Local extrahepatic expression of complement
genes C3, factor B, C2, and C4 is increased in
murine lupus nephritis.
J Passwell, … , H U Beuscher, H R Colten
J Clin Invest.
1988;
82(5)
:1676-1684.
https://doi.org/10.1172/JCI113780
.
Systemic lupus erythematosus (SLE) is associated with the presence of complement
proteins and immune complexes in affected organs. Since complement proteins are
synthesized in hepatic and extrahepatic sites, we studied a murine model of SLE to
ascertain the relative importance of local and humoral (liver) synthesis of complement. C3,
C4, and C2 mRNA increase in kidney coincident with the development of nephritis in the
MRL lpr/lpr mouse, a strain that spontaneously develops SLE. Two factor B messenger
RNA transcripts are expressed in kidney and intestine; SLE nephritis is associated with
decrease in the long factor B mRNA and increase in the short form. Increased local
synthesis of C3 and B protein and a concomitant glomerular and renal interstitial
macrophage infiltrate paralleled the increase in mRNA content in the (lpr/lpr) mice. In
addition to kidney, an increase in C3, C4, C2 and factor B mRNA was noted in the lung,
heart and intestine and to a lesser extent in liver of (lpr/lpr) in comparison to the MRL (+/+)
animals. These results suggest that in SLE local expression of complement genes plays a
role in the pathogenesis of chronic glomerulonephritis and in the autoimmune arteritis of
other organs.
Research Article
Find the latest version:
Local Extrahepatic Expression
of
Complement
Genes
C3,
Factor
B, C2,
and
C4
Is
Increased
in Murine
Lupus Nephritis
Justen Passwell, GeorgeF.Schreiner,* MasaruNonaka,Horst U.Beuscher,andHarveyR.Colten
EdwardMallinckrodtDepartment ofPediatrics, and *Departments ofInternalMedicine andPathology, Washington University School ofMedicine, St. Louis, Missouri 63110
Abstract
Systemic lupus erythematosus (SLE) is associated with the presence of complement proteins and immune complexes in
affectedorgans. Sincecomplementproteinsaresynthesizedin
hepatic andextrahepatic sites,we studiedamurine model of
SLEtoascertain therelativeimportanceof local and humoral
(liver)synthesis of complement. C3, C4, and C2 mRNA
in-crease inkidney coincidentwith thedevelopment ofnephritis
in the MRL lpr/lpr mouse, a strain that spontaneously de-velops SLE. Two factor B messenger RNA transcripts are
expressed inkidneyandintestine;SLEnephritisis associated with decrease in the long factor BmKNAandincrease in the shortform. Increased localsynthesisof C3 and I1
protein
andaconcomitant glomerular and renal interstitial macrophage in-filtrate paralleled the increasein mRNA contentinthe(lpr/
lpr) mice. Inadditiontokidney,anincrease inC3, C4,C2 and factor B mRNAwasnoted in thelung,heart andintestine and
toa lesserextentinliver of(Ipr/lpr)incomparisontothe MRL
(+/+)
animals.These results suggest that in SLElocal expression of
com-plement genesplaysarole in thepathogenesis ofchronic
glo-merulonephritis and in the autoimmune arteritis ofother
organs.
Introduction
The MRL-LP lpr/lpr inbred mouse strain
consistently
de-velops a spontaneous murinesystemic
lupuserythematous
(SLE)'
syndrome withsevereglomerulonephritis
and evidenceof arteritisin other organs.
Lymph gland
hyperplasia
andar-thritis are also common clinical features.
Serologic
studiesshowaprogressiveincreasewithage,of
immunoglobulin
con-centrations,
circulating
immunecomplexes,
anti-DNA and otherautoantibodies,
anda decrease in totalserumcomple-menthemolyticactivity
(1,
2).Immune cellinfiltrationintoaffected organs is particularly
prominent in this murine model of SLE. The expression of
Dr. Passwell was on sabbatical leave from the Sackter School of
Medi-cine,TelAviv,Israel.
Address reprintrequests to Dr. Colten, Department ofPediatrics, WashingtonUniversity School of Medicine, 400SouthKingshighway, St.Louis,MO 63110.
Received forpublication 8February 1988 and in revisedform 20 June1988.
1. Abbreviations used in thispaper:SLE,systemic lupus erythema-tosus.
autoimmunity is associated with theemergenceofalymphoid
cell population of unusual phenotype (Lyl+-, dThy-l+,
L3T4-) (3). Abnormal immunoregulation by T cells is clearly implicated in the pathogenesis ofthe diseasesince depletion of
T cells by monoclonalanti-T cellantibody (4), thymectomy (5),allogeneic bone marrowtransplantation (6),or treatment
with cyclosporin (7) can prevent or ameliorate the systemic
autoimmune disease.
Inthe MRL lpr/lplr mice,asin the human disease, deposits
ofimmunoglobulin andcomplement components, particu-larlyC3, are identified in the kidney with progression of
dis-ease. Activated complement proteins maycause tissueinjury directlyorrecruitinflammatory effectorcells(8).
There is increasing evidence that macrophages have an
important role in the pathogenesis ofglomerulonephritis. In
ratand rabbit experimental models of glomerulonephritisand
in the NZB model ofmurinelupus, mononuclear phagocytes
are recruited intotheglomerulus duringthe development of inflammation (9-1 1). The functional role of these cells may be regulationoflocal immune response (they express the Ia
anti-genand react with lymphocytes in a genetically restricted
manner
[12]),
clearance of immune complexes (13),enhance-ment of tissueinjury byrelease ofproducts suchas prostaglan-dins and leukotrienes (14) and coagulant factors (15), all of
which have been identified in isolated glomerular cultures fromratswith glomerulonephritis.
Thecomplement proteins inserumaresynthesized by
he-patocytes but extrahepatic expression ofthese proteins in
mononuclearphagocyteshasbeen demonstratedaswell(16).
Inseveralexperimental models, hepatic and extrahepatic regu-lation ofcomplement gene expression have been shown to be underindependent control (17, 18). To ascertain whether local expressionofcomplement proteins may also playarole in the
immunopathology oflupus nephritis, weexamined the
con-centration of mRNA forC3,factorB,C4 and C2inthe kidney
andother organsof the MRLlpr/lpr and the congenic MRL
+/+ mousestrains attimed intervals. Amarked increase in mRNA forthese complement proteins in the lpr/lpr kidney
and inother organs affected by the autoimmune disease was observed concomitant with thedevelopment ofSLE. The in-creased mRNA content isreflected in increased synthesisof complementinthenephritickidney. Finally,using the F4/80 monoclonal antibody that identifies a specific mouse macro-phage antigen (19), a glomerular and interstitial macrophage
infiltratecorrelated with progression of the kidney disease.
Methods
Mice. MRL(lpr/lpr)and MRL(+/+)male micewerepurchasedfrom the JacksonLaboratory (Bar Harbor, Maine). Theyweremaintained
on aregulardiet andgivenwaterad lib. Urine forprotein analysiswas
collected fromgroupsof mice in metaboliccages.At four timepoints, 1676 Passwelletal.
J.Clin. Invest.
©TheAmericanSocietyforClinical Investigation, Inc.
0021-9738/88/11/1676/09 $2.00
i.e.,6, 12, 18,and 22wk, micewerekilled by cervical dislocationand bledby cardiac puncture, and theliver,kidneys, spleen,lungs, intes-tine,and heartwererapidlyremoved.Smallslices ofliverandkidney were obtained and stored in 10% formalin for histologyand quick frozeninliquid nitrogen for immunohistology.Theremainder ofthe organswerefrozeninliquid nitrogen andstoredat-70'Cuntil pro-cessedfor isolation oftotal RNA. Bloodwascollected intotubeswith
EDTAandkeptonice,and the separatedplasmawasstoredat-70'C untilanalyzedforC3,anti-DNAantibody,andcreatinine concentra-tions. Urineprotein content wasdetermined byaquantitative
sulfo-salicylicmethod(20).C3 concentration intheplasmawasquantitated by immunodiffusion usinga rabbit anti-mouseC3 antibody kindly
providedby Dr.Natsuume-Sakai (CancerResearchInstitute,
Kana-zawaUniversity,Japan). Plasmafrom 8-wk-oldBalb/c mice (C3 50
mg/dl)was used asstandard. Plasma creatininewasmeasured bya routinemethodusinganautoanalyzer.Kidneyandliversectionswere
embedded inparaffin, stained withhematoxylinand eosin and
peri-odic acid-Schiffandreviewedina"blinded" fashion.
Topermitgreaterspecificityinscoring progressionofrenaldisease, histologywasevaluatedfortheseverity of changesin threecategories: (a)acuteglomerulonephritis (GN),(b) glomerulosclerosis (GS),and(c)
interstitialinflammation (IN)accordingtothefollowing scoringscale:
Score: + ++ +++ ++++
GN Focal segmen- Diffuse mes- Diffuse necrotiz- Diffuse GN tal mesan- angiopro- ingprolifera- with fibro-gioprolifer- liferative tiveGNwith cellular ative disease focalcrescents crescents in
changes >50%of
glomeruli
GS Focal segmen- Focal glomer- Diffuse,seg- Diffuse glo-talsclerosis ularhya- mentalglo- merular
linosis meruloscler- hyalinosis osis
IN Patchy non- Diffuse inter- Necrotizing in- Diffuse inter-necrotizing stitial infil- terstitialinfil- stitial fi-mononu- trate trateswithin- brosis and clear cell terstitial tubular
at-infiltrate edemaand rophy
focaltubular
atrophy
TheF4/80hybridoma (kindlyprovided byDr.HowardGray, Uni-versity ofColorado, Denver) was culturedinRPMI1640+10%
heat-inactivated fetal calfserum. The monoclonal antibody was
precipi-tatedfromthe culture supernatantby50%ammonium sulphateand
dialyzed for48 hagainstPBS.
Immunoperoxidase labeling ofrenaltissue. Frozensections (6
Ism)
ofkidneys harvested from control and experimental animals were fixedinchilled(40C)acetonefor 10 min andair-dried. Endogenous peroxidase activitywasinhibitedby immersion for 10 min ina
solu-tionconsistingof 40partsmethanol, 9 partsH20, and I partH202
(30%). Endogenousbiotinactivitywasinhibited bysequential30-min exposurestoavidinDandbiotinblocking solutions (Vector
Laborato-ries, Burlingame, CA).Thesectionswerethenplacedinrabbitserum blocking solution (Zymed Laboratories,SanFrancisco,CA),followed byF4/80 antibody (diluted1:10 in PBScontaining3.5%bovineserum albumin) for30 min. Afterwashing, biotinylated rabbit anti-ratIgG
(Vector Laboratories) affinity purified and adsorbed againstmouse IgG,wasaddedfor 15 min.Afterwashing,theslidesweresequentially exposedtostreptavidin-peroxidasefollowed byaminoethylcarbazole andhydrogenperoxide,assupplied by Zymed Laboratories.The sec-tionswerecounterstained withhematoxylinand mountedunder cov-erslips.
Cellswerescoredpositiveforexpressionof theF4/80 antigen if
theydemonstratedarimpatternof membranelabelingwith the chro-magen.Interstitialcellsareexpressedaspositivecells per 100 tubule
cells,which wereuniformly negative,in ordertominimizesampling
error. 15high-powerfieldswereread per section. Allglomerulion a
section(10-20 glomerulipersection)werescored forpositivelabeled
cellsand theresults calculatedon aperglomerularbasis.
mRNAisolation.Atearlytimepoints (6and 12wk)twoanimals and at 18 and 22 wk four animals from each strainwere used for mRNAstudies.Organswerepulverizedinliquid nitrogenwitha
mor-tarandpestleandlysedusing4 Mguanidium thiocyanateasdescribed
previously (21).RNAwasseparatedfromthelysates by
ultracentrifu-gation (35,000 rpmat 20'Cforatleast 12 husingaSW50.1 rotor, BeckmanInstruments,Inc.,Fullerton,CA) througha5.7 M cesium
chloridegradient. The RNA pelletwaswashed in 70% ethanol, dis-solved in water, reprecipitated in sodium acetate andethanol, and
redissolvedinwater.RNAcontent wasdeterminedbymeasurementof
absorptionat260nm.
Northern blotanalysis.RNAwasseparated by 1%agarose
formal-dehyde gelelectrophoresisrun forat least 12 h,then transferred to
nylonmembranes(Hybond-N, AmershamCorp.,ArlingtonHeights,
IL)byblottingandfixedbyexposureto anultravioletlightsourcefor5 min. cDNA probeswerelabeledwith [32PjdCTP bynicktranslation
and Northern blot hybridization was performed as described
pre-viously (22). Prehybridization and hybridizationwith specific RNA
probes (seebelow)weredoneat55-60'C in 50%formamide,50 mM
sodiumphosphate pH 6.5,0.8%NaCl,1 mMEDTA,0.5%Denhardt's
solution, 500 ug/ml denatured salmon spermDNA,and 500/Ag/ml
yeast RNA(SigmaChemicalCo.,St.Louis, MO).Filterswerewashed
at650Cin50mMNaCl,20 mMsodiumphosphate pH 6.5, 1 mM
EDTA, and0.1% SDS. Semiquantitative analysisofthe amountof increasein mRNAwasquantitated bylaserdensitometryof the
auto-radiographs.
Probes. ForC2 mRNAthe 800bp PstI fragment ofthepC2M
mousecDNAclonewasused(23).The C4probe,a 1.4-kbfragmentof
the clonepFC4/5.4 (24), and achickena-actin cDNA (25), which
hybridizesto,B and yactin,wereused.Synthetic oligomersofmouse
C4 (CCTGCAGCATGTTGTGGTTG) and Slp
(AATTCAC-CATGTCCCGGACC) werekinaselabeled with [32P]ATP. A 1.3-kb
Pst I fragmentfrom mouse factorB cDNA clonepBmB2 (26)was
subclonedintoaPGEM4standardcloningvectorandtransformed into
Escherichiacoli. Transcriptionofthe RNA probe wasachievedby
linearizingthevectorwith SmaI andlabelingwith[32P]UTPfollowing
the protocolofthesupplier (Promega, Madison, WI). A mouseC3 cDNAclone(kindly provided byDr. M.Takahashi,Kanazawa,Japan)
containinga2.7-kbinsertwasdigestedwithPst I.Fivedistinctbands
wereidentified.An800-bpfragmentwassubclonedintoPGEM4and
usedfortranscriptionof labeledRNAasdescribedabove.
Biosynthesis,immunoprecipitation,and SDS PAGE.Kidneysfrom
6- and 18-wk-old MRL(+/+)and MRL(lpr/lpr)micewereharvested
intocoldPBS with 1.5 mMKClandheparin (10 U/ml)andkepton ice.Coronalkidney slicesapproximately0.2 X 1 cm were cutwitha
razorblade and washed twiceandincubated for20 minat37°Cin
methionine-free DME (Gibco, Grand Island, NY) tissue culture
media.Thetissue slicesweretransferredtothe wells in separate 16-mm
tissuecultureplates, medium wasremoved, and 0.5 ml of medium
containing [35S]methionine (0.5 mCi/ml, sp act - 1,000 Ci/mmol;
AmershamCorp.) wasadded. After 1 h thekidneysliceswere har-vested inlysisbuffer (10 mMEDTA, 1% TritonX100,0.5%
deoxycho-late inPBS, pH 7.4,in the presence of 2mM
phenylmethylsulfonyl-fluoride and 250 gg/ml soybean trypsin inhibitor[Sigma Chemical
Co.])and frozenat -70°C.Intracellular lysatesofkidneywere ob-tainedby repeatedfreezethawingandvigorousvortexingof the organ
slices.TotalproteinsynthesiswasdeterminedbyTCAprecipitationof
aliquotsof the intracellular lysatesandextracellular media.Samples
werepreclearedwithformalin-fixedStaphylococcusaureusand
succes-siveimmunoprecipitationswith anti-mouseC3(Cappel Laboratories,
Table I. Urineand Plasma FindingsintheMRLStrainswithIncreasing Age
MRL (+/+) MRL (Ipr/lpr)
Age (wk) 6 12 18 22 6 12 18 22
Urineprotein(mg/ml) 0.85 1.73 3.15 1.77 4.87 6.39 9.67 8.17 Plasmacreatinine* (mg/ml) 0.2 0.3 0.2 0.2 0.2 0.2 0.2 0.4 PlasmaC38(mg/dl) 70±5 54±18 80±7 106±15 61±6 48±6 77±3 76±4
Anti-DNAantibody8(1/titer) neg 40 40 40 20 320 10,240 5,120
*Averageoftwo to threeindividual miceateachtime point. $ Averageofthreetosevenindividual miceateach timepoint. § Samples from
onemouseateachtimepoint.
mouse antigen (Atlantic Antibodies, Scarsborough, ME)were done exactly as described previously (17). The immune complexes were precipitated with formalin-fixed Staphylococcus aureus (IgSorb En-zyme Center, Malden, MA), washed extensively, and subjected to SDS-PAGE underreducing conditions (5%f3-mercaptoethanol). The
gelsweretreated withEn3hance, dried undervacuumafter which auto-radiographywasperformed.
Results
Clinicalfindings.
By 18 wk of age the mice of the lpr/lprstrainmanifested ulcerated skin lesions, lymphadenopathy, and
lacked their normal coat lustre. There was a progressive
in-crease in proteinuria (Table I). Plasma C3 concentrations,
which were higher than that of the BALB/c mouse strain, did notdecreasewith the development ofrenaldisease, but were less than the C3 levels in the+/+ strainat22 wkof age. There was a markedprogressiveelevationofanti-DNA antibodies in plasmaofthelpr/lpr strainwithonly a modest increase in the
+/+ strain.Thecreatinineconcentrationwasslightlyelevated
onlyatthelasttimepoint (22 wk)for thelpr/lprmice.
Renal histology.At6 and 12wk,control MRL
(+/+)
kid-neys showed no evidence ofpathology. At 18 and 22 wk, a mild mesangioproliferative glomerulonephritis without evi-dence ofcrescents, necrosis, sclerosis, orinterstitial nephritis wasobserved.Incontrast, the MRL lpr/lpr mice developed a mild increase in mesangial hypercellularity as early as 6 wk, which evolved into a diffuse, moderate mesangioproliferative
glomerulonephritis by age 12 wk. Enlarged, reactive parietal
epithelial cells were observed but there were no crescents.
There was noevidence of interstitial nephritis. By age 18 wk,
thelpr/lprmicedevelopedadiffuse, proliferative, necrotizing
glomerulonephritis with crescents involving at least 50% of
glomeruliand a moderate interstitialnephritis.By age 22wk,
virtually allglomerulidisplayed crescentformationwith
peri-glomerularfibrosisandworsening interstitial nephritis (Table
II). Scattered sclerosed glomeruli were observed.
Immunohistology with F4/80 antibody.Control
(+/+)
andexperimental(lpr/lpr)kidneyswerelabeledfor the presence of
macrophages at 6 and 18 wk ofage.Control kidneysat6 wk
hadvirtuallynoglomerularmacrophagesandasmall number
ofresident, interstitial macrophages (Table II). Aged control
miceshowed amildglomerularinfiltration withmacrophages
and an insignificant increase in interstitial macrophages. In
contrast, lpr/lpr mice displayed increased glomerular
macro-phages at 6wkandamarkedincrease in both glomerular and interstitial macrophages by 18 wk (Fig. 1 and Table II). At this
timepoint, theinterstitial infiltrate wasdiffusely peritubular,
confined to the cortex, and not associated with tubular
ne-crosis.
Expression
of
mRNA inkidneys
and other organsby
Northern blot analysis. As early as 12 wk there was a slight,
then
progressive,
increase inexpression
ofboth C3 and C4mRNA in kidneys ofthelpr/lpr strain; in the control MRL
+/+ strain,therewas asmall,butdefinite increase in C3 and
C4 mRNA with
advancing
age(Fig.
2).Both C2 and factor BmRNA are constitutively expressed in thekidneys in young
animals ofboth MRLstrains. A clearprogressive increasein
C2 mRNAduringthedevelopment of glomerulonephritiswas seenin thelpr/lpr
strain,
withonlyaminimal changenoted inthe +/+ animal. FactorB mRNAis expressedin themurine
kidneyas adoublet(reference17andFig. 2),thesmallerofthe
Table II. RenalHistologyintheMRLStrains
MRL(+/+) MRL(lpr/lpr)
Age(wk) 6 12 18 22 6 12 18 22
Glomerulonephritis* - - + + + ++ ++++ ++++
Glomerular sclerosis* - - - + - - ++ ++
Interstitial inflammation* - - - - + ++ +++ ++++
F4/80Stain
Glomerular
macrophagesi
(mean±SE) 0.1±0.1 ND ND 0 2.3±0.7 ND 12.0±1.5 NDInterstitialmacrophagesO(mean±SE) 0.3±0.1 ND ND 0.9±0.4 0.8±0.2 ND 29.0±2.5 ND
ND,notdone. *Description of scoringsystemis given inMethods. *Macrophages (F4/80positive)/glomerulus(allglomeruliin asection
[10-20]
werecounted). § Macrophages (F4/80 positive)/100tubule cells.a0
t
f.
;~~~ ~ ~
-~~~~~~~~
4
.7
4~~4
a
_
. 7
4',
*: Jts
'-*'s r
,# ., _., r ,t , b. Zs_ ': s w tt'a!;-t 5
*4 s i .: ^
5*Ati*r ';. >4 ,!t ,.4 g*ft;t ; C.S' * a,:
*.'t eriitE...,+-*/.StRtff ;,,Zc'- T;}
,.,vX,,4 ,tr<^,Xi jtC, ,..,, .^,..v....
F S>;,usltziS ..r
,,, ,E,,4,wej8j ts, tws :^8zi ,f
...
,.,,*
;, ,._Lt--:
*w,
&*t FX..-.
v} e' iA * " .' sb. +
, u .,
;J) Ss b 4,t
- 'a'= s:
t iX
:'_.,,\:
't4^! _,.t, .:, .J
4.."
.1
,
..1
j4
a -~
Z
i
o(C~~~~~~~~~l
~~~~t~~r
e
cis
.Is
+~v;~- -.00
J
-
i
CIS
A-
<t g * , I reQ Z,
+00
4^D
3
I-cd
r)c
-XQ
*~ *
8l a
4 0 c-Ywj
o a
o * CuQ
c
~-I-.CA
soc 0CuL
o 3
XL £
to,
4
.11*.A"I"
.41 ....A :, `
.-t.
t
*jt ..:.i
k:''
t.
,4~ .,W,3L
.:.Zl.,C, W.""'
.% 1. 4
I
ss, ,o,. ..
.Ap-Ai&,
"* .- 'PWWI 4
C3
Sto
s
0
Factor B
6 12 18 22
6 12 18 22
MRL
MRL
(+/+)
(Ipr/I
pr)
Figure2.Northernblot analysis of C4, C3, C2, and factor B mRNA inkidney of MRL+/+and MRL lpr/lpratages6, 12, 18, and 22
wks. 10,gof total RNA loaded in each lane. Representative
experi-mentfromtwoanimals (6, 12 wk) and four animals (18, 22 wk) two mRNA species being - 0.3 kb shorter. Both factor B mRNAbandsarepresent inapproximately equal
concentra-tionsin theyoung animals. Inthe MRL +/+ strain asmall
6 12 18 22
MRL
(+/+)
6 12
18 22 weeks
MRL
(
Ipr/lpr)
from each strain blotted and probedonreplicate (threeto fourtimes) Northernanalyses. Both by ethidium stain and actinmRNA con-tent, there were nosignificantdifferences in amount of RNA loaded in each lane.
increase in eachband is notedasthe miceage.However,inthe
MRL lpr/lpr strain there is a significant and consistent
in-crease in concentration of the lower band, while the upper
10
---.--- ---o
0.9.
0.5
32
10
_-
I--II
5
~~~~~~~~~~~~~~12
1.0
0.Y
0.8
0.7
0.4
,.
---2I1 '7
Figure 3. Tracing of laser densitometry of factor B mRNA in thekidney of the MRL+/+and MRLlpr/lpr strainatages6, 12, 18,and 22 wk
(lefttoright). ,ugof RNAwasloaded in each lane.Upper tracingsfrom(+/+)andlowertracingsfrom(lpr/lpr).
1680 Passwelletal
C4
C48s
28s-C3
18s-Afib.
_C2
28s-
18s-Factor B
a P@ _S
1.1
1.S
0.9
S.,
0.7
0.6
0.5
0.4
0.1
0.7
0.0
0.5
I
band decreases. It was not possible to accurately separate the bands for scintillation spectrometry, but laser densitometry clearly showed the presence of the double band, a twofold increase of the lower band and a > 80% fold decrease of the upperband withadvancingage inthelpr/lprstrain (Figs. 2 and
3). Ofall theother organsexamined,only theintestine displays
the double-bandedfactorB mRNA.
Synthetic oligomers homologous to C4 and Slp sequence were used todetermine whether the Slp sequence of the C4 genewasexpressed in thekidney of this mousestrain. Only the sequencehomologous to C4 hybridized to kidney mRNA at 18 and22 wkin the lpr/lpr strain. No hybridization to kidney mRNA wasobservedwith the Slp oligomer, but a strong signal wasobtained when,for a control, a plasmid containing the Slp cDNA wasprobed with the Slpspecificoligonucleotide (results notshown).
Theexpressionof complement genes in other organs of the
+/+ and lpr/lpr strain was estimatedat 18 wk by Northern
blotanalysisasshown inFig.4. Forliver,the sourceofplasma
complement, the mRNA content of C2, C3, C4, and factor B in lpr/lpr was approximately twofold that of each in the
+/+
strain(Fig.4). There were no markeddifferences between the
twostrainsinexpressionof these mRNA species in the spleen.
However,acomparisonof lung, heart and intestine in the two
strainsrevealedsubstantially more mRNA in the lpr/lpr than
in the+/+ strainat 18 wk.
Loading ofthegels for Northernblotting was initially
esti-mated by comparing ethidium bromide staining of the 28S and 18S RNAbands. Thechicken a-actincDNAprobe which
cross-hybridizes with both
#
andT-actin
was used to moreC4
04,.
28s-
18s-L
V
K
S
Vv
Lu
V
I
\
H
precisely estimate comparability of the data. Actin mRNA concentrations varied among the different organs, however, similar amounts were present for each organ in comparing the two mousestrains(Fig. 5).
Proteinsynthesisinkidney. Miceages6 and 18 wkofthe congenic strains were used to study the biosynthesis of factor B and C3. Tissues were culturedfor 1 h afteraninitial 20-min labeling period. Only the kidney specimens derived from the 18-wk oldlpr/lpr strain synthesizedsignificantamountsof C3 and factor B protein (Fig. 6). The majority of labeled C3 pro-teinwasexpressedaspro-C3 withtrace amountsof native C3 detectable,asexpected, in the intracellular compartment.
Discussion
We have demonstrated a progressive increase in mRNA cor-responding to the complement genes C3, C4, C2, and factor B in thekidney ofthe MRL lpr/lpr mousestrain coincident with the development of glomerulonephritis and interstitial nephritis. This mRNA is translated, since kidney organ cul-turesderived from micewith glomerulonephritis manifested
increasedbiosynthesis of C3 and factor B protein.Thisis the
first demonstration of local regulation of complement genes and in situ synthesis of complement protein in an organ
af-fected by a naturally evolving autoimmune disease. Similar
increases in concentration of mRNA of these complement
components in other organs thatmanifest autoimmune
arter-itiswereobserved, but there waslittle change in C3, C4, C2,
and factorB mRNAin liver, although liver is the source of
plasma complement proteins. These marked differences in
ex-C3
I
L
K
S
Lu
I
A AA A AA
.AA
AA A
*
0C3
H
A
C4,.
28s-C2Dw
18s-.^~~~~~~~~~~~~~~.
..
s :.
C2
Figure4. Northern blotanalysisofC4,C3,C2,andfactorB mRNA inorgansofMRL+/+and MRLlpr/lprat18wkofage. 10,g of
total RNAwasloaded in each lane exceptfor liverwhere 5gg/lane
ofRNAwasloadedineach.L,liver; K,kidney; S, spleen; Lu, lung;
-Factor B
Factor
B
I,intestine;H, heart. First sample of each pair from (+/+) and sec-ondfrom (Ipr/lpr)organs.Thisexperimentisoneof fourseparate
Northernblotsperformedoneach of threesetsof animals.
0
28s-
18s-L W JL JLJ11 A L I L L W I
L
K
S
Lu
I
H
pression ofcomplement mRNA at localsites of inflammation
suggestthatlocalcomplement productionmay play a rolein
thepathogenesis of theautoimmunepathology andthat local
regulatoryfactors modulate this effect.
Theidentificationof two forms offactorB mRNAin
kid-ney and intestine, but not in other organs, is an instance of
tissue specificityinexpressionof
this
complement gene. OnlyC3
Factor B
Mr(x
10-3)
- -
200
I
-92.5
-
69
... ..
..
..
.4
...;
46
- i-
a
6
18
weeks
....
.e- W.
*...-.A..
...A...
. .......
*....
.. .... ... tbstz
....Of.-.
is
-L
JL
--a
6
18
Figure6.SDS-PAGE of immunoprecipitated[35S]methionine 1-h
pulse-labeledC3 andfactorBfromkidneyorgan culturelysatesof 6-and 1 8-wk old MRL+/+(left lane in each pair) andMkL lpr/lpr
mice(right lane in each pair). Molecular mass markers (D) are
indi-cated.
Actin
_.
ma
Figure5. Northern blotanalysis of actin
mRNA(probedwith chicken a-actin cDNA) in organs of MRL +/+ and MRL lpr/lpr mice strainsat18 wkofage.All lanes loaded with 10jigperlaneexcept
for liver with 5 jig per lane. L, liver; K, kidney;S,spleen; Lu, lung; I, intestine; H,heart.Leftlaneof eachpair (+/+)
andright(lpr/lpr).
the smaller ofthetwofactorB mRNAspecieswasupregulated, coincidental with advancing kidney disease, while the larger form decreased by >80%. A similar increase ofthe smaller
mRNA speciesin mouse kidney has been induced by intra-peritoneal injection of endotoxin (unpublished results).Other
genesexpressing different forms of mRNA inatissue specific mannerhave been described. One example of this is the ex-pression of a-amylase inmouseliverandsalivary gland. In this instance differences inexpression ofmRNAhave been attrib-uted tovariationin5'untranslated regions whichwerethought
to arisebyeither differentialtranscription and/orprocessingof
the mRNA (27).
Although increases in complement-specific mRNA and
protein synthesis duringtheevolution ofnephritiscorrelated
with increased numbers of macrophages, attribution of the observedchangesto aspecific cell type must remain specula-tive. That is, it is possible that the different factorB mRNA
speciesarederived from different cells within thesameorgan.
Indeed, such a mechanism has recently been described for
expression
of the humana-1proteinase
inhibitorgene.Macro-phagesand hepatocytes express ac-l proteinaseinhibitor, but
two mRNA species are found in macrophages (28), both of
whicharelarger than thehepatocellulara- 1 PI mRNA. In each
celldifferent promoter sequences have been identified.An al-ternativesplicing mechanism apparently accountsforthe two forms ofmRNA found in the macrophage (29). In immune
complex glomerulonephritis, hypercellularity can be
attrib-utedtomacrophageinfiltrationand toproliferationof
intrin-sicglomerularcells,particularly mesangial cells.Macrophages
(30)andfibroblasts(Y. Katz,F.S.Cole,R.C.Strunk,
unpub-lished results) synthesize factorB intissue culture, however, both express only the smaller of thetwofactorBmRNA
spe-cies. Further studies using in situ hybridization or isolated
kidney cell preparations will be needed to determine whether thetwo factorB mRNA speciesarederived from asingleor
multiple cell types. Finally,the two factorB mRNA species
expressedinintestinearealso modulatedduringprogression of SLEwithapatternqualitativelydistinct from that observedin
kidney. This observationsuggestseither differentcells express
1682 Passwelletal.
.... *: ::.
factor B in kidney and intestineor a more complex mecha-nism ofregulationof the two forms of B mRNA must exist.
The F4/80 membrane antigen is a specific marker of mousemacrophages (19). We have used monoclonal antibody to this antigen to demonstrate that in this mouse model of immune complex glomerulonephritis, macrophages infiltrate theglomerulus and the interstitium, where theyare the pre-dominant inflammatory cell. Macrophages produce comple-mentlocally and monokines mayact on adjacent cells. The regulation of complementbiosynthesisby the monokines IL- 1 and TNF in mouse and human hepatocytes has been well
documented. The effect of these monokines is exerted ata
pretranslational level,selectively upregulatingfactorB,C3 and C4 but not C2 (31-33). However, in vivo administration of rIL-1 increases renal concentrations of C2, C3 and factor B
mRNA (17). The distinct pattern in this SLE model of in-creased mRNAofall thecomplement componentswestudied suggests a common mediator of this upregulation. In vitro studies with recombinantIFN-yhave shown thatitenhances
themRNAandsynthesisof C2,B,C3and C4 in mononuclear
phagocytes (33). In this regard, it is of interest that in vivo
administration ofIFN-y aggravates, while ablation of T
lym-phocyte function ameliorates, progression ofmurine SLE (34, 35).
Inacute immunecomplex kidney disease, circulating im-munecomplexes aredeposited withinthesubendothelialand
mesangialregionsoftheglomerulus. Serum complement
con-centration decreases and local activation of the complement
cascade occurs (36). Activation of complement leads to
re-cruitment ofother inflammatory cells and enhanced
opsoni-zationofimmunecomplexes. Inaddition,components of the
classical complementpathwayinhibit immunecomplex
depo-sition and enhance solubilization ofimmune
complexes (37,
38). Hence, localproductionofcomplementmaysignificantly
modifytheevolution ofimmunenephritis. Our studies
dem-onstrate that increased local production ofcomplementalso
occursin thekidney coincident withthedevelopmentof
glo-merulonephritis and interstitial nephritis. Thus, insitu renal
synthesis of complement
proteins
may exacerbate orprotectagainstimmunecomplexmediated tissueinjury. Acknowledgments
We thank Ms. Barbara Pellerito for assistance in preparation of the
manuscript.
This work was supported in part by grants A124836, A124739,
DK36277,and HL37591 from the U. S. Public Health Service and a grantfromthe Samuel Jared Kushnick Foundation.
References
1.Andrews, B.S.,R. A.Eisenberg,A. N.Theofilopoulos, S. Izui, C. B.Wilson,P. J.McConahey, E. D. Murphy, J. B. Roths, and F. J.
Dixon. 1978.Spontaneous murinelupus-likesyndromes: clinical and
immunopathological manifestations in several strains. J. Exp. Med.
148:1198-1215.
2.Theofilopoulos,A.N., and F. J. Dixon. 1985. Murine model of
systemiclupuserythematosus.Adv.Immunol.37:269-390.
3. Weston, K. M., E. T. H. Yeh, and M.-S. Sy. 1987. Autoreactivity accelerates the developmentof autoimmunity and
lymphoprolifera-tioninMRL/Mp-lpr/lpr mice. J. Immunol. 139:734-742.
4.Seaman,W.E., D.Wofsy,J.S.Greenspan,and J. A.Ledbetter. 1983. Treatmentof autoimmune MRL/lpr mice with monoclonal
an-tibody to Thy-1.2: a single injection has sustained effects on lympho-proliferation and renaldisease. J. Immunol. 130:1713-1718.
5.Steinberg, A. D., J. B. Roths, E. D. Murphy, R. T. Steinberg, and E. S. Raveche. 1980. Effects of thymectomy or androgen administra-tion upon theauto-immune disease of MRL/MP-lpr/lpr mice. J. Im-munol. 125:871-873.
6.Theofilopoulos, A. N. 1982. Role of the thymus inmurine lupus and cellulartransfer of the disease. Arthritis Rheum. 25:726-733.
7. Mountz, J. D., H. R. Smith, R. L. Wilder, J. Patton Reeves, and A. D.Steinberg. 1987. CS-A therapy in MRL-lpr/lpr mice: ameliora-tion of immunopathology despite auto-antibody producameliora-tion. J. Im-munol. 138:157-163.
8. Couser, W. G. 1985. Mechanisms of glomerular injury in im-mune complex disease. KidneyInt. 28:569-583.
9. Schreiner, G. F., R. S. Cotran, U. Pardo, and E. R. Unanue. 1978. Amononuclear cell component in experimental immunological glomerulonephritis. J. Exp. Med. 147:369-384.
10.Holdsworth, S. R., T. J. Neale, and C. B. Wilson. 1981.
Abroga-tion ofmacrophage-dependent injury in experimental glomerulone-phritis in therabbit. J.Clin. Invest. 68:686-698.
11. Kimura, M., M. Nagase, A. Hishida, and N. Honda. 1987. Intramesangial passage of mononuclear phagocytes in murine lupus glomerulonephritis. Am. J. Pathol. 127:149-156.
12.Schreiner, G. F., J. M. Kiely, R. S. Cotran, and E. R. Unanue. 1981.Characterization of resident glomerular cells in the rat express-ingIadeterminants and manifesting genetically restricted interactions withlymphocytes.J. Clin.Invest. 68:920-931.
13. Boyce, N. W., and S. R. Holdsworth. 1986. Quantitation of the intrarenal uptake of immunoglobulin aggregates by macrophages in
diffuseproliferative glomerulonephritis. Clin. Exp. Immunol. 64:638-645.
14. Stork, J. E., and M. J. Dunn. 1985. Hemodynamic roles of thromboxane A2 and prostaglandin E2 in glomerulonephritis. J.
Pharmacol. Exp. Ther.233:672-678.
15.Wiggins, R. C., A. Glatfelter, and J. Brukman. 1985. Procoagu-lant activity in glomeruli and urine of rabbits with nephrotoxic nephritis.Lab.Invest. 53:156-165.
16. Alpert, S. E., H. S. Auerbach, F. S. Cole, and H. R. Colten. 1983. Macrophage maturation differences in complement secretion by marrow, monocyte, and tissue macrophages detected with an im-provedhemolyticplaque assay.J. Immunol. 130:102-107.
17. Falus, A., H. U. Beuscher, H. S. Auerbach, and H. R. Colten. 1987. Constitutiveand IL-1 regulated murine complement gene ex-pression is strain and tissue specific. J.Immunol. 138:856-860.
18. Ramadori, G., J. D. Sipe, and H. R. Colten. 1985. Expression andregulation ofthemurine serum amyloid A(SAA)gene in
extrahe-patic sites. J.Immunol. 135:3645-3647.
19. Lee, S. H., P. M. Starkey, and S. Gordon. 1985. Quantitative
analysis oftotal macrophage content in adult mouse tissues:
Immuno-chemicalstudies with monoclonal antibody F4/80. J. Exp. Med.
161:475-489.
20.Schreiner,G.,Cotran,R., Pardo, V., and Unanue, E. R. 1978. A mononuclearcell component in experimental immunological
glo-merulonephritis.J. Exp.Med. 147:369-384.
21. Chirgwin, T. M., A. E. Przybyla, R. J. MacDonald, and W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from
sourcesenriched in ribonuclease. Biochemistry. 18:5294-5299.
22. Thomas, P. 1980. Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA.77:5201-5205.
23. Falus, A., E. K. Wakeland, T. J. McConnell, J. Gitlin,A. S. Whitehead, and H. R. Colten. 1987.DNApolymorphism ofMHCIII
genes in inbred andwildmouse strains.Immunogenetics. 25:290-298. 24. Nonaka, M., K. Nakayama, Y. D. Yuel, and M.Takahashi.
1985.Complete nucleotide and derivedamino-acidsequencesofthe
fourth component ofmouse complement (C4). J. Biol. Chem.
260:10936-10943.
Dugaic-zyk. 1980. Regulation of muscledifferentiation: cloning of sequences from alpha-actin messenger ribonucleic acid. Biochemistry.
19:5883-5890.
26. Sackstein, R., H. R. Colten,and D. W. Woods. 1983.
Phylo-genetic conservation ofa class IIImajor histocompatibility complex
antigen, factorB:isolationandnucleotide sequencing of mouse factor B cDNA clones. J.Biol. Chem. 258:14693-14697.
27. Young, R. A., D. Hagenbuchle, and U.Schibler.1981.A single mouse a-amylase genespecifies twodifferent tissue-specific mRNAs.
Cell. 23:451-458.
28.Perlmutter, D. H., R. M. Kay, F. S. Cole, T. H.Rossing,D. Van
Thiel,and H. R.Colten.1985.Thecellular defect in alpha 1 proteinase
inhibitor(alphaPI)deficiency is expressed in xenopusoocytesinjected with human liver RNA. Proc.Nati.Acad.Sc. USA. 82:6918-6921.
29. Perlino, E., R. Cortese, andG. Ciliberto. 1987. The human
a1-antitrypsin gene istranscribed from two differentpromoters in macrophages and hepatocytes. EMBO (Eur. Mol. Bio. Organ.) J.
6:2767-2771.
30.Perlmutter, D. H., and H. R.Colten. 1986. Molecular
immu-nobiology ofcomplementbiosynthesis:a modelof single-cell control
ofeffector-inhibitorbalance. Annu. Rev.Immunol.4:231-251.
31.Perlmutter, D. H., G.Goldberger, C.A.Dinarello,S. B. Mizel,
andH. R.Colten. 1986. Regulation of classIIImajor histocompatibil-ity complex gene products by interleukin 1. Science(Wash. DC).
232:850-852.
,32. Perlmutter, D. H., C. A. Dinarello, P. I. Punsal, and H. R. Colten. 1986. Cachectin/tumor necrosis factor regulates hepatic
acute-phasegeneexpression.J.Clin.Invest.78:1349-1354.
33. Strunk,R.C.,F.S.Cole,D. H.Perlmutter, and H. R. Colten.
1985.'y-Interferonincreasesexpressionof class IIIcomplementgenes
C2andfactorBin humanmonocytesand in murine fibroblasts trans-fected withhumanC2 and factorB genes.J.Biol. Chem.
260:15280-15285.
34. Adam, C., Y. Thoua, P. Ronco, P.Verroust,M.Tovey, andL. Morel-Maroger.1980.Theeffect ofexogenousinterferon: acceleration of autoimmuneand renaldiseases in (NZB/W) F1 mice. Clin. Exp. Immunol. 40:373-382.
35. Heremans, H., A. Billiau, A. Colombatti,J. Hilgers, and P.
DeSomer. 1978. InterferontreatmentofNZBmice: accelerated
pro-gressionof autoimmune disease.Infect.Immun.21:925-930. 36. Wener,M.H.,and M.Mannik. 1986.Mechanisms of immune deposit formation in renalglomeruli. Springer Semin. Immunopathol. 9:219-235.
37.Miller, G.W., and V.Nussenzweig. 1975. Anewcomplement function: solubilization ofantigen-antibody aggregates. Proc.Natl. Acad. Sci. USA. 72:418-422.
38.Schifferli,J. A., Y.C. Ng, andD.-K. Peters. 1986. Therole of complementanditsreceptorintheeliminationof immunecomplexes.
N.Engl.J.Med.315:488-495.