentation of bile salts to the apical surface of enterocytes. Similarly to the CA feeding model, ileal Cnt1 and Shp gene expression in CBDL mice is inversely regulated: Cnt1 expression was significantly increased, whereas Shp expression was diminished to almost undetectable limits in ileum of mice that underwent CBDL.
CNT1 is highly expressed in human kidneys and bile acid secretion in urine is markedly increased in both cholestatic animal models and in clinical cholestatic disorders (30, 36, 49). Therefore, we also analysed bile acid-dependent regulation of Cnt1 expression in kidneys of cholestatic mouse models. In contrast to the ileum, feeding a CA-enriched diet had no effect on either Cnt1 or Shp renal mRNA expression levels. The difference in bile acid-responsiveness of Cnt1 in ileum and kidneys of mice after feeding a CA-enriched diet might be explained by
the fact that enterocytes were exposed to much higher concentrations of CA than renal tubule cells. Even if the levels of serum bile acids were significantly elevated upon CA-feeding (data not shown), they may have been modified by phase I and II metabolizing enzymes, before reaching the kidneys. Bile acids undergo hydroxylation, sulfation, and glucuronidation to increase their water solubility, facilitating their detoxification (25). Such modified bile acids may have an altered potency to serve as FXR ligands, and hence to regulate Cnt1 gene expression via a Shp-dependent pathway.
In addition to the CA feeding mouse model we investigated changes in Cnt1 expression in kidneys of CBDL versus SOP mice. CBDL mice are characterized by elevated serum bile acid concentrations and increased urinary bile acid excretion rates (36). Cnt1 mRNA expression was indeed suppressed upon CBDL in kidneys, consistent with our model. Thus renal Cnt1 mRNA expression is only suppressed in the CBDL but not the bile acid feeding model. We note that discrepancies in transporter expression in different animal models of cholestasis have been reported before (31).
Bile acids exert their signalling activity mostly as ligands of the nuclear receptor FXR (35, 42, 57), which activates its target promoters via direct binding to FXR response elements. One FXR-activated target gene encodes the transcriptional corepressor SHP (52), which we propose to mediate the suppressive effects of bile acids on CNT1 gene expression. It should be noted that bile acids do also elicit FXR-independent signalling pathways, such as the c-Jun N-terminal kinase JNK pathway (24), which may contribute to CNT1 gene suppression. In this context it is interesting that the activity of HNF-4α has been suggested to be modulated by phosphorylation events (23, 56, 61). Furthermore, bile acids may reduce CNT1 gene expression by modulating HNF-4α expression. We observed reduced HNF-4α mRNA expression in primary human hepatocytes treated with CDCA, an effect that was observed previously in rat
livers (62) and the liver-derived human cell line Huh7 (48). However, we were not able to detect any significant differences in Hnf-4α mRNA expression in ileum and kidneys in the two cholestatic mouse models. Reduced nuclear localisation of Hnf-4α has been described in mouse liver after CBDL, but not after CA-feeding (65).
In summary (Fig. 10), we have shown that HNF-4α transactivates the CNT1 promoter and that the coactivator PGC-1α further increases HNF-4α-dependent CNT1 promoter activity. Bile acids suppress CNT1 expression in vitro and in vivo, most likely via increasing the expression of the transcriptional corepressor SHP in a FXR/RXR-dependent pathway, thus counteracting the HNF-4α-mediated induction of the CNT1 promoter. Based on these results, the uptake of nucleoside analogue drugs may be decreased in disease conditions associated with elevated intracellular concentrations of bile acids.
ACKNOWLEDGEMENTS
Dr. Anastasia Kralli is acknowledged for donating the PGC-1α expression construct. We thank Christian Hiller for excellent technical assistance and Dagmar Silbert and Judith Gumhold for their assistance with the mouse samples.
GRANTS
This study was supported by the Swiss National Science Foundation project grant 32-120463/1 (to G.A. Kullak-Ublick and J. J. Eloranta), by a collaborative grant of the Zurich Center of Integrative Human Physiology (to G. A. Kullak-Ublick and J. J. Eloranta), and by the Austrian Science Foundation project grant P18613-B05 (to M. Trauner).
REFERENCES
1. Aranda A, Pascual A. Nuclear hormone receptors and gene expression. Physiol Rev 81: 1269-1304, 2001.
2. Arrese M, Trauner M, Sacchiero RJ, Crossman MW, Shneider BL. Neither intestinal sequestration of bile acids nor common bile duct ligation modulate the expression and function of the rat ileal bile acid transporter. Hepatology 28: 1081-1087, 1998.
3. Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, Frisch M, Bayerlein M, Werner T. MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21: 2933-2942, 2005.
4. Cereghini S. Liver-enriched transcription factors and hepatocyte differentiation. Faseb J 10: 267-282, 1996.
5. Chen F, Ma L, Dawson PA, Sinal CJ, Sehayek E, Gonzalez FJ, Breslow J, Ananthanarayanan M, Shneider BL. Liver receptor homologue-1 mediates species- and cell line-specific bile acid-dependent negative feedback regulation of the apical sodium-dependent bile acid transporter. J Biol Chem 278: 19909-19916, 2003.
6. del Santo B, Tarafa G, Felipe A, Casado FJ, Pastor-Anglada M. Developmental regulation of the concentrative nucleoside transporters CNT1 and CNT2 in rat liver. J Hepatol 34: 873-880, 2001.
7. Dhe-Paganon S, Duda K, Iwamoto M, Chi YI, Shoelson SE. Crystal structure of the HNF4 alpha ligand binding domain in complex with endogenous fatty acid ligand. J Biol Chem 277: 37973-37976, 2002.
8. Dietrich CG, Martin IV, Porn AC, Voigt S, Gartung C, Trautwein C, Geier A. Fasting induces basolateral uptake transporters of the SLC family in the liver via HNF4alpha and PGC1alpha. Am J Physiol Gastrointest Liver Physiol 293: G585-590, 2007.
9. Eloranta JJ, Jung D, Kullak-Ublick GA. The human Na+-taurocholate cotransporting polypeptide gene is activated by glucocorticoid receptor and peroxisome proliferator-activated receptor-gamma coactivator-1alpha, and suppressed by bile acids via a small heterodimer partner-dependent mechanism. Mol Endocrinol 20: 65-79, 2006.
10. Eloranta JJ, Kullak-Ublick GA. Coordinate transcriptional regulation of bile acid homeostasis and drug metabolism. Arch Biochem Biophys 433: 397-412, 2005.
11. Farre X, Guillen-Gomez E, Sanchez L, Hardisson D, Plaza Y, Lloberas J, Casado FJ, Palacios J, Pastor-Anglada M. Expression of the nucleoside-derived drug transporters hCNT1, hENT1 and hENT2 in gynecologic tumors. Int J Cancer 112: 959-966, 2004.
12. Felipe A, Valdes R, Santo B, Lloberas J, Casado J, Pastor-Anglada M. Na+-dependent nucleoside transport in liver: two different isoforms from the same gene family are expressed in liver cells. Biochem J 330 ( Pt 2): 997-1001, 1998.
13. Fernandez-Veledo S, Jover R, Casado FJ, Gomez-Lechon MJ, Pastor-Anglada M. Transcription factors involved in the expression of SLC28 genes in human liver parenchymal cells. Biochem Biophys Res Commun 353: 381-388, 2007.
14. Fernandez-Veledo S, Valdes R, Wallenius V, Casado FJ, Pastor-Anglada M. Up-regulation of the high-affinity pyrimidine-preferring nucleoside transporter
concentrative nucleoside transporter 1 by tumor necrosis factor-alpha and interleukin-6 in liver parenchymal cells. J Hepatol 41: 538-544, 2004.
15. Frankenberg T, Rao A, Chen F, Haywood J, Shneider BL, Dawson PA. Regulation of the mouse organic solute transporter alpha-beta, Ostalpha-Ostbeta, by bile acids. Am J Physiol Gastrointest Liver Physiol 290: G912-922, 2006.
16. Fraser JD, Martinez V, Straney R, Briggs MR. DNA binding and transcription activation specificity of hepatocyte nuclear factor 4. Nucleic Acids Res 26: 2702-2707, 1998.
17. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, Galardi C, Wilson JG, Lewis MC, Roth ME, Maloney PR, Willson TM, Kliewer SA. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 6: 517-526, 2000.
18. Govindarajan R, Bakken AH, Hudkins KL, Lai Y, Casado FJ, Pastor-Anglada M, Tse CM, Hayashi J, Unadkat JD. In situ hybridization and immunolocalization of concentrative and equilibrative nucleoside transporters in the human intestine, liver, kidneys, and placenta. Am J Physiol Regul Integr Comp Physiol 293: R1809-1822, 2007.
19. Govindarajan R, Endres CJ, Whittington D, Lecluyse E, Pastor-Anglada M, Tse CM, Unadkat JD. Expression and Hepatobiliary Transport Characteristics of the Concentrative and Equilibrative Nucleoside Transporters in Sandwich-Cultured Human Hepatocytes. Am J Physiol Gastrointest Liver Physiol, 2008.
20. Gray JH, Mangravite LM, Owen RP, Urban TJ, Chan W, Carlson EJ, Huang CC, Kawamoto M, Johns SJ, Stryke D, Ferrin TE, Giacomini KM. Functional and
genetic diversity in the concentrative nucleoside transporter, CNT1, in human populations. Mol Pharmacol 65: 512-519, 2004.
21. Gray JH, Owen RP, Giacomini KM. The concentrative nucleoside transporter family, SLC28. Pflugers Arch 447: 728-734, 2004.
22. Guallar JP, Cano-Soldado P, Aymerich I, Domingo JC, Alegre M, Domingo P, Villarroya F, Javier Casado F, Giralt M, Pastor-Anglada M. Altered expression of nucleoside transporter genes (SLC28 and SLC29) in adipose tissue from HIV-1-infected patients. Antivir Ther 12: 853-863, 2007.
23. Guo H, Wei J, Inoue Y, Gonzalez FJ, Kuo PC. Serine/threonine phosphorylation regulates HNF-4alpha-dependent redox-mediated iNOS expression in hepatocytes. Am J Physiol Cell Physiol 284: C1090-1099, 2003.
24. Gupta S, Stravitz RT, Dent P, Hylemon PB. Down-regulation of cholesterol 7alpha-hydroxylase (CYP7A1) gene expression by bile acids in primary rat hepatocytes is mediated by the c-Jun N-terminal kinase pathway. J Biol Chem 276: 15816-15822, 2001.
25. Hofmann AF, Hagey LR. Bile acids: chemistry, pathochemistry, biology, pathobiology, and therapeutics. Cell Mol Life Sci 65: 2461-2483, 2008.
26. Jung D, Podvinec M, Meyer UA, Mangelsdorf DJ, Fried M, Meier PJ, Kullak-Ublick GA. Human organic anion transporting polypeptide 8 promoter is transactivated by the farnesoid X receptor/bile acid receptor. Gastroenterology 122: 1954-1966, 2002. 27. King AE, Ackley MA, Cass CE, Young JD, Baldwin SA. Nucleoside transporters:
28. Landrier JF, Eloranta JJ, Vavricka SR, Kullak-Ublick GA. The nuclear receptor for bile acids, FXR, transactivates human organic solute transporter-alpha and -beta genes. Am J Physiol Gastrointest Liver Physiol 290: G476-485, 2006.
29. Leabman MK, Huang CC, DeYoung J, Carlson EJ, Taylor TR, de la Cruz M, Johns SJ, Stryke D, Kawamoto M, Urban TJ, Kroetz DL, Ferrin TE, Clark AG, Risch N, Herskowitz I, Giacomini KM. Natural variation in human membrane transporter genes reveals evolutionary and functional constraints. Proc Natl Acad Sci U S A 100: 5896-5901, 2003.
30. Lee J, Azzaroli F, Wang L, Soroka CJ, Gigliozzi A, Setchell KD, Kramer W, Boyer JL. Adaptive regulation of bile salt transporters in kidney and liver in obstructive cholestasis in the rat. Gastroenterology 121: 1473-1484, 2001.
31. Lickteig AJ, Slitt AL, Arkan MC, Karin M, Cherrington NJ. Differential regulation of hepatic transporters in the absence of tumor necrosis factor-alpha, interleukin-1beta, interleukin-6, and nuclear factor-kappaB in two models of cholestasis. Drug Metab Dispos 35: 402-409, 2007.
32. Lin J, Handschin C, Spiegelman BM. Metabolic control through the PGC-1 family of transcription coactivators. Cell Metab 1: 361-370, 2005.
33. Loots GG, Ovcharenko I. rVISTA 2.0: evolutionary analysis of transcription factor binding sites. Nucleic Acids Res 32: W217-221, 2004.
34. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, Mangelsdorf DJ. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 6: 507-515, 2000.
35. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, Hull MV, Lustig KD, Mangelsdorf DJ, Shan B. Identification of a nuclear receptor for bile acids. Science 284: 1362-1365, 1999.
36. Marschall HU, Wagner M, Bodin K, Zollner G, Fickert P, Gumhold J, Silbert D, Fuchsbichler A, Sjovall J, Trauner M. Fxr(-/-) mice adapt to biliary obstruction by enhanced phase I detoxification and renal elimination of bile acids. J Lipid Res 47: 582-592, 2006.
37. Meier Y, Eloranta JJ, Darimont J, Ismair MG, Hiller C, Fried M, Kullak-Ublick GA, Vavricka SR. Regional distribution of solute carrier mRNA expression along the human intestinal tract. Drug Metab Dispos 35: 590-594, 2007.
38. Neimark E, Chen F, Li X, Shneider BL. Bile acid-induced negative feedback regulation of the human ileal bile acid transporter. Hepatology 40: 149-156, 2004.
39. NIH. Laboratory animal welfare: Public Health Service policy on humane care and use of laboratory animals by awardee institutions; notice. Fed Regist 50: 19584-19585, 1985. 40. Odom DT, Zizlsperger N, Gordon DB, Bell GW, Rinaldi NJ, Murray HL, Volkert
TL, Schreiber J, Rolfe PA, Gifford DK, Fraenkel E, Bell GI, Young RA. Control of pancreas and liver gene expression by HNF transcription factors. Science 303: 1378-1381, 2004.
41. Ogasawara K, Terada T, Asaka J, Katsura T, Inui K. Hepatocyte nuclear factor-4{alpha} regulates the human organic anion transporter 1 gene in the kidney. Am J Physiol Renal Physiol 292: F1819-1826, 2007.
42. Parks DJ, Blanchard SG, Bledsoe RK, Chandra G, Consler TG, Kliewer SA, Stimmel JB, Willson TM, Zavacki AM, Moore DD, Lehmann JM. Bile acids: natural ligands for an orphan nuclear receptor. Science 284: 1365-1368, 1999.
43. Pastor-Anglada M, Cano-Soldado P, Errasti-Murugarren E, Casado FJ. SLC28 genes and concentrative nucleoside transporter (CNT) proteins. Xenobiotica 38: 972-994, 2008.
44. Pawelczyk T, Podgorska M, Sakowicz M. The effect of insulin on expression level of nucleoside transporters in diabetic rats. Mol Pharmacol 63: 81-88, 2003.
45. Pennycooke M, Chaudary N, Shuralyova I, Zhang Y, Coe IR. Differential expression of human nucleoside transporters in normal and tumor tissue. Biochem Biophys Res Commun 280: 951-959, 2001.
46. Podgorska M, Kocbuch K, Grden M, Szulc A, Szutowicz A, Pawelczyk T. Different signaling pathways utilized by insulin to regulate the expression of ENT2, CNT1, CNT2 nucleoside transporters in rat cardiac fibroblasts. Arch Biochem Biophys 464: 344-349, 2007.
47. Podvinec M, Kaufmann MR, Handschin C, Meyer UA. NUBIScan, an in silico approach for prediction of nuclear receptor response elements. Mol Endocrinol 16: 1269-1279, 2002.
48. Popowski K, Eloranta JJ, Saborowski M, Fried M, Meier PJ, Kullak-Ublick GA. The human organic anion transporter 2 gene is transactivated by hepatocyte nuclear factor-4 alpha and suppressed by bile acids. Mol Pharmacol 67: 1629-1638, 2005. 49. Raedsch R, Lauterburg BH, Hofmann AF. Altered bile acid metabolism in primary
biliary cirrhosis. Dig Dis Sci 26: 394-401, 1981.
50. Ritzel MW, Yao SY, Huang MY, Elliott JF, Cass CE, Young JD. Molecular cloning and functional expression of cDNAs encoding a human Na+-nucleoside cotransporter (hCNT1). Am J Physiol 272: C707-714, 1997.
51. Saborowski M, Kullak-Ublick GA, Eloranta JJ. The human organic cation transporter-1 gene is transactivated by hepatocyte nuclear factor-4alpha. J Pharmacol Exp Ther 317: 778-785, 2006.
52. Seol W, Choi HS, Moore DD. An orphan nuclear hormone receptor that lacks a DNA binding domain and heterodimerizes with other receptors. Science 272: 1336-1339, 1996.
53. Sladek FM. Orphan receptor HNF-4 and liver-specific gene expression. Receptor 3: 223-232, 1993.
54. Stahl S, Davies MR, Cook DI, Graham MJ. Nuclear hormone receptor-dependent regulation of hepatic transporters and their role in the adaptive response in cholestasis. Xenobiotica 38: 725-777, 2008.
55. Valdes R, Ortega MA, Casado FJ, Felipe A, Gil A, Sanchez-Pozo A, Pastor-Anglada M. Nutritional regulation of nucleoside transporter expression in rat small intestine. Gastroenterology 119: 1623-1630, 2000.
56. Viollet B, Kahn A, Raymondjean M. Protein kinase A-dependent phosphorylation modulates DNA-binding activity of hepatocyte nuclear factor 4. Mol Cell Biol 17: 4208-4219, 1997.
57. Wang H, Chen J, Hollister K, Sowers LC, Forman BM. Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 3: 543-553, 1999.
58. Wang L, Han Y, Kim CS, Lee YK, Moore DD. Resistance of SHP-null mice to bile acid-induced liver damage. J Biol Chem 278: 44475-44481, 2003.
59. Wang L, Lee YK, Bundman D, Han Y, Thevananther S, Kim CS, Chua SS, Wei P, Heyman RA, Karin M, Moore DD. Redundant pathways for negative feedback regulation of bile acid production. Dev Cell 2: 721-731, 2002.
60. Wisely GB, Miller AB, Davis RG, Thornquest AD, Jr., Johnson R, Spitzer T, Sefler A, Shearer B, Moore JT, Willson TM, Williams SP. Hepatocyte nuclear factor 4 is a transcription factor that constitutively binds fatty acids. Structure 10: 1225-1234, 2002.
61. Xu Z, Tavares-Sanchez OL, Li Q, Fernando J, Rodriguez CM, Studer EJ, Pandak WM, Hylemon PB, Gil G. Activation of bile acid biosynthesis by the p38 mitogen-activated protein kinase (MAPK): hepatocyte nuclear factor-4alpha phosphorylation by the p38 MAPK is required for cholesterol 7alpha-hydroxylase expression. J Biol Chem 282: 24607-24614, 2007.
62. Yang Y, Zhang M, Eggertsen G, Chiang JY. On the mechanism of bile acid inhibition of rat sterol 12alpha-hydroxylase gene (CYP8B1) transcription: roles of alpha-fetoprotein transcription factor and hepatocyte nuclear factor 4alpha. Biochim Biophys Acta 1583: 63-73, 2002.
63. Yoon JC, Puigserver P, Chen G, Donovan J, Wu Z, Rhee J, Adelmant G, Stafford J, Kahn CR, Granner DK, Newgard CB, Spiegelman BM. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 413: 131-138, 2001.
64. Zollner G, Fickert P, Fuchsbichler A, Silbert D, Wagner M, Arbeiter S, Gonzalez FJ, Marschall HU, Zatloukal K, Denk H, Trauner M. Role of nuclear bile acid receptor, FXR, in adaptive ABC transporter regulation by cholic and ursodeoxycholic acid in mouse liver, kidney and intestine. J Hepatol 39: 480-488, 2003.
65. Zollner G, Wagner M, Fickert P, Geier A, Fuchsbichler A, Silbert D, Gumhold J, Zatloukal K, Kaser A, Tilg H, Denk H, Trauner M. Role of nuclear receptors and
hepatocyte-enriched transcription factors for Ntcp repression in biliary obstruction in mouse liver. Am J Physiol Gastrointest Liver Physiol 289: G798-805, 2005.
66. Zollner G, Wagner M, Moustafa T, Fickert P, Silbert D, Gumhold J, Fuchsbichler A, Halilbasic E, Denk H, Marschall HU, Trauner M. Coordinated induction of bile acid detoxification and alternative elimination in mice: role of FXR-regulated organic solute transporter-alpha/beta in the adaptive response to bile acids. Am J Physiol Gastrointest Liver Physiol 290: G923-932, 2006.
FIGURE LEGENDS
Fig. 1. Determination of the transcriptional start site of the human CNT1 gene by 5`-RACE using liver RNA. A. The 5`-5`-RACE product was cloned into the pGEM-T vector and sequenced. B. The position of the exons (E) in the CNT1 sequence is shown. The oligonucleotide primer (arrow) used in the 5`-RACE experiment is located in exon 3. C. The transcription start site +1 of the CNT1 gene identified by 5`-RACE is located 27 bp upstream of the predicted exon 1 according to GenBank submission NM_004213 shown in grey.
Fig. 2. Identification of putative HNF-4α response elements within the human CNT1 promoter. A. In the top row, the consensus sequence of a HNF-4α response element DR-1 is shown. Sequence and location relative to the transcription start site of the DR-1 like elements of the CNT1 promoter are shown. Nucleotides different from the consensus sequence are underlined. Mutated DR-1 elements used in figures 4, 5, and 6 are shown below. B. The DR-1 elements (boxes) -71/-59 and -55/-43 are conserved between human and rodent CNT1/Cnt1 genes. In the top row, the human sequence containing the two proximal DR-1 elements is shown. Nucleotides in the rodent DR-1 elements that differ from the human sequence are underlined.
Fig. 3. HNF-4α transactivates the human CNT1 promoter. A. Huh7 B. Caco2 and C. ACHN cells were cotransfected with reporter-linked CNT1 promoter deletion constructs, as well as the promoterless reporter vector pGL3basic. With each construct, either a CMV promoter-driven expression plasmid for HNF-4α or an empty pcDNA3.1(-) vector (control) was cotransfected. Relative luciferase activities obtained for pcDNA3.1(-)-transfected cells are
set to 1, and the fold activities in other test conditions are shown relative to these. n.s. not significant, ***p<0.001.
Fig. 4. Two DR-1 elements within the human CNT1 promoter are functional. Huh7 cells were cotransfected with reporter-linked CNT1 promoter construct -99/+110, as well as the promoterless reporter vector pGL3basic. DR-1 elements in the promoter constructs were mutated (boxes with a cross) by site-directed mutagenesis, either together or separately. With each construct, either a CMV promoter-driven expression plasmid for HNF-4α or an empty pcDNA3.1(-) vector (control) was cotransfected. Relative luciferase activities obtained for pcDNA3.1(-)-transfected cells are set to 1, and the fold activities in other test conditions are shown relative to these. n.s. not significant., ***p<0.001.
Fig. 5. HNF-4α specifically binds to the DR-1 elements within the CNT1 promoter. A. Electrophoretic mobility shift assays were performed using nuclear extracts (NE) from Huh7 cells and the CNT1 sequence containing the wild-type (WT) or mutated (mut) DR-1 elements as radiolabelled probes. Nucleotide exchanges in mutated probes are shown in the sequence below. Probes contained each of the DR-1 elements separately or combined. Numbers indicate the position of the probes within the CNT1 promoter relative to the transcription start site. To identify protein-DNA complexes specifically formed between HNF-4α and the radiolabelled probes, samples preincubated with a HNF-4α antibody were included as indicated. B. Competition assays were performed using nuclear extracts (NE) from Huh7 cells and a radiolabelled probe containing the HNF-4α consensus binding site. Competitor probes containing the CNT1 wild-type (WT) or mutated (mut) DR-1 elements were added in a 50-fold, 100-fold or 200-fold molar excess as indicated.
Fig. 6. PGC-1α coactivates and SHP represses CNT1 promoter activity. Huh7 cells were transfected with the CNT1 promoter constructs -2450/+110, -99/+110, and mutated -99/+110, and cotransfected with HNF-4α expression plasmid with or without an expression plasmid for A. PGC-1α or B. SHP. Relative luciferase activities obtained for pcDNA3.1(-)-transfected cells are set to 1, and the fold activities in other test conditions are shown relative to these. n.s. not significant. ***p<0.001.
Fig. 7. Bile acids suppress CNT1 expression levels. Primary human hepatocytes of two donors were treated with 50 µM CDCA or the vehicle DMSO for 16 hours before isolating total cellular RNA. After reverse transcription, cDNAs were analysed by TaqMan PCR for CNT1, SHP, HNF-4α, NTCP, and OATP1B3 expression levels. The signal obtained for the DMSO-treated cells was set to 1, and values for CDCA-treated cells are shown relative to this. ***p<0.001.
Fig. 8. Effects of bile acids on Cnt1 expression in the ileum. Total ileal RNAs were isolated from mice A. fed a CA-enriched diet or a standard diet, or B. one week after sham operation (SOP) or common bile duct ligation (CBDL). After reverse transcription, cDNAs were analysed by TaqMan PCR for Cnt1, Shp, Hnf-4α, Asbt, Ostα, and Ostβ expression levels. Expression levels were normalized to villin expression. Values are averages from 4-5 animals per group. Data of CA-fed animals are shown relative to data from animals fed a standard diet. n.s. not significant. * p<0.05, ** p<0.01, ***p<0.001.
Fig. 9. Effects of bile acids on Cnt1 expression in kidneys. Total kidney RNAs were isolated from mice A. fed a CA-enriched diet or a standard diet, or B. one week after sham operation (SOP) or common bile duct ligation (CBDL). After reverse transcription, cDNAs were analysed by TaqMan PCR for Cnt1, Shp, Hnf-4α, Ostα, and Ostβ expression levels. Expression levels were normalized to Hprt expression. Values are averages from 4 animals per group. Data of CA-fed animals are shown relative to data from animals fed a standard diet. n.s. not significant. * p<0.05, ** p<0.01.
Fig. 10. Potential pathways that regulate CNT1 gene expression. Bile acids bind to and activate FXR, which heterodimerizes with RXR, and induces the expression of SHP. SHP is a corepressor for HNF-4α, which binds to the DR-1 elements in the CNT1 promoter. PGC-1α coactivates HNF-4α-mediated induction of CNT1 gene expression. Furthermore, bile acids may have a direct, SHP-independent, effect on CNT1 gene expression.
Table 1. Sequences of oligonucleotides used for cloning, mutagenesis, and as EMSA probes. Only the top strands are shown for oligonucleotides used in EMSA assays. Where applicable, restriction sites introduced are underlined and corresponding enzymes used are given in parentheses.
Oligonucleotide Sequence (5’-3’) Purpose
hCNT1 -2450 for GATACGCGTATAATAGACAGGGACATCACCC (MluI) hCNT1(-2450/+110) cloning
hCNT1 +110 rev GATCTCGAGTCCTTTTCTCTCACCCTTGTT (XhoI) hCNT1(-2450/+110) cloning
hCNT1 -341 for ACGCGTTGGCTTCTGGGGTCTGG (MluI) hCNT1(-341/+110) cloning
hCNT1 -99 for ACGCGTTAACTTTGGCAGTCAGGAGTG (MluI) hCNT1(-99/+110) cloning
hCNT1 -29 for ACGCGTTGTAGAGATTAGGGCCCACAA (MluI) hCNT1(-29/+110) cloning
hCNT1 +3 rev CTCGAGTCTCTACAACAAGGATTTAATGGGCT (XhoI) hCNT1(-99/+3) cloning
hHNF-4α for GAATTCGGCCATGGTCAGCGTGAACGC (EcoRI) hHNF-4α cloning
hHNF-4α rev GGATCCCTAGATAACTTCCTGCTTGGTGATGG (BamHI) hHNF-4α cloning
hSHP for GGATCCATATGAGCACCAGCCAACCAGGGG (BamHI) hSHP cloning
hSHP rev GAATTCTACCTGAGCAAAAGCATGTCCCCAAGAAG (EcoRI) hSHP cloning
hCNT1 wt AGCTAGTGGAGACCTTTGGGCTCCAAGCTCAAGGTCCACCCCA EMSA (-76/-38)
hCNT1 mut AGCTAGTGGATACTTTTTGGTTCCAAACTAAAGATCAACCCCA EMSA (-76/-38)
hCNT1 wt AGCTAGTGGAGACCTTTGGGCTCCAAG EMSA (-76/-54)
hCNT1 mut AGCTAGTGGATACTTTTTGGTTCCAAG EMSA (-76/-54)
hCNT1 wt AGCTCTCCAAGCTCAAGGTCCACCCCA EMSA (-60/-38)
hCNT1 mut AGCTCTCCAAACTAAAGTTCTACCCCA EMSA (-60/-38)
HNF-4α consensus GATCAGGTCTCACAGGTCAAAGGTCACCCTGGGA EMSA
hCNT1 -55/-43 GAGACCTTTGGGCTCCAAACTAAAGTTCTACCCCAAGAC hCNT1(-99/+110) mutagenesis
hCNT1 -71/-59 GTCAGGAGTGGATACTTTTTGGTTCCAAGCTCAAGGTCC hCNT1(-99/+110) mutagenesis
hCNT1 exon3 rev GCCCCCATGTTCTCCAGACCCTTGGCC 5`-RACE
gene used in TaqMan PCR experiments are shown. Figure 7
gene Donor 1: Ct ± SD Donor 2: Ct ± SD
CNT1 29.1 ± 0.05 28.6 ± 0.09 SHP 31.3 ± 0.09 28.0 ± 0.04 HNF-4α 26.2 ± 0.01 25.5 ± 0.05 NTCP 26.4 ± 0.08 24.0 ± 0.03 OATP1B3 29.2 ± 0.28 30.6 ± 0.24 Figure 8A gene Ct ± SD Cnt1 32.4 ± 0.85 Shp 33.2 ± 1.6 Hnf-4α 24.6 ± 0.97 Asbt 23.1 ± 1.03 Ostα 24.8 ± 0.97 Ostβ 23.6 ± 1.6 Figure 8B gene Ct ± SD Cnt1 32.2 ± 2.04 Shp 30.7 ± 2.29 Hnf-4α 23.6 ± 0.45 Asbt 23.4 ± 0.21 Ostα 23.9 ± 0.45 Ostβ 23.2 ± 0.44 Figure 9A gene Ct ± SD Cnt1 30.9 ± 0.47 Shp 34.2 ± 0.54 Hnf-4α 22.9 ± 0.17 Ostα 27.1 ± 0.29 Ostβ 27.0 ± 0.09 Figure 9B gene Ct ± SD Cnt1 30.2 ± 0.14 Shp 33.8 ± 0.30 Hnf-4α 30.2 ± 0.24 Ostα 26.6 ± 0.43 Ostβ 26.9 ± 0.22
320 bp 190 bp 5` 3` 97 214 325 1 E1 E2 E3 +1 AAGCCCGGAGTCTCCTGGCCTGGAGGAGGGGAGCAGTGTGTCAGGACACCCCGGATGG GACCTGTGACAGCAATGACACCTGCCAGCCTGATGCCGCTTGACTCCCTGCCAGGTACTT CCTAAGCAGGAGCACGCTGACTCCTCATGTGCTCTATTACCCACCACCAGATGAGGCAGC AAGTTAACTTTGGCAGTCAGGAGTGGAGACCTTTGGGCTCCAAGCTCAAGGTCCACCCCA AGACACACAGCCCATTAAATCCTTGTTGTAGAGATTAGGGCCCACAACGATGTGAAGGTTA TAAGCTGCACTGCATGGTTGCTGCTGGATGTGTTGTGTTCCTGGCTTCCCTCTGGATGCTG ACAGAAACAAGGGTGAGAGAAAAGGACAGTAGGAGAGGAGGGAAGGCGGGACTGAAGAA AGGAGGGGAAGGGGGTAGCACAGGGCAAAGTGGAAAAGCAGGTAGCGTCCTTTTTTTCTT CACTAGGGCTTGGCGAAGACCCCTTCGAGGACAGCTCCAGGCCCATCCCTGTGGTGGCCA
C
98 213site (DR-1): human CNT1 nt -55/-43: human CNT1 nt -1857/-1845: human CNT1 nt -59/-71: TC A G AGCTCAaGGTCCA AGCTCAgAGTTCA AGCCCAaAGGTCT AGTGGAGACCTTTGGGCTCCAAGCTCAAGGTCCACCC AATCGAGATCTTTGGGCTCCCAGCTCAAGGTTCATCC AATCTAGATCTTTGGGCTCCCAGCTCAAGGTTCATCC -71/-59 -55/-43 human: mouse: rat:
B
human CNT1 nt -55/-43 mut: human CNT1 nt -59/-71 mut: AACTAAaGATCAA AACCAAaAAGTAT0 1 2 3 4 5 6 7 8 9 luc -71/-59 -55/-43 -1857/-1845 -2540/+110 luc -653/+110 luc -341/+110 luc -99/+110 luc -29/+110 luc -99/+3 *** *** n.s . *** *** *** *** *** *** control HNF-4α
relative luciferase fold activity
0 0.5 1 1.5 2 2.5 3 *** *** n.s . *** -2450/+110 -99/+110 -29/+110
B
0 2 4 6 8 10 12 14relative luciferase fold activity
*** -2450/+110 -99/+110 -29/+110 *** *** n.s .
C
-71/-59 -55/-43 5` 3` 5` 3` 5` 3` 5` 3` *** n.s . *** *** *** *** *** control HNF-4α
supershift HNF-4α HNF-4α antibody probe: hCNT1 -76/-38 -76/-54 -60/-38 - -- - - + ++ - -+ ++ - -+ ++ - -+ ++- -+ ++- -+ ++ hCNT1: 5` agtggAGACCTtTGGGCTccaAGCTCAaGGTCCAcccca 3` -71/-59 -55/-43 T T T A A A A T probe: HNF-4α consensus HNF-4α NE - + + + + + + + + + + + + + WT WT mut mut competitor: hCNT1 -76/-54 -60/-38 50 100 200 50 100 200 50 100 200 50 100 200 - - B
0 2 4 6 8 10 12 14
relative luciferase fold activity
luc -71/-59 -55/-43 -1857/-1845 -2540/+110 luc -99/+110 luc mut-99/+110 *** n.s . *** n.s . n.s . n.s . n.s . *** *** control HNF-4α HNF-4α + PGC-1α PGC-1α *** n.s . *** n.s . n.s . n.s . n.s . *** *** control HNF-4α HNF-4α + SHP SHP
NTCP OATP1B3 CNT1 SHP control CDCA HNF-4α 0 0.2 0.4 0.6 0.8 0 24 6 8 10 12 0 0.2 0.4 0.6 0 0.2 0.4 0.6 0.8 1 1.2 0 0.51 1.5 2 2.5 3 relative mR expressi relative mR NA expressi on *** *** *** ***
donor 1 donor 2 donor 1 donor 2 donor 1
donor 1 donor 1
donor 2
donor 2 donor 2
0.5% CA 0.25 0.50 0.75 1.00 0 Cnt1 0 0.25 0.50 0.75 1 1.25 Ostα 0 10 Shp 0 0.25 0.50 0.75 Hnf-4α 0 0.5 1 1.5 2 2.5 Asbt 0 1 2 1 Ostβ ** n.s. n.s.
relative mRNA expression relative mRNA expression
1.5 0.5 15 5 SOP CBDL 0 5 10 15 20 25 30 35 0 0.25 0.50 0.75 1 1.25 0 1 2 1.5 0.5
relative mRNA expression
n.s. 0 0.5 1 1.5 0 0.25 0.50 0.75 1 0 1 2 1.5 0.5 Cnt1 Shp Hnf-4α Ostα Asbt Ostβ
relative mRNA expression
*** ***
n.s.
* *
0 1 Cnt1 0 0.5 1 Shp 0 0.5 1 1.5 Cnt1 0 0.5 1 1.5 Shp 0 0.25 0.50 0.75 Hnf-4α 1.5 0.5 relative mRN A expressio n 1% CA * SOP CBDL 0 1 2 3 4 5 6 7 Ostα 1 2 3 4 Ostβ 0 relative mRN A expressio n ** 0 0.5 1 1.5 Hnf-4α 0 1 2 Ostα 1.5 0.5 0 1 2 Ostβ 1.5 0.5 ** n.s. n.s. n.s. n.s. relative mRN A expressio n relative mRN A expressio n B
SHP SHP DR-1 (-55/-43) DR-1 (-71/-59) PGC-1α ? FXR RXR hCNT1 4α 4α
Supplemental figure 1. Basal CNT1 promoter activity: Huh7, Caco2, and ACHN cells were transfected with reporter-linked CNT1 promoter deletion constructs, as well as promoterless reporter vector pGL3basic. Luciferase activities obtained for pGL3basic-transfected cells are set to 1, and the fold activities for CNT1 promoter deletion constructs are shown relative to these.
0 1 2 3 4 5 6 7 8 Huh7 Caco2 ACHN pGL3 basic pGL3 basic -2450/+110 -653/+110 -2450/+110 -341/+110 -99/+110 -99/+110 -29/+110 pGL3 basic -2450/+110 -99/+110 -29/+110 -29/+110 -99/+3
