Supplementary Material 1
2
Convergent lines of evidence support NOTCH4 as a schizophrenia risk gene 3
4
Yan Zhang1,8, Shiwu Li2,3,8, Xiaoyan Li2,3,8, Yongfeng Yang1,4,5, Wenqiang Li1,4,5, Xiao Xiao2, 5
Ming Li2, Luxian Lv1,4,5,*, & Xiong-Jian Luo2,3,6,7,*
6 7
1Henan Mental Hospital, The Second Affiliated Hospital of Xinxiang Medical University, 8
Xinxiang, Henan 453002, China 9
2Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of 10
Sciences & Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, 11
Kunming, Yunnan 650223, China 12
3Kunming College of Life Science, University of Chinese Academy of Sciences, Kunming, 13
Yunnan 650204, China 14
4Henan Key Lab of Biological Psychiatry of Xinxiang Medical University, Xinxiang, Henan 15
453002, China 16
5International Joint Research Laboratory for Psychiatry and Neuroscience of Henan, 17
Xinxiang, Henan 453002, China 18
6Center for Excellence in Animal Evolution and Genetics, Chinese Academy of Sciences, 19
Kunming 650223, China 20
7KIZ-CUHK Joint Laboratory of Bioresources and Molecular Research in Common Diseases, 21
Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 22
8These authors contributed equally to this work 23
*To whom correspondence should be addressed; Key Laboratory of Animal Models and Human 24
Disease Mechanisms, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 25
Yunnan 650204, China; Tel: +86-871-68125413, E-mail: [email protected] (XJL) or 26
[email protected] (LXL).
27 28 29 30 31 32 33 34
Supplemental methods 1
2
Brain eQTL data sets used for Sherlock integrative analysis 3
Two brain eQTL data sets were used for Sherlock integrative analysis in this study. The first eQTL 4
was from the common mind consortium (CMC) [1]. In CMC, brain tissues (the dorsolateral 5
prefrontal cortex) were collected from 467 genetically-inferred Caucasian samples and gene 6
expression was quantified with RNA sequencing (HiSeq2500 platform). Genotypes were 7
determined using the Illumina Infinium HumanOmni ExpressExome 8 v 1.1b chip and eQTL was 8
analyzed with MatrixEQTL [2] (with a linear model). More detailed information about tissue 9
collection, RNA sequencing, genotyping, quality control and statistical analyses can be found in 10
the original paper [1]. The second eQTL data set was from the xQTL data of Ng et al. [3]. Ng et al.
11
generated a comprehensive multi-omic datasets that contain RNA-seq, methylation and histone 12
acetylation, which made the identification of eQTL, mQTL (methylation quantitative trait locus), 13
and haQTL (histone acetylation quantitative trait locus) possible [3]. We only used the eQTL 14
resource from xQTL. The gene expression data were measured by using RNA-seq from the 15
dorsolateral prefrontal cortex, and DNA was extracted from whole blood, lymphocytes or frozen 16
brain tissue. Genotyping was performed on the Affymetrix genome-wide human-SNP array6.0 and 17
Illumina OmniQuad express platform. After genotype quality control and expression outlier test, 18
494 individuals were included in the eQTL analysis. More detailed information about tissue 19
collection, RNA sequencing, genotyping, quality control and statistical analyses can be found in 20
the original paper [3].
21 22
Sherlock integrative analysis 23
Most of the risk variants identified by schizophrenia GWAS were located in non-coding regions, 24
suggesting that these identified variants may confer risk of schizophrenia through affecting gene 1
expression rather than protein function. To identify genes whose expression level may confer risk 2
of disease, He et al. developed an integrative analysis method based on Bayesian statistical 3
inference hypothesis (named Sherlock) [4]. Sherlock hypothesizes that any genetic variation that 4
affects the expression of disease-related genes would also affect the occurrence of the disease [4].
5
Sherlock considers both cis and trans expression quantitative trait loci. Although the effect of a 6
single variant may often be weak and not enough to provide adequate information, accumulation 7
effect of expression variants for an individual gene can provide a powerful statistical signal.
8
Therefore, each gene usually contains different set of expression SNPs (eSNPs) with different 9
effect sizes [4]. Sherlock identifies disease-associated genes through integrating genetic 10
associations from genome-wide association study (GWAS) and independent expression 11
quantitative trait locus (eQTL) data. Cumulative evidence from GWAS and eQTL could be 12
combined by Sherlock to test if a gene is associated with a specific disease.
13
Before performing Sherlock analysis, we filtered the eQTL results first. P threshold for 14
cis-eSNPs (within 1 Mb of the gene) was set to < 1E-3 and trans-eSNPs was set to < 5E-5. To 15
generate null GWAS P values, we performed 100 permutations to randomly assign the 503 16
European individuals from the 1,000 Genomes (Phase 3, http://www.1000genomes.org) into cases 17
and controls, as suggested by the author (Dr. Xin He) of the Sherlock software. Parameters were 18
set according to samples information of eQTL and GWAS data and the prevalence of disease.
19
Sherlock integrative method computes the Bayes factor (BF) for each SNP, and the total score for 20
each gene is the sum of the logarithm of BF (LBF) of each SNP [4]. The value of LBF score of a 21
gene can be used as an evaluation criterion for the strength of the relationship between this gene 22
and disease, the larger LBF value, the higher probability that this gene is associated with disease.
1
For example, LBF=4.6 means that the probability of the alternative hypothesis (associated with 2
schizophrenia) is 100 times greater than the probability of the null hypothesis (unrelated to 3
schizophrenia), exp[4.6]=100 times [4]. For the LBF value of any SNP, if LBF>0, then it means 4
that the variant is positively correlated with schizophrenia, otherwise it is not correlated. The LBF 5
value of a gene is equal to the sum of the LBF values of all eSNPs.
6
7
Expression patterns analysis of NOTCH4 across human brain development 8
Briefly, human brain tissues from different developmental stages (range from 5.7 weeks 9
post-conception (PCW) to 82 years) were collected from 42 subjects by BrainSpan [5] and gene 10
expression was quantified with RNA sequencing. The transformed gene expression values (RPKM, 11
reads per kilobase per million reads) from four sub-regions (including the dorsolateral frontal 12
cortex (DFC), the medial frontal cortex (MFC), the orbital frontal cortex (OFC) and the 13
ventrolateral frontal cortex (VFC)) were used to plot the temporal expression pattern of NOTCH4.
14
More detailed information about transformation and plot processes have described in the study of 15
Yang et al. [6].
16
17
Expression analysis of NOTCH4 in other psychiatric disorder (i.e., major depressive disorder, 18
MDD) and neurodegenerative disease (i.e., Alzheimer's disease, AD).
19
We first examined NOTCH4 expression in MDD using the data from Duric et al. [7]. Briefly, 20
Duric et al. collected brain tissues (from two subregions of the hippocampus, the dentate gyrus 21
and CA1) of 21 MDD cases and 18 matched controls. Gene expression was quantified with human 22
whole-genome expression MI Ready microarrays (Microarray, Inc.). We found that NOTCH4 did 1
not show significant change in MDD cases in study of Duric et al. We also examined NOTCH4 2
expression using the expression data from the study of Jansen et al. [8]. Jansen et al. quantified 3
gene expression gene expression in peripheral blood from 1,848 subjects (including 1,517 MDD 4
cases and 331 controls) from The Netherlands Study of Depression and Anxiety. Again, we found 5
that NOTCH4 did not show significant change in MDD cases in study of Jansen et al. Finally, we 6
explored NOTCH4 expression in neurodegenerative disease (Alzheimer's disease, AD) using the 7
expression data from the AD database (http://www.alzdata.org/) [9]. NOTCH4 expression was not 8
changed in AD cases compared with controls (Supplementary Fig.8).
9
10
Supplementary Table 1. Sequences of shRNAs targeting to Notch4 and primers used for qPCR
Primer Sequence(5'to3')
Notch4-shRNA1#-F CCGGGCAAGTTATGCCAGGATAATGCTCGAGCATTATCCTGGCATAACTTGCTTTTTG Notch4-shRNA1#-R AATTCAAAAAGCAAGTTATGCCAGGATAATGCTCGAGCATTATCCTGGCATAACTTGC Notch4-shRNA2#-F CCGGGGATCCTGTGAGATCACAACACTCGAGTGTTGTGATCTCACAGGATCCTTTTTG Notch4-shRNA2#-R AATTCAAAAAGGATCCTGTGAGATCACAACACTCGAGTGTTGTGATCTCACAGGATCC Notch4-shRNA3#-F CCGGGGAGTGTGAATCGGAGGTTCTCTCGAGAGAACCTCCGATTCACACTCCTTTTTG Notch4-shRNA3#-R AATTCAAAAAGGAGTGTGAATCGGAGGTTCTCTCGAGAGAACCTCCGATTCACACTCC Notch4-qPCR-F TGGAGATGGACCTCTGTCAGAGC
Notch4-qPCR-R ATGGATGCCGCAGGAAAGG
Actb-qPCR-F CATGTACGTTGCTATCCAGGC
Actb-qPCR-R CTCCTTAATGTCACGCACGAT
Mouse-Nanog-F-100: TCTTCCTGGTCCCCACAGTTT Mouse-Nanog-R-100: GCAAGAATAGTTCTCGGGATGAA Mouse-Klf4-F-185: GTGCCCCGACTAACCGTTG Mouse-Klf4-R-185: GTCGTTGAACTCCTCGGTCT Mouse-Nestin-F-114: CCCCTTGCCTAATACCCTTGA Mouse-Nestin-R-114: GCCTCAGACATAGGTGGGATG Mouse-Sox2-F-157: GCGGAGTGGAAACTTTTGTCC Mouse-Sox2-R-157: CGGGAAGCGTGTACTTATCCTT
Supplement Table 2: Summary for assays in total number of organoids per condition and independent experimental replicates
Assay Figure
Total number of organoids per
condition
Total number of independent experimental replicates
Brdu assay Figure 1 h-i 5 3
CCK-8 assay Figure 1 j 6 6
Neurosphere (stemness) assay Figure 2 b-d 10 3 Differentiation assays of NSCs Figure 3 b,e 3 3 Differentiation assays of NSCs Figure 3 c,f 3 3 Differentiation assays of NSCs Figure 3 d,g 3 3
Neural migration assay Figure 4 b-d 6 6
Supplementary Table 3. Genes whose expression were associated with rs2071287 in diverse tissues from GTEx.
Gene Symbol SNP Id P-Value Tissue
NOTCH4 rs2071287 1.30E-46 Adipose - Subcutaneous NOTCH4 rs2071287 1.10E-38 Muscle -
Skeletal NOTCH4 rs2071287 2.00E-34 Nerve - Tibial
NOTCH4 rs2071287 4.30E-34 Esophagus - Muscularis NOTCH4 rs2071287 4.40E-34 Esophagus - Mucosa
NOTCH4 rs2071287 4.80E-34 Adipose - Visceral (Omentum) NOTCH4 rs2071287 5.30E-29 Skin - Sun Exposed (Lower leg) NOTCH4 rs2071287 1.80E-28 Artery - Tibial
NOTCH4 rs2071287 5.80E-28 Skin - Not Sun Exposed (Suprapubic) NOTCH4 rs2071287 9.90E-25 Thyroid
NOTCH4 rs2071287 4.50E-24 Heart - Left Ventricle NOTCH4 rs2071287 7.00E-22 Heart - Atrial Appendage NOTCH4 rs2071287 1.40E-21 Lung
NOTCH4 rs2071287 9.90E-21 Breast - Mammary Tissue
NOTCH4 rs2071287 1.30E-17 Colon - Transverse
NOTCH4 rs2071287 2.70E-16 Esophagus - Gastroesophageal Junction NOTCH4 rs2071287 3.70E-16 Stomach
C4A rs2071287 7.40E-15 Skin - Not Sun Exposed (Suprapubic) NOTCH4 rs2071287 1.60E-12 Spleen
HLA-DRB5 rs2071287 3.40E-12 Skin - Not Sun Exposed (Suprapubic) C4A rs2071287 3.80E-12 Nerve - Tibial
HLA-DRB5 rs2071287 4.40E-12 Muscle - Skeletal
NOTCH4 rs2071287 4.90E-12 Brain - Hippocampus RNF5 rs2071287 1.40E-11 Colon - Transverse NOTCH4 rs2071287 1.40E-11 Prostate
NOTCH4 rs2071287 1.60E-11 Colon - Sigmoid HLA-DRB5 rs2071287 2.40E-11 Adipose - Subcutaneous HLA-DRB5 rs2071287 5.00E-11 Nerve - Tibial
HLA-DQB1 rs2071287 5.10E-11 Skin - Not Sun Exposed (Suprapubic) C4A rs2071287 6.30E-11 Skin - Sun Exposed (Lower leg) NOTCH4 rs2071287 6.50E-11 Artery - Aorta
HLA-DRB5 rs2071287 3.80E-10 Heart - Left Ventricle C4A rs2071287 5.10E-10 Adipose - Subcutaneous HLA-DRB5 rs2071287 6.20E-10 Thyroid
HLA-DRB5 rs2071287 6.40E-10 Skin - Sun Exposed (Lower leg) C4A rs2071287 1.10E-09 Thyroid
RNF5 rs2071287 1.30E-09 Muscle - Skeletal
ATF6B rs2071287 1.70E-09 Heart - Atrial Appendage HLA-DRB5 rs2071287 2.50E-09 Artery - Tibial
NOTCH4 rs2071287 2.60E-09 Brain - Cerebellum HLA-DRB5 rs2071287 2.80E-09 Breast - Mammary
Tissue
HLA-DRB5 rs2071287 3.90E-09 Esophagus - Mucosa NOTCH4 rs2071287 4.70E-09 Pancreas
NOTCH4 rs2071287 5.40E-09 Brain - Cortex RNF5 rs2071287 6.00E-09 Brain - Cerebellum NOTCH4 rs2071287 1.40E-08 Artery -
Coronary
RNF5 rs2071287 1.80E-08 Brain - Cerebellar Hemisphere HLA-DRB5 rs2071287 3.20E-08 Artery - Aorta
HLA-DRB5 rs2071287 4.50E-08 Esophagus - Gastroesophageal Junction C4A rs2071287 4.70E-08 Whole Blood
NOTCH4 rs2071287 5.00E-08 Testis
CYP21A2 rs2071287 6.40E-08 Colon - Sigmoid AGPAT1 rs2071287 6.40E-08 Liver
C4A rs2071287 6.90E-08 Brain - Cortex C4A rs2071287 7.90E-08 Esophagus - Mucosa
C4A rs2071287 1.00E-07 Muscle -
Skeletal
HLA-DQB1 rs2071287 1.10E-07 Adipose - Subcutaneous NOTCH4 rs2071287 1.20E-07 Minor Salivary Gland NOTCH4 rs2071287 1.40E-07 Pituitary
C4A rs2071287 1.60E-07 Brain - Cerebellum HLA-DQB1 rs2071287 1.60E-07 Whole Blood C4A rs2071287 1.70E-07 Testis
HLA-DRB5 rs2071287 1.90E-07 Heart - Atrial Appendage NOTCH4 rs2071287 1.90E-07 Brain - Putamen (basal ganglia) NOTCH4 rs2071287 2.00E-07 Brain - Caudate (basal ganglia) C4B rs2071287 2.60E-07 Testis
HLA-DRB5 rs2071287 2.70E-07 Lung
NOTCH4 rs2071287 2.90E-07 Adrenal Gland NOTCH4 rs2071287 3.10E-07 Brain - Hypothalamus
C4B rs2071287 3.30E-07 Skin - Not Sun Exposed (Suprapubic) HLA-DQB1 rs2071287 3.50E-07 Muscle -
Skeletal
ATF6B rs2071287 3.50E-07 Adipose - Subcutaneous
C4A rs2071287 4.60E-07 Lung
ATF6B rs2071287 5.80E-07 Nerve - Tibial C4A rs2071287 6.10E-07 Colon - Transverse
HLA-DRB5 rs2071287 6.70E-07 Adipose - Visceral (Omentum) HLA-DRB5 rs2071287 6.70E-07 Whole Blood
NOTCH4 rs2071287 7.00E-07 Vagina HLA-DQB1 rs2071287 8.20E-07 Nerve - Tibial
NOTCH4 rs2071287 8.60E-07 Brain - Nucleus accumbens (basal ganglia) ATF6B rs2071287 9.10E-07 Artery - Tibial
NOTCH4 rs2071287 9.50E-07 Ovary HLA-DQB1 rs2071287 1.1E-06 Artery - Tibial RNF5 rs2071287 1.2E-06 Heart - Left Ventricle C4A rs2071287 1.3E-06 Esophagus - Muscularis HLA-DRB5 rs2071287 1.4E-06 Spleen
NOTCH4 rs2071287 1.6E-06 Liver
CYP21A2 rs2071287 1.6E-06 Skin - Not Sun Exposed (Suprapubic) HLA-DQB1 rs2071287 1.7E-06 Skin - Sun Exposed (Lower leg) C4A rs2071287 1.9E-06 Cells - Cultured fibroblasts NOTCH4 rs2071287 1.9E-06 Brain - Frontal Cortex (BA9) HLA-DQB2 rs2071287 0.000002 Adipose - Subcutaneous SKIV2L rs2071287 2.1E-06 Artery - Tibial
C4A rs2071287 2.3E-06 Spleen
C4A rs2071287 2.4E-06 Heart - Atrial Appendage HLA-DQB1 rs2071287 2.5E-06 Testis
HLA-DQB1 rs2071287 2.5E-06 Heart - Left Ventricle HLA-DQB1 rs2071287 3.1E-06 Liver
HLA-DRB5 rs2071287 3.1E-06 Colon - Sigmoid
C4A rs2071287 0.000004 Brain - Caudate (basal ganglia) C4B rs2071287 4.1E-06 Cells - Cultured fibroblasts HLA-DRB5 rs2071287 4.5E-06 Liver
ATF6B rs2071287 4.5E-06 Adipose - Visceral (Omentum) HLA-DRB5 rs2071287 4.9E-06 Prostate
ATF6B rs2071287 5.4E-06 Lung
HLA-DQB2 rs2071287 6.8E-06 Muscle - Skeletal
HLA-DRB5 rs2071287 7.2E-06 Brain - Frontal Cortex (BA9) MICB rs2071287 7.7E-06 Brain - Cerebellum
C4A rs2071287 7.7E-06 Brain - Hypothalamus HLA-DQB1 rs2071287 0.000008 Thyroid
C4A rs2071287 8.1E-06 Liver
C4A rs2071287 8.2E-06 Brain - Hippocampus
HLA-DRB5 rs2071287 8.4E-06 Brain - Anterior cingulate cortex (BA24) EGFL8 rs2071287 8.8E-06 Esophagus - Muscularis
C4A rs2071287 9.3E-06 Prostate HLA-DQB1 rs2071287 9.7E-06 Colon - Sigmoid HLA-DRB5 rs2071287 0.000011 Esophagus - Muscularis HLA-DRB5 rs2071287 0.000011 Brain -
Amygdala
HLA-DRB9 rs2071287 0.000011 Adipose - Visceral (Omentum)
HLA-DQB1 rs2071287 0.000011 Prostate PRRT1 rs2071287 0.000012 Artery - Tibial C4A rs2071287 0.000014 Heart - Left Ventricle
C4B rs2071287 0.000015 Skin - Sun Exposed (Lower leg) C4A rs2071287 0.000016 Artery - Tibial
NOTCH4 rs2071287 0.000017 Small Intestine - Terminal Ileum HLA-DQB1 rs2071287 0.000018 Adipose - Visceral (Omentum) HLA-DRB6 rs2071287 0.000018 Heart - Left Ventricle
HLA-DQB2 rs2071287 0.000019 Heart - Left Ventricle RNF5 rs2071287 0.000021 Thyroid
ATF6B rs2071287 0.000021 Muscle - Skeletal
RNF5 rs2071287 0.000023 Stomach CYP21A2 rs2071287 0.000027 Nerve - Tibial C4A rs2071287 0.000027 Artery - Aorta C4A rs2071287 0.000029 Stomach CLIC1 rs2071287 0.00003 Testis
C4A rs2071287 0.000031 Brain - Frontal Cortex (BA9)
C4A rs2071287 0.000034 Brain - Nucleus accumbens (basal ganglia) HLA-DQA1 rs2071287 0.000034 Esophagus - Gastroesophageal Junction PPT2 rs2071287 0.000034 Cells - Cultured fibroblasts
PSMB9 rs2071287 0.000035 Thyroid HLA-DQB2 rs2071287 0.000035 Whole Blood HLA-DRB5 rs2071287 0.000038 Stomach
HLA-DQB2 rs2071287 0.000039 Adipose - Visceral (Omentum) HLA-DQB2 rs2071287 0.000039 Esophagus - Muscularis HLA-DRB5 rs2071287 0.00004 Brain - Caudate (basal ganglia) ATF6B rs2071287 0.000042 Skin - Sun Exposed (Lower leg) HLA-DQB1-AS1 rs2071287 0.000043 Skin - Not Sun Exposed (Suprapubic) ATF6B rs2071287 0.000043 Artery - Aorta
SKIV2L rs2071287 0.000043 Adipose - Subcutaneous PRRT1 rs2071287 0.00005 Cells - Cultured fibroblasts HLA-DRB9 rs2071287 0.000054 Lung
C4A rs2071287 0.000054 Breast - Mammary Tissue
ATF6B rs2071287 0.000061 Adrenal Gland HLA-DQB1-AS1 rs2071287 0.000085 Heart - Left Ventricle ATF6B rs2071287 0.000085 Heart - Left Ventricle C4B rs2071287 0.000087 Esophagus - Mucosa CYP21A2 rs2071287 0.000091 Artery - Tibial
C4A rs2071287 0.0001 Pancreas
HCG23 rs2071287 0.00011 Brain - Cerebellum RNF5 rs2071287 0.00012 Lung
HLA-DRB6 rs2071287 0.00013 Nerve - Tibial
HLA-DQB1 rs2071287 0.00013 Esophagus - Mucosa AGPAT1 rs2071287 0.00015 Nerve - Tibial
C4B rs2071287 0.00016 Adipose - Visceral (Omentum) HLA-DQB1-AS1 rs2071287 0.00016 Whole Blood
DDAH2 rs2071287 0.00017 Whole Blood NELFE rs2071287 0.00019 Artery - Tibial
ATF6B rs2071287 0.00025 Cells - Cultured fibroblasts CYP21A2 rs2071287 0.00026 Thyroid
AGPAT1 rs2071287 0.00034 Thyroid
Data were from the GTEx consortium (https://gtexportal.org/home/).
Supplementary Table 4. Fine-mapping analysis using PAINTOR
Index SNP SNP in LD with rs2071287
R2a Chr Position PAINTOR Probabilityb
rs2071287 rs1053924 0.37 6 32120715 0.00
rs1061808 0.39 6 32136547 0.00
rs2071277 0.99 6 32171683 0.00
rs2071279 0.37 6 32164874 0.00
rs2071287 1.00 6 32170433 0.00
rs2269423 0.39 6 32145707 0.00
rs2269426 0.33 6 32076499 1.00
rs3096688 0.39 6 32161034 0.00
rs3096698 0.35 6 32107139 0.00
rs3130290 0.65 6 32174957 0.00
rs3130293 0.39 6 32177263 0.00
rs3130294 0.98 6 32178773 0.00
rs3131290 0.65 6 32183175 0.00
rs3131291 0.82 6 32184066 0.00
rs3131295 1.00 6 32173257 0.00
rs3132934 0.40 6 32167009 0.00
rs3132942 0.72 6 32176512 0.00
rs3134797 0.81 6 32186050 1.00
rs3134799 0.82 6 32184221 0.00
rs3134932 0.65 6 32186147 0.00
rs3134950 0.38 6 32127477 0.00
rs394657 0.79 6 32187023 0.00
rs415929 0.43 6 32189032 0.00
rs429853 0.72 6 32187202 0.00
rs436388 0.50 6 32186264 0.00
rs444472 0.79 6 32186726 0.00
rs520688 0.43 6 32188642 0.00
rs520692 0.43 6 32188640 0.00
rs9267820 0.44 6 32165583 0.00
rs9267821 0.44 6 32169574 0.00
rs9267823 0.44 6 32173238 0.00
rs9267830 0.44 6 32177429 0.00
rs9267831 0.44 6 32177614 0.00
rs9267832 0.44 6 32177625 0.00
rs9267833 0.40 6 32177900 0.00
ar2 represents the linkage disequilibrium values of index risk SNP rs2071287. bA higher PAINTOR score suggests a higher probability of causality.
Supplementary Figure 1. Association significance between rs2071287 and expression of RNF5, CYP21A2 and HLA-DRB5. Data were from the LIBD brain eQTL dataset.
Supplementary Figure 2. SNP rs2071287 is located in binding motif of PBX1 transcription factor. The position of rs2071287 was highlighted with red box. RegulomeDB was used to annotate if rs2071287 was functional.
Supplementary Figure 3. Dysregulation of Klf4 and Nestin in Notch4 knocked-down NSCs. a, Notch4 was efficiently knocked-down by the shRNAs. b, d, Expression of Sox2 and Nanog were not changed in Notch4 knocked-down NSCs. c, Klf4 was significantly up-regulated in Notch4
knocked-down NSCs. d, Nestin was significantly down-regulated in Notch4 knocked-down NSCs.
Two tailed Student’s t test was used to test if the difference was significant. *P<0.05, **P<0.01,
***P<0.001.
Supplementary Figure 4. Expression level of NOTCH4 in different neuronal cell types of human brain.
Supplementary Figure 5. Association between SNPs near NOTCH4 and C4 and schizophrenia. The locations of C4 and NOTCH4 were marked by red dashed line.
Supplementary Figure 6. Expression level of NOTCH4 in brains of Alzheimer's disease (AD) cases and controls. Data was from the AD database http://www.alzdata.org/.
Supplementary Figure 7. Expression level of NOTCH4 across different brain developmental stages.
Supplementary Figure 8. Expression level of NOTCH4 in cell clusters identified by single cell RNA sequencing. NOTCH4 expression was low in all of the cell clusters identified by single cell RNA-seq.
Supplementary Figure 9. Expression of NOTCH1, NOTCH2 and NOTCH4 in four neural cell types.
References
1. Fromer M, Roussos P, Sieberts SK, Johnson JS, Kavanagh DH, Perumal TM et al. Gene expression elucidates functional impact of polygenic risk for schizophrenia. Nat Neurosci. 2016;19:1442-1453.
2. Shabalin AA. Matrix eQTL: ultra fast eQTL analysis via large matrix operations.
Bioinformatics. 2012;28:1353-1358.
3. Ng B, White CC, Klein HU, Sieberts SK, McCabe C, Patrick E et al. An xQTL map integrates the genetic architecture of the human brain's transcriptome and epigenome. Nat Neurosci. 2017;20:1418-1426.
4. He X, Fuller CK, Song Y, Meng Q, Zhang B, Yang X et al. Sherlock: detecting gene-disease associations by matching patterns of expression QTL and GWAS. American journal of human genetics. 2013;92:667-680.
5. Kang HJ, Kawasawa YI, Cheng F, Zhu Y, Xu X, Li M et al. Spatio-temporal transcriptome of the human brain. Nature. 2011;478:483-489.
6. Yang CP, Li X, Wu Y, Shen Q, Zeng Y, Xiong Q et al. Comprehensive integrative analyses identify GLT8D1 and CSNK2B as schizophrenia risk genes. Nat Commun. 2018;9:838.
7. Duric V, Banasr M, Licznerski P, Schmidt HD, Stockmeier CA, Simen AA et al. A negative regulator of MAP kinase causes depressive behavior. Nat Med. 2010;16:1328-1332.
8. Jansen R, Penninx BW, Madar V, Xia K, Milaneschi Y, Hottenga JJ et al. Gene expression in major depressive disorder. Mol Psychiatry. 2016;21:444.
9. Xu M, Zhang DF, Luo R, Wu Y, Zhou H, Kong LL et al. A systematic integrated analysis of brain expression profiles reveals YAP1 and other prioritized hub genes as important upstream regulators in Alzheimer's disease. Alzheimers Dement. 2018;14:215-229.
