Draft
MiR-378 promotes the cell proliferation of osteosarcoma through down-regulating the expression of kruppel-like
factor 9
Journal: Biochemistry and Cell Biology
Manuscript ID bcb-2017-0186.R1 Manuscript Type: Article
Date Submitted by the Author: 04-Jan-2018
Complete List of Authors: Peng, Ningning; Cangzhou Central Hospital, Hebei Medical University Miao, Zhigang; Cangzhou Central Hospital, Hebei Medical University Wang, Liguo; Cangzhou Central Hospital, Hebei Medical University Liu, Binbin; Cangzhou Central Hospital, Hebei Medical University Wang, Guijiang; Cangzhou Central Hospital, Hebei Medical University Guo, Xu; Cangzhou Central Hospital, Hebei Medical University Is the invited manuscript for
consideration in a Special Issue? :
N/A
Keyword: miR-378, osteosarcoma, cell proliferation, KLF9, gene expression
Draft
MiR-378 promotes the cell proliferation of osteosarcoma through
1
down-regulating the expression of kruppel-like factor 9
2 3
Ningning Peng1, Zhigang Miao1, Liguo Wang1, Binbin Liu1, Guijiang Wang1, Xu Guo1* 4
1
Department of orthopedics, Cangzhou Central Hospital, Hebei Medical University, 5
Cangzhou, 061000, He bei, China 6
7
*Correspondence to: Xu Guo, Department of orthopedics, Cangzhou Central Hospital, 8
Hebei Medical University, Cangzhou, He bei, China. Email: [email protected] 9
10 11
Key words: miR-378, osteosarcoma, cell proliferation, KLF9, gene expression
12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28
Draft
Abstract: MicroRNAs (miRNAs) are small non-coding RNAs that play important 29
roles in a variety of biological processes. Dysregulation of miRNAs is tightly 30
associated with the malignancy of cancers. Aberrant expression of miR-378 has been 31
observed in human cancers, however, the function of miR-378 in osteosarcoma (OS) 32
remains largely unknown. Here, we showed that miR-378 was highly expressed in 33
human OS tissues and cell lines. Overexpression of miR-378 significantly promoted 34
the cell proliferation of OS cells. Molecular studies identified kruppel-like factor-9 35
(KLF9) as a functional downstream target of miR-378. MiR-378 directly bound to the 36
mRNA 3’-UTR region of KLF9 and suppressed the expression of KLF9. Highly 37
expressed KLF9 reversed the promoting effect of miR-378 on the proliferation of OS 38
cells. The expression level of miR-378 was negatively correlated with that of KLF9 in 39
OS tissues. Collectively, our results demonstrated the molecular interaction between 40
miR-378 and KLF9, indicating the therapeutic potential of miR-378 for OS. 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56
Draft
Introduction
57
Osteosarcoma is a common primary malignant musculoskeletal tumor, which mainly 58
occurs in children and adults (Link et al. 1986; Mirabello et al. 2009). Although the 59
combination of chemotherapy and tumor resection have been adopted in the treatment 60
of OS, the five-year survival rate of OS still remains be as low as 20% (Strauss et al. 61
2010; Zhou et al. 2013). The disease relapse and lung metastasis have been the big 62
challenges to improve the treatment outcome of OS. Therefore, identifying the novel 63
regulators involved in OS development and understanding the molecular mechanism by 64
which regulates the tumorigenesis of OS is urgently needed. 65
MicroRNAs (miRNAs) are characterized as small non-coding RNA, which 66
negatively regulate gene expression via inducing the degradation of mRNA or 67
suppressing the translation of target mRNA (Fu et al. 2016; Katoh and Katoh 2008; 68
Lodewijk et al. 2012; Ma et al. 2016; Mizuguchi et al. 2016; Wen 2016; Wilfred et al. 69
2007). Increasing evidence has demonstrated that some miRNAs are aberrantly 70
expressed in human cancers and play important roles in regulating the tumor growth 71
(Lodewijk et al. 2012; Srivastava and Srivastava 2012; Wang et al. 2015). Among these 72
miRNAs, miR-378 was reported to function as an onco-miRNA to promote the cell 73
growth of cervical cancer via targeting the suppression of tumorigenicity 7-like 74
(ST7L)/Wnt/β-catenin pathway (Li et al. 2017). The potential oncogenic role of 75
miR-378 was also supported by the study that miR-378 reversed the chemoresistance to 76
cisplatin in lung cancer by regulating the expression of secreted clusterin (Chen et al. 77
2016b). Additionally, miR-378 has been found to play important roles in breast cancer, 78
prostate cancer and ovarian cancer (Avgeris et al. 2014; Chan et al. 2014), however, the 79
expression level as well as the function of miR-378 in OS remains largely unknown. 80
Previous study predicted that KLF9 was a putative target of miR-378 (Lee et al. 81
2007). KLF9 belongs to the KLF family of transcription factors characterized by a 82
highly homologous three C2-H2 zinc finger DNA-binding domain (McConnell and 83
Yang 2010), which regulated the expression of target genes via binding to the GC/CT 84
Draft
boxes and CACCC elements in the regions of promoter and enhancer (Brown et al. 85
2015). It has been reported that KLF9 regulates the cell differentiation and programmed 86
cell death (Huang et al. 2015; Shen et al. 2014; Sporl et al. 2012; Sun et al. 2014). 87
Decreased expression of KLF9 has been observed in colorectal adenocarcinoma and 88
glioblastoma (Kang et al. 2008; Ying et al. 2011). In colorectal cancer, KLF9 prevented 89
the tumorigenesis through inhibiting interferon-related signaling (Brown et al. 2015). 90
Conversely, KLF9 was highly expressed in the gut and promoted the cell growth 91
(Simmen et al. 2007). These studies indicated the different expression pattern and 92
molecular function of KLF9 in cancers, however, the function of KLF9 in OS has not 93
been elucidated. 94
In this study, we showed that miR-378 was highly expressed in OS tissues and cell 95
lines. Mechanistically, we characterized that miR-378 directly targeted KLF9 by which 96
positively regulated the proliferation of OS cells. 97
98 99
Materials and Methods
100
Clinical samples and cell lines
101
Thirty paired OS tissues and adjacent normal tissues were obtained from OS patients 102
who undergone radical resection at Cangzhou Central Hospital from 2015 to 2016. 103
Signed informed consents were obtained from all the patients. This study was approved 104
by the Ethics Committee at the Cangzhou Central Hospital. 105
Osteosarcoma cell line including HOS, MG-63, U2OS, G-292, Saos2 and normal 106
human osteoblast cell line hFOB 1.19 were cultured in DMEM medium with 10% FBS 107
(Thermo Scientific, Grand Island, NY, USA). All the cell lines were purchased from the 108
Institute of Cell Biology at the Chinese Academy of Sciences (Shanghai, China). 109
110
Cell proliferation assay
111
OS cells were seeded at the 96-well plate with the cell concentration of 2×103 112
Draft
cells/well. Cells were transfected with miR-378 mimics for the indicated time. The cell 113
viability was determined by adding 10 µl of Cell Counting kit-8 (CCK-8) reagent into 114
the medium. The absorbance of each well was detected with a microplate reader at 450 115
nm. 116
117
microRNA extraction and qRT-PCR
118
MiRNA extraction was performed with the mirVana microRNA Isolation kit 119
(Applied Biosystems, USA) according to the manufacturer’s instructions. The quality 120
of miRNAs was determined by the NanoVue Plus (GE Healthcare, USA). Reverse 121
transcription of miRNA was performed with stem-loop primers (Applied Biosystems). 122
The qRT-PCR reaction was analyzed with the SYBR Green PCR mix on the ABI Prism 123
7900HT thermocycler. The expression level of miRNA relative to the internal control 124
U6 was calculated using the comparative threshold cycle 2−∆∆CT method. The mature 125
miR-378 (5’- CUCCUGACUCCAGGUCCUGUGU) specific primers were 126
commercially purchased. The primer sequence of U6 was as follows: U6-Forward: 127 5′-TGCGGGTGCTCGCTTCGGCAGC; U6-Reverse: 5′- 128 CCAGTGCAGGGTCCGAGGT-3. 129 130
Luciferase report assay
131
The wild-type or mutant mRNA 3′-UTR of KLF9 containing the predicted binding 132
site of miR-378 was inserted into the downstream of luciferase reporter vector 133
psiCHECK-2. For the luciferase assay, OS cells were seeded in the 24-well plate and 134
miR-378 mimics or control miRNA were transfected into the cells. After transfection 135
for 48 h, cells were harvested and the luciferase activity was determined using the 136
ClarityTM Luminescence Microplate Reader. Renilla luciferase was used as the 137 normalization control. 138 139 Western blot 140
Draft
OS cells transfected with miR-378 mimics or control miRNA were harvested and 141
lysed with the NP-40 lysis buffer. Equal amount of protein was separated by the 142
SDS-PAGE and transferred onto the polyvinylidene fluoride (PVDF) membrane. The 143
membrane was blocked with 5% nonfat milk and then incubated with the indicated 144
primary antibody for 2 h at room temperature. Afterwards, the membrane was 145
incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Sigma) 146
for 1 h. The bands were visualized with a chemiluminescent HRP substrate (Millipore 147
Corporation, Billerica, USA). The anti-KLF9 antibody (ab26074) was purchased from 148
Abcam. Anti-GAPDH antibody (G8795) was obtained from Sigma. 149
150
Statistical analysis
151
All the statistical analyses were performed using the SPSS 19.0 (SPSS, Inc., Chicago, 152
IL, USA). The data were presented as the mean ± SD. P<0.05 was considered 153 statistically significant. 154 155 Results 156
MiR-378 was highly expressed in OS tissues and cell lines
157
To investigate the function of miR-378 in OS, we detected the expression level of 158
miR-378 in OS tissues and adjacent normal tissues. The data showed that the 159
abundance of miR-378 was significantly upregulated in OS tissues in comparison with 160
that of normal control (Fig.1A). Additionally, the expression of miR-378 was also 161
examined in several OS cell lines. As shown in Fig.1B, compared with the normal cells, 162
the expression of miR-378 was significantly increased in OS cell lines Saos2, U2OS, 163
MG-63, HOS. These results demonstrated that miR-378 was overexpressed in OS. 164
165
Overexpression of miR-378 promoted OS cell proliferation
166
As miR-378 was highly expressed in OS, to detect the effect of miR-378 on the 167
growth of OS cells, MG-63 and U2OS cells, which harbored higher expression level of 168
Draft
miR-378 compared with other types of OS cell lines as shown in Fig.1B, were 169
transfected with the miR-378 mimics or control miRNA (Fig.2A). The cell proliferation 170
rate was assessed by the CCK-8 assay. As presented in Fig.2B and 2C, there was a 171
significant increase in the absorbance at 450 nm after transfection with miR-378 172
mimics in both MG-63 and U2OS cells. To detect whether overexpression of miR-378 173
affected the growth of normal cells, hFOB1.19 was transfected with miR-378 or control 174
miRNA and the cell proliferation was determined. The data showed that compared with 175
the significant promotion effect of miR-378 on OS cells, highly expressed miR-378 176
slightly increased the proliferation rate of hFOB 1.19 (Fig.2D). To further characterize 177
the influence of miR-378 on the growth of OS cells, colony formation assay was 178
performed with U2OS and MG-63 cells expressing miR-378 mimics or control miRNA. 179
The result showed that OS cells harboring overexpressed miR-378 generated more 180
colonies (Fig.2E). These data demonstrated that overexpression of miR-378 promoted 181
growth of OS cells. 182
183
KLF9 was a direct target of miR-378
184
Using the TargetScan database, KLF9 was predicted as one of the downstream 185
targets of miR-378. The predicted binding site of miR-378 at the 3′-UTR of KLF9 was 186
found and shown in Fig.3A. To validate this observation, luciferase assay was 187
performed to detect the binding capacity of miR-378 with the 3′-UTR of KLF9. The 188
result indicated that miR-378 significantly decreased the luciferase activity of the wild 189
type 3′-UTR of KLF9 but not the mutant 3′-UTR of KLF9 in OS cells (Fig.3B). This 190
result suggested the binding between miR-378 and the 3′-UTR region of KLF9. To 191
further confirm this, OS cells were transfected with miR-378 mimics or the control 192
miRNA. And the expression mRNA and protein abundance of KLF9 was detected by 193
qRT-PCR and western blot, respectively. As shown in Fig.3C and 3D, overexpression 194
of miR-378 inhibited both the mRNA and protein level of KLF9. In addition, the 195
endogenous miR-378 was down-regulated by miR-378 antagomir (Fig.3E) and the 196
Draft
expression of KLF9 was examined. The results indicated that depletion of miR-378 197
increased both the mRNA and protein abundance of KLF9 in OS cells (Fig.3F and 3G). 198
Collectively, these results identified KLF9 as a downstream target of miR-378 in OS 199
cells. 200
201
The tumor proliferation-promoting effect by miR-378 was reversed by KLF9
202
As KLF9 was identified as one of the downstream targets of miR-378, to further 203
investigate whether KLF9 was involved in miR-378-mediated proliferation-promoting 204
effect of OS cells, U2OS cells were transfected with miR-378 mimics, or co-transfected 205
with the plasmid expressing KLF9 and the cell proliferation was measured by the 206
CCK-8 assay. As shown in Fig.4A, compared with the cells only bearing miR-378, 207
co-transfection of miR-378 and Flag-vector induced a slight (P>0.05) decreased in the 208
cell proliferation at 96 h. This data suggested that transfection of Flag-vector did not 209
significantly changed the proliferation of cells. Additionally, compared with cells 210
expressing miR-378 mimics and Flag-vector, co-transfection of miR-378 mimics and 211
Flag-KLF9 decreased the proliferation of OS cells. The difference indicated that 212
overexpression of KLF9 inhibited the promotion effect of miR-378 on the proliferation 213
of OS cells. Consistent with this data, rescue the expression of KLF9 suppressed the 214
colony formation of OS cell with highly expressed miR-378 (Fig.4B). 215
To further confirm the role of KLF9 in the proliferation-promoting effect of miR-378 216
on OS cells growth, the endogenous expression of KLF9 was down-regulated by 217
shRNA-KLF9. qRT-PCR assay showed that the abundance of KLF9 was significantly 218
decreased in the presence of shRNA-KLF9 (Fig.4C). The CCK-8 assay showed that 219
down-regulation of KLF9 or overexpression of miR-378 facilitated cell growth 220
(Fig.4D). And the promotion effect of miR-378 mimics on the cell growth was 221
significantly increased in comparison with the effected caused by depletion of KLF9. 222
Notably, the cell proliferation of OS cells harboring miR-378 mimics and depleted 223
KLF9 was significantly higher than that of cells expressing miR-378 mimics alone 224
Draft
(Fig.4D). These results indicated that down-regulation of KLF9 partially contributed to 225
the proliferation-promoting effects of miR-378 in OS cells. 226
227
KLF9 was down-regulated in OS tissues and inversely correlated with the
228
expression of miR-378
229
As KLF9 was identified as one of the targets of miR-378, to detect the expression of 230
KLF9 in OS, RT-qPCR analysis was performed to examine the mRNA level of KLF9 in 231
both OS cell lines and tissues. As shown in Fig.5A, the expression abundance of KLF9 232
was significantly decreased in most of the OS tissues in comparison with that of 233
adjacent normal tissues. Consistent with this data, decreased expression of KLF9 was 234
also observed in OS cell lines Saos2, U2OS, MG-63 and HOS (Fig.5B). To evaluate the 235
correlation between KLF9 and miR-378 in OS tissues, statistical analysis was 236
performed and the result demonstrated that the expression of miR-378 was negatively 237
correlated with that of the miR-378 in OS tumor tissues (Fig.5C). 238
239
Discussion
240
MiRNAs have been characterized as a class of regulator element that negatively 241
regulate the expression of target genes via inducing mRNA degradation or inhibiting 242
translation by imperfect hybridization with the 3′-UTR region. Dysregulation of 243
miRNAs was involved in many aspects of tumorigenesis. Aberrant expression of 244
miR-378 has been found breast cancer, prostate cancer and ovarian cancer (Avgeris et 245
al. 2014; Chan et al. 2014; Lee et al. 2007). However, the expression and function of 246
miR-378 in OS is little known. To explore the role of miR-378 in OS, we detected the 247
expression level of miR-378 in OS patients. Significant increased expression of 248
miR-378 was observed in OS tissues compared with that of healthy controls. 249
Overexpression of miR-378 promoted the cell growth of OS cells, suggesting the 250
oncogenic potential of miR-378 in OS. 251
Detailed molecular mechanism revealed that KLF9 was downstream target of 252
Draft
miR-378 in OS cells. It is previously documented that miR-378 plays key roles in the 253
pathogenesis and progression of many malignant cancers (Avgeris et al. 2014; Chan et 254
al. 2014; Lee et al. 2007). In lung adenocarcinoma cells, miR-378 impaired the cisplatin 255
chemoresistance via targeting secreted clusterin (Chen et al. 2016c). Additionally, 256
miR-378 has been reported to be involved in the development of breast cancer through 257
regulating RUNX1 (Browne et al. 2016). The promoting or inhibiting effect of 258
miR-378 on cancer cell growth was diverse in difference cancers, as overexpression of 259
miR-378 in both prostate cancer and glioma cells suppressed the cell migration and 260
invasion (Chen et al. 2016a; Li et al. 2015). In this study, we found that overexpressed 261
miR-378 promoted the OS cells growth through regulating KLF9. Consistent with our 262
data, Ma et al. demonstrated that miR-378 enhanced the cell proliferation of liver 263
cancer by down-regulating the expression of Fus (Ma et al. 2014). These reports 264
suggested that in different cancers, miR-378 might function as an oncogene or tumor 265
suppressor. The identification of KLF9 as a downstream target of miR-378 enriched our 266
understanding of miR-378 in the development of cancers. 267
Further studies focused on the aberrant expression of miR-378 in OS tissues may be 268
needed to explore the upstream regulators that contribute to the up-regulation of 269
miR-378 in OS tissues. In addition, searching for novel direct targets of miR-378 would 270
benefit our knowledge about the function of miRNA in the malignancy of tumors. 271
In conclusion, our study demonstrated that miR-378 was highly expressed in OS. 272
Overexpression of miR-378 promoted the growth of OS cell, which suggested the 273
oncogentic potential of miR-378 in OS. We also found KLF9 as a direct target of 274
miR-378. Our results implicated the potential application of miR-378 in OS treatment. 275
276
Conflicts of interest
277
The authors declare that they have no conflicts of interests. 278
279
References
Draft
Avgeris, M., Stravodimos, K., and Scorilas, A. 2014. Loss of miR-378 in prostate 281
cancer, a common regulator of KLK2 and KLK4, correlates with aggressive disease 282
phenotype and predicts the short-term relapse of the patients. Biol Chem 395(9): 283
1095-1104. 284
Brown, A.R., Simmen, R.C.M., Raj, V.R., Van, T.T., MacLeod, S.L., and Simmen, F.A. 285
2015. Kruppel-like factor 9 (KLF9) prevents colorectal cancer through inhibition of 286
interferon-related signaling. Carcinogenesis 36(9): 946-955. 287
Browne, G., Dragon, J.A., Hong, D.L., Messier, T.L., Gordon, J.A.R., Farina, N.H., 288
Boyd, J.R., VanOudenhove, J.J., Perez, A.W., Zaidi, S.K., Stein, J.L., Stein, G.S., and 289
Lian, J. 2016. MicroRNA-378-mediated suppression of Runx1 alleviates the aggressive 290
phenotype of triple-negative MDA-MB-231 human breast cancer cells. Tumor Biol 291
37(7): 8825-8839. 292
Chan, J.K., Kiet, T.K., Blansit, K., Ramasubbaiah, R., Hilton, J.F., Kapp, D.S., and 293
Matei, D. 2014. MiR-378 as a biomarker for response to anti-angiogenic treatment in 294
ovarian cancer. Gynecol Oncol 133(3): 568-574. 295
Chen, Q.G., Zhou, W., Han, T., Du, S.Q., Li, Z.H., Zhang, Z., Shan, G.Y., and Kong, C.Z. 296
2016a. MiR-378 suppresses prostate cancer cell growth through downregulation of 297
MAPK1 in vitro and in vivo. Tumor Biol 37(2): 2095-2103. 298
Chen, X., Jiang, Y., Huang, Z., Li, D., Chen, X., Cao, M., Meng, Q., Pang, H., Sun, L., 299
Zhao, Y., and Cai, L. 2016b. miRNA-378 reverses chemoresistance to cisplatin in lung 300
adenocarcinoma cells by targeting secreted clusterin. Scientific reports 6: 19455. doi: 301
10.1038/srep19455. 302
Chen, X.S., Jiang, Y., Huang, Z.P., Li, D.D., Chen, X.D., Cao, M.R., Meng, Q.W., Pang, 303
H., Sun, L.C., Zhao, Y.B., and Cai, L. 2016c. miRNA-378 reverses chemoresistance to 304
cisplatin in lung adenocarcinoma cells by targeting secreted clusterin. Scientific reports 305
6. 306
Fu, L.Y., Jin, L., Yan, L., Shi, J.P., Wang, H.L., Zhou, B., and Wu, X.M. 2016. 307
Comprehensive review of genetic association studies and meta-analysis on miRNA 308
Draft
polymorphisms and rheumatoid arthritis and systemic lupus erythematosus 309
susceptibility. Hum Immunol 77(1): 1-6. 310
Huang, S., Wang, C., Yi, Y., Sun, X., Luo, M., Zhou, Z., Li, J., Cai, Y., Jiang, X., and Ke, 311
Y. 2015. Kruppel-like factor 9 inhibits glioma cell proliferation and tumorigenicity via 312
downregulation of miR-21. Cancer letters 356(2 Pt B): 547-555. doi: 313
10.1016/j.canlet.2014.10.007. 314
Kang, L., Lu, B.J., Xu, J., Hu, H., and Lai, M. 2008. Downregulation of Kruppel-like 315
factor 9 in human colorectal cancer. Pathol Int 58(6): 334-338. 316
Katoh, Y., and Katoh, M. 2008. Hedgehog signaling, epithelial-to-mesenchymal 317
transition and miRNA (Review). Int J Mol Med 22(3): 271-275. 318
Lee, D.Y., Deng, Z.Q., Wang, C.H., and Yang, B.B. 2007. MicroRNA-378 promotes 319
cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression. 320
Proceedings of the National Academy of Sciences of the United States of America 321
104(51): 20350-20355. 322
Li, B., Wang, Y.L., Li, S.T., He, H., Sun, F.B., Wang, C.L., Lu, Y.C., Wang, X.Q., and 323
Tao, B.B. 2015. Decreased expression of miR-378 correlates with tumor invasiveness 324
and poor prognosis of patients with glioma. International journal of clinical and 325
experimental pathology 8(6): 7016-7021. 326
Li, S., Yang, F., Wang, M., Cao, W., and Yang, Z. 2017. miR-378 functions as an 327
onco-miRNA by targeting the ST7L/Wnt/beta-catenin pathway in cervical cancer. Int J 328
Mol Med 40(4): 1047-1056. doi: 10.3892/ijmm.2017.3116. 329
Link, M.P., Goorin, A.M., Miser, A.W., Green, A.A., Pratt, C.B., Belasco, J.B., 330
Pritchard, J., Malpas, J.S., Baker, A.R., Kirkpatrick, J.A., Ayala, A.G., Shuster, J.J., 331
Abelson, H.T., Simone, J.V., and Vietti, T.J. 1986. The Effect of Adjuvant 332
Chemotherapy on Relapse-Free Survival in Patients with Osteosarcoma of the 333
Extremity. New Engl J Med 314(25): 1600-1606. 334
Lodewijk, L., Prins, A.M., Kist, J.W., Valk, G.D., Kranenburg, O., Rinkes, I.H.M.B., 335
and Vriens, M.R. 2012. The value of miRNA in diagnosing thyroid cancer: A 336
Draft
systematic review. Cancer Biomark 11(6): 229-238. 337Ma, H., Wu, Y.Q., Yang, H.M., Liu, J.J., Dan, H.X., Zeng, X., Zhou, Y., Jiang, L., and 338
Chen, Q.M. 2016. MicroRNAs in oral lichen planus and potential miRNA-mRNA 339
pathogenesis with essential cytokines: a review. Or Surg or Med or Pa 122(2): 164-173. 340
Ma, J.C., Lin, J., Qian, J., Qian, W., Yin, J.Y., Yang, B., Tang, Q., Chen, X.X., Wen, 341
X.M., Guo, H., and Deng, Z.Q. 2014. MiR-378 Promotes the Migration of Liver Cancer 342
Cells by Down-Regulating Fus Expression. Cell Physiol Biochem 34(6): 2266-2274. 343
McConnell, B.B., and Yang, V.W. 2010. Mammalian Kruppel-Like Factors in Health 344
and Diseases. Physiol Rev 90(4): 1337-1381. 345
Mirabello, L., Troisi, R.J., and Savage, S.A. 2009. International osteosarcoma 346
incidence patterns in children and adolescents, middle ages and elderly persons. 347
International Journal of Cancer 125(1): 229-234. 348
Mizuguchi, Y., Takizawa, T., Yoshida, H., and Uchida, E. 2016. Dysregulated miRNA 349
in progression of hepatocellular carcinoma: A systematic review. Hepatol Res 46(5): 350
391-406. 351
Shen, P., Sun, J., Xu, G., Zhang, L., Yang, Z., Xia, S., Wang, Y., Liu, Y., and Shi, G. 352
2014. KLF9, a transcription factor induced in flutamide-caused cell apoptosis, inhibits 353
AKT activation and suppresses tumor growth of prostate cancer cells. The Prostate 354
74(9): 946-958. doi: 10.1002/pros.22812. 355
Simmen, F.A., Xiao, R.J., Velarde, M.C., Nicholson, R.D., Bowman, M.T., 356
Fujii-Kuriyama, Y., Oh, S.P., and Simmen, R.C.M. 2007. Dysregulation of intestinal 357
crypt cell proliferation and villus cell migration in mice lacking Kruppel-like factor 9. 358
Am J Physiol-Gastr L 292(6): G1757-G1769. 359
Sporl, F., Korge, S., Jurchott, K., Wunderskirchner, M., Schellenberg, K., Heins, S., 360
Specht, A., Stoll, C., Klemz, R., Maier, B., Wenck, H., Schrader, A., Kunz, D., Blatt, T., 361
and Kramer, A. 2012. Kruppel-like factor 9 is a circadian transcription factor in human 362
epidermis that controls proliferation of keratinocytes. Proceedings of the National 363
Academy of Sciences of the United States of America 109(27): 10903-10908. doi: 364
Draft
10.1073/pnas.1118641109.365
Srivastava, K., and Srivastava, A. 2012. Comprehensive Review of Genetic 366
Association Studies and Meta-Analyses on miRNA Polymorphisms and Cancer Risk. 367
PloS one 7(11). 368
Strauss, S.J., Ng, T., Mendoza-Naranjo, A., Whelan, J., and Sorensen, P.H.B. 2010. 369
Understanding Micrometastatic Disease and Anoikis Resistance in Ewing Family of 370
Tumors and Osteosarcoma. Oncologist 15(6): 627-635. 371
Sun, J., Wang, B., Liu, Y., Zhang, L., Ma, A., Yang, Z., Ji, Y., and Liu, Y. 2014. 372
Transcription factor KLF9 suppresses the growth of hepatocellular carcinoma cells in 373
vivo and positively regulates p53 expression. Cancer letters 355(1): 25-33. doi: 374
10.1016/j.canlet.2014.09.022. 375
Wang, Q.X., Zhu, Y.Q., Zhang, H., and Xiao, J. 2015. Altered MiRNA Expression in 376
Gastric Cancer: a Systematic Review and Meta-Analysis. Cell Physiol Biochem 35(3): 377
933-944. 378
Wen, M.M. 2016. Getting miRNA Therapeutics into the Target Cells for 379
Neurodegenerative Diseases: A Mini-Review. Front Mol Neurosci 9. 380
Wilfred, B.R., Wang, W.X., and Nelson, P.T. 2007. Energizing miRNA research: A 381
review of the role of miRNAs in lipid metabolism, with a prediction that miR-103/107 382
regulates human metabolic pathways. Molecular genetics and metabolism 91(3): 383
209-217. 384
Ying, M.Y., Sang, Y.Y., Li, Y.Q., Guerrero-Cazares, H., Quinones-Hinojosa, A., 385
Vescovi, A.L., Eberhart, C.G., Xia, S.L., and Laterra, J. 2011. Kruppel-Like Family of 386
Transcription Factor 9, a Differentiation-Associated Transcription Factor, Suppresses 387
Notch1 Signaling and Inhibits Glioblastoma-Initiating Stem Cells. Stem cells 29(1): 388
20-31. 389
Zhou, L., Park, B.H., Park, J.H., Jang, K.Y., Park, H.S., Wagle, S., Lee, K.B., and Kim, 390
J.R. 2013. Overexpression of the prolyl isomerase PIN1 promotes cell growth in 391
osteosarcoma cells. Oncology reports 29(1): 193-198. 392
Draft
393394
Figure legend
395
Figure 1. miR-378 was highly expressed in OS tissues and cells. (A) QRT-PCR 396
analysis of miR-378 in OS tissues and healthy controls. **P<0.01. Each point 397
represented a sample. (B) The expression of miR-378 in human OS cells lines (HOS, 398
MG-63, U2OS, G-292, Saos2) and normal cells hFOB 1.19 was detected by qRT-PCR. 399
400
Figure 2. miR-378 promoted the proliferation of OS cells. (A) U2OS and MG-63 401
cells were transfected with miR-378 mimics or negative control (NC, the control mimic 402
miRNA, 5’-UCACAACCUCCUAGAAAGAGUAGA). The expression level of 403
miR-378 was determined by qRT-PCR assay. (B and C) USOS and MG-63 cells were 404
transfected with miR-378 mimics or NC for the indicated time. The cell proliferation 405
was measured with the CCK-8 assay. *P<0.05, ***P<0.001, two-way analysis of 406
variance (ANOVA). (D) hFOB1.19 cells were transfected with miR-378 mimics or 407
control miRNA. The expression level of miR-378 was detected by RT-qPCR (left 408
panel). The proliferation of hFOB1.19 cells was determined at the indicated time by the 409
CCK-8 assay. NS, no significance. (E) Colony formation assay was performed in both 410
U2OS and MG-63 cells after transfected with NC or miR-378 mimics. **P<0.01, 411
***P<0.001, Student’s t test. 412
413
Figure 3. KLF9 was a downstream target of miR-378. (A) The predicted binding 414
site of miR-378 in the wild type or mutant 3’-UTR of KLF9 was shown. (B) Luciferase 415
reporter assay of the U2OS and MG-63 cells transfected with the 3’-UTR of KLF9 416
reporter plasmid and miR-378 mimics or NC. **P<0.01, Student’s t test. (C) OS cells 417
were transfected with miR-378 mimics or NC and the mRNA expression level of KLF9 418
was detected by the qRT-PCR. **P<0.01, Student’s t test. (D) Western blot analysis of 419
KLF9 in OS cells transfected with miR-378 mimics or NC. GAPDH was used as the 420
Draft
loading control. (E) Both U2OS and MG-63 cells were transfected with miR-378 421
antagomir or antagomir control miRNA (5’- UUUGUACUACACAAAAGUACUG) 422
and the down-regulation efficiency of miR-378 was detected by qRT-PCR. **P<0.01, 423
Student’s t test. (F) The mRNA level of KLF9 was evaluated in OS cells with depleted 424
miR-378. (G) OS cells was transfected with miR-378 antagomir or control miRNA and 425
the protein level of KLF9 was detected by western blot with anti-KLF9 antibody. 426
427
Figure 4. The proliferation-promoting effect by miR-378 was reversed by KLF9.
428
(A) U2OS cells transfected with the indicated miRNA or plasmids were subjected to 429
CCK-8 assay. **P<0.01, two-way analysis of variance (ANOVA). (B) The colony 430
formation of U2OS cells transfected with the indicated miRNA or plasmids. **P<0.01, 431
Student’s t test. (C) U2OS cells were transfected with shRNA-control or shRNA-KLF9. 432
The knockdown efficiency of KLF9 was confirmed by qRT-PCR analysis. **P<0.01, 433
Student’s t test. (D) The CCK-8 assay of U2OS cells transfected with the indicated 434
miRNA or plasmids. **P<0.01, two-way analysis of variance (ANOVA). 435
436
Figure 5. KLF9 was down-regulated in OS tissues and inversely correlated with
437
the expression of miR-378. (A) The mRNA level of KLF9 was examined in OS tissues 438
and adjacent normal tissue. (B) The mRNA abundance of KLF9 in HOS, MG-63, 439
U2OS, G-292, Saos2 cells and normal cells hFOB 1.19 was detected by RT-qPCR. 440
**P<0.01; ***P<0.001; ns, no significance. (C) The correlation between the 441
expression of miR-378 and KLF9 in OS tissues was analyzed. ***P<0.001. 442
Draft
Print Fig.1 in black and white 161x76mm (300 x 300 DPI)
Draft
Print Fig.2 in black and white 162x115mm (300 x 300 DPI)
Draft
Print Fig.3 in black and white 164x129mm (300 x 300 DPI)
Draft
Print Fig.4 in black and white 163x149mm (300 x 300 DPI)
Draft
Print Fig.5 in black and white 157x123mm (300 x 300 DPI)
