0095-1137/94/$04.00+0
An
Integrated Target
Sequence and Signal Amplification
Assay, Reverse
Transcriptase-PCR-Enzyme-Linked
Immunosorbent Assay, To Detect and
Characterize Flaviviruses
GWONG-JEN J. CHANG,* DENNIS W.TRENT, A. VANCE VORNDAM, EDGARDO VERGNE, RICHARD M. KINNEY,
ANDCARL J. MITCHELL
Division of Vector-Borne Infectious Diseases, National Center for Infectious Diseases, CentersforDisease Control andPrevention, PublicHealthService, Department
ofHealth andHumanServices, FortCollins, Colorado 80522 Received 20September1993/Accepted 18 November 1993
We previously described a reversetranscriptase-PCRusing flavivirus genus-conserved and virus species-specific amplimers(D.W.Trent and G. J. Chang,p.355-371,inY. Beckerand C.Darai; ed., Frontiersof Virology, vol. 1, 1992). Target amplification was improved by redesigning theamplimers, and a sensitive enzyme-linked immunosorbent assay(ELISA) technique has beendeveloped todetect amplifieddigoxigenin (DIG)-modified DNA. A singlebiotin motif andmultiple DIG motifswereincorporated intoeachamplicon, which permitted amplicon capture by a biotin-streptavidin interaction and detection with DIG-specific antiserum in acolorimetric ELISA. We evaluated theutilityofthisassayfordetecting St. Louisencephalitis (SLE) viral RNA in infected mosquitoes and dengue viral RNA in human serum specimens. The reverse transcriptase-PCR-ELISAwas assensitiveasisolation ofSLEvirusbycell culture indetectingSLEviral RNA ininfected mosquitoes. Thetestwas89% specific and 95to 100%1 sensitive for identificationofdengueviral RNA in serum specimens compared with isolation of virus by Aedes albopictus C6/36 cell culture and identificationbytheindirectimmunofluorescenceassay.
Flavivirusesarearthropod-transmittedviruses thatbelong tothefamilyFlaviviridae(1).Viruses inthisfamilyinclude the etiologic agents of dengue (DEN), yellow fever (YF), Japanese encephalitis (JE),West Nile encephalitis, Murray Valley encephalitis, St. Louis encephalitis (SLE), and tick-borne encephalitis (9). Conventional flavivirus diagnosis is based on isolation and identification of virus from clinical specimens orthe presenceofvirus-specific antibody in the patient serum specimen (9). The exceptional sensitivity of the PCR permits a millionfold amplification ofspecific nu-cleotidesequences invitro(14). Thistechnique provides an attractiveapproach forrapiddetection and identification of flavivirusesinmosquitoesand clinicalspecimenswhen virus cultivation is difficultortimeconsumingand whendiagnosis impacts on clinical treatment and has implications for vac-cinationandmosquitocontrol.
Several reverse transcriptase (RT)-PCRs using different pairsofprimers (amplimers) for specificviruses have been developed for detecting flavivirus RNA. Identification of virus to species level has usually been accomplished by determining the size of amplified DNA by agarose gel
electrophoresis (3, 6-8, 10)orby hybridizationwith labeled virus species-specific (VSS) probes (2, 6, 8). Agarose gel electrophoresis is more convenient but less sensitive than hybridization.Acombination ofnestedPCR andagarosegel electrophoresis is more sensitive than hybridization for detecting and identifying the four serotypes of DENvirus (DEN1 through DEN4) (8). However, this technique is
* Corresponding author. Mailing address: Division of
Vector-Borne Infectious Diseases, NCID, CDC, P.O. Box 2087, Fort Collins,CO 80522. Phone:(303)221-6497.Fax: (303)221-6476.
subjectto ampliconcontamination duringthe second cycle of amplification. We have described a simple strategy to detect medically important flaviviruses in a single-vessel RT-PCR (15). This assay consists of a flavivirus
genus-conserved(FGC) amplimer pair (FUDJ9166andCFDJ9977) and 11 individual VSS up amplimers that hybridize with specificsequencesinthecarboxyl-terminalone-thirdportion of the NS5 (nonstructural) gene. The FGC amplimer pair amplifies an amplicon of 830 bp in the NS5 gene of all flaviviruses tested (15). To determine the species of viral RNA, the FGC down amplimer (CFDJ9977) is used in combination with an individual VSS up amplimer.
Ampli-cons ofappropriate sizesaregenerated ifthevirus-specific
up amplimerandviral RNAarehomologous. ThisRT-PCR can also be usedto identify previously unrecognized flavi-virusesby nucleotidesequenceanalysis of theDNA
ampli-fiedbythe FGCamplimer pair (15).
Toimprovethesensitivityandspecificityof the flavivirus RT-PCR, we have modified the FGC down amplimer, CFD2-4, and developed an integrated target and signal amplification assay. This assay employs RT-PCR in the
presence of digoxigenin (DIG)-11-dUTP to amplify target
sequences in theNS5 gene oftheflavivirus RNA and uses theenzyme-linkedimmunosorbentassay(ELISA)todetect the DIG-modified amplicon DNA. Amplimers have been designedtodetect andtypethemedicallyimportant
flavivi-rusesinmosquitoesand serumspecimens.
MATERIALS ANDMETHODS
Virus strains and specimens. Viruses used in this study wereobtained from thereference collection atthe Division of Vector-Borne Infectious Diseases, Centers for Disease
477
on May 15, 2020 by guest
http://jcm.asm.org/
Control andPrevention(CDC),FortCollins, Colo.YFvirus
strain17Dand SLE virus strain MSI-7weretitrated in Vero cells
(16).
Insectary-maintained Culex pipiens mosquitoes were in-oculated
intrathoracically
with 0.5 PFU of SLE virus per 350 nl. Sincemosquitoes
are more susceptible than Vero cellsforflavivirus
replication,
thevirusdose usedis sufficientto infect allinoculatedmosquitoes. Sixteenuninfected mosqui-toes were frozen at zero hour as the normalmosquito
control. Twotofour infected
mosquitoes
wereremoved and frozen at -70°C at 4.5, 18.5, 48, 96, and 144 h postinoculation (p.i.). Individualmosquitoeswerehomogenized separately in 1 ml of Eagle's minimal essential medium
containing
5% bovine serumalbumin and frozen at -70°C.Theinfectionstatusof eachmosquitowasverifiedby plaque titration in Vero cells
(16).
Serum
specimens
from DEN viruspatients
wereobtained from the San Juan Laboratories, Division of Vector-Borne Infectious Diseases, CDC, San Juan, P.R. To evaluate thesensitivity
andspecificity
oftheRT-PCR-ELISA,
we ana-lyzed91serumspecimens previouslyshowntocontain DEN virusasdemonstratedby virus isolation inAedesalbopictusC6/36
cell culture and virus identificationbyindirect immu-nofluorescenceassay(IFA) (5).
Twenty-four specimens neg-ativeby C6/36
cell culture and IFA were included as controls.All of thespecimenswereassignedarandom codeprior
to blindtesting
byRT-PCR-ELISA.RNAextraction.Nucleic acidswere extracted from virus seed
stocks, homogenized mosquito
suspensions,orhuman serumspecimens by
the methoddescribedby
Lanciottietal.(8).
The extracted nucleic acidwasresuspended
in distilled water andstored at -700C.Capture
offlaviviralRNAfrommosquitoesbefore RT-PCR. Toremovenonspecific
inhibitors of theRT-PCR,
viral RNA in infectedmosquito
extracts wascaptured by using
a modification of themethod describedby
Lanciottietal.(8).
Oligonucleotide primer
Bio-CFDJ9977 or Bio-CFD2-4served as the flaviviral RNA capture
probe.
Nucleic acid extracted fromhomogenized mosquitoes
was mixed with 5pmol
of captureprobe
in washbuffer(0.1
MTris-HCl,
pH5.5;
0.1 MNaCl),
heatedat94°C
for 2min,andslowly
cooled to room temperature.Biotinylated probe
(Bio-probe)-viral
RNA
complexes
werecaptured by
the addition of 10,ul
ofprewashed streptavidin-coated magnetic
beads(M-280
streptavidin, binding capacity
of 2pmol/Rl;
Dynal,
Inc.,Great
Neck,
N.Y.). Following
incubation at room tempera-ture for 30min,
Bio-probe-viral
RNA-M-280complexes
were immobilized
during
allwashing
stepswith amagnetic
particle
concentrator(Dynal MPC-E; Dynal, Inc.).
Bio-probe-viral
RNA-M-280complexes
were washed threetimes with wash bufferto removeunbound components, and the
complexes
wereresuspended
in 20 ,ulofdistilledH20.
Captured
viral RNA wasseparated
from the complex byheating
at80°Cfor 2 minandquickchilling
at4°C. RNA in thesupernatant
wasseparated
from themagnetic
beads at4°C
and collected.Synthesis
ofoligonucleotide amplimers.
TheFGC and VSSamplimers
used in theRT-PCR-ELISA,
exceptCFD2-4 andDEN4-9580,
have beenpreviously
described(Table 1) (15).
FGC
amplimer CFD2-4,
whose 3'-terminal 21 residues are identical to thecomplete
FGCamplimer
CFDJ9977, pro-videdmore efficientamplification
of DEN4 viralRNAs.Oligonucleotides
weresynthesized
on anApplied
Biosys-tems DNAsynthesizer,
model380A, by using
standardphosphoramidite chemistry (Applied Biosystems
Inc., Fos-terCity, Calif.).
Biotin was attached to the 5' end of the15'NC IC
|PrM/M E |NS1 NS2A/B NS3 NS4A/B| NS5 3'NCNS5 l iiii ill ll ll ll ll ll[Tlll l i
FGC: 9166 FUDJ9166 ==F=z
VSS:
9977
-:==CFD2-4
.~c
=CFDJ9977
}Amplicon bp
DEN1-J9243 =D 761
YF-9334 743
JE-9574 566
DEN2-J9452 546
DEN3-9471 522
SLE-J9483
i
515 DEN4-9580 = 411FIG. 1. Schematicdiagramof the11-kb flavivirusgenome show-ing the relative locations of FGC and VSS amplimers. Arrows indicatethe 5'-to-3' directionofamplimers. Amplimers specific for DEN1, DEN2, DEN3, DEN4, JE, SLE, and YF viruses are designated DEN1-J9243, DEN2-J9452, DEN3-9471, DEN4-9580, JE-9574, SLE-J9483, and YF-9334, respectively. NC, noncoding region; C, nucleocapsid protein; PrM/M, premembrane and mem-braneprotein; E, envelope protein;NS, nonstructural protein.
CFDJ9977 and CFD2-4 amplimers by usingbiotin-on phos-phoramidite chemistry (Clontech Laboratories, Inc., Palo
Alto, Calif.). Synthetic oligonucleotides were purified by
using OPC columns(Applied Biosystems, Inc.).
RT-PCR as a target sequence amplification system. A
single-vesselRT-PCRwasusedtoconverttargetviral RNA to cDNA with subsequent amplification of the cDNA to double-stranded DNA. Reactions were done in a 25-,ul volume that contained the following components:
resus-pended viralRNAextract(1to 10 ,ul); 50 mM
KCl;
10 mMTris-Cl, pH 8.5; 1.5 mMMgCl2;0.01% (wtlvol) gelatin; 200
,uM
(each)
the four deoxynucleoside triphosphates(Pro-mega,Madison, Wis.);2.5 mMdithiothreitol;250 nM(each)
(unlessotherwise specified)upand down amplimers;2.5 U of RAV-2 RT(Amersham Corp., Arlington Heights, Ill.)per 100p,u;and 2.5 U ofAmplitaq polymerase (ThePerkin-Elmer
Corp., Norwalk,Conn.)per100
pul.
Reaction mixtureswere incubatedinamodel 9600Thermocycler(ThePerkin-ElmerCorp.)for 1 hat55°Ctofacilitate the RT reaction and for 4 min at 94°C for denaturation, after which they were
sub-jected to 25 cycles ofdenaturation (94°C for 1 min), am-plimer annealing (55°C for 1 min), and amplimerextension
(72°Cfor 3min), followedbya 10-min incubationat72°C.
To incorporate DIG-dUMP directly into the amplicon, reactions were performed as described above with the
addition of 10 ,uM DIG-11-dUTP (Boehringer Mannheim
Biochemicals, Indianapolis, Ind.) in the reaction mixture.
Although a higher concentration of DIG-11-dUTP in the reaction mixture resulted in increased optical density (OD) readings in ELISAs, test sensitivity was not significantly improved(datanotshown).
ELISA amplification system. DIG-modified amplicons (DIG-amplicons)werecharacterizedbyagarosegel
electro-phoresis and ELISA. Five-microliter portions of reaction
product were electrophoresed in 3% GTG agarose gels (FMC Bioproducts, Rockland, Maine), and the amplified
DNAwas stained withethidium bromide. Because individ-ual VSS amplimers primedat differentpositionsintheNS5
geneof the viralRNA, theampliconsize for eachflavivirus wasdifferent(Fig. 1 and Table 1).
on May 15, 2020 by guest
http://jcm.asm.org/
TABLE 1. Amplimersusedin RT-PCR-ELISAidentificationofflaviviruses
Amplimertypeand Oligonucleotide sequence(5'to3') Arnpliconsize
designation (bp)
FGCamplimers
Bio-CFD2-4a 5'-TlTGAGCATGTCTlCCGTCGTCATCC
Bio-CFDJ9977a 5'- GCATGTCTTCCGTCGTCATCC
FUDJ9166b 5'-GATGACACAGCAGGATGGGAC 838or832C
VSSup amplimers
DEN1-J9243 5'-GCCTGAACATGCTCTATTGGCT 761
DEN2-J9452 5'-TCTTCAAAAGCATTCAGCACCT 546
DEN3-9471 5'-CCCATCCGCTAGAGAAGAAAATTACAC 522
DEN4-9580 5'-GGTllrrGGCACl-CCCTCC-rCTTCTlG 411
JE-9574 5'-GACCACAACACTTGGAACAGCTAC 566
SLE-J9483 5'-ACGATTGGCCAAAGCGGTTGAG 515
YF-9334 5'-ACAAGCAGTGATGGAAATGACA 743
Nested-PCRamplimersd
Dl 5'-TCAATATGCTGAAACGCGCGAGAAACCG
D2
5'-TTGCACCAACAGTCAATGTCTTCAGGTFC
511TS1 5'-CGTCICAGTGATCCGGGGG 482
TS2 5'-CGCCACAAGGGCCATGAACAG 119
TS3 5'-TAACATCATCATGAGACAGAGC 290
TS4 5'-CICTGTTGTCTrAAACAAGAGA 392
aDown amplimer.
bUpamplimer.
'Amplicon size obtained by using Bio-CFD2-4orBio-CFDJ9977, respectively.
dReported by Lanciottietal. (8).
Aschematic representation of the ELISA detection pro-tocol is shown in Fig. 2. DIG-amplicons were diluted in a fourfold dilutionseries with rinse buffer(phosphate-buffered
saline with0.05%Tween20). Fifty-microliteraliquotsof the
dilutedDIG-ampliconswereaddedtoeachwell ofa96-well ELISA plate (Immulon II; Dynatech Laboratories Inc., Chantilly, Va.)that hadpreviouslybeencoated with strepta-vidin(1,ug perwell;BoehringerMannheimBiochemicals)in 100 ,ul of coating buffer (Na2CO3-NaHCO3, pH 9.6) and blocked with 100 ,ul of blocking buffer (3% normal goat
Read
OD450
Substrate
Color
\
7
FIG. 2. Detectionof DIG-dUMP(DG) incorporated DNA bya
colorimetric ELISA technique. DIG-dUMPs were incorporated directly into the amplicon during target sequence amplification. Ampliconswerecaptured by biotin(Bio)-streptavidin (SA)
interac-tion andweredetectedby using horseradishperoxidase-conjugated
sheep anti-DIGFabfragment (POD) inastandardELISA format.
The biotin moiety was from biotinylated FGC amplimers, Bio-CFD2-4.
serumin rinsebuffer) per well.BiotinylatedDIG-amplicons werebound to the microtiterplate through
biotin-streptavi-dininteractionby incubationat37°C for 1 h. Theplateswere washed threetimes with rinsebuffer, followed bythe addi-tiontoeach well of50 ,u of rinse buffercontaining5 mU of horseradishperoxidase-conjugated sheep anti-DIGFab frag-ment (Boehringer Mannheim Biochemicals), incubation at 37°C for 1 h, and three washes with rinse buffer. One hundred microliters of the enzymesubstrate-colorindicator (0.01% 3,3',5,5'-tetramethyl benzidine, 0.005% H202in 0.1 Mcitrate-acetatebuffer,pH6.0)wasaddedtoeachwell,and the plateswere incubated at room temperature for10 min. Reactions were stopped by the addition of 50
RI
of 2 M H2SO4 perwell, and the OD at 450 nm(OD450)
was mea-sured ineach well.Development of testing algorithms for routine diagnosis of flavivirus infection. Apanel of 115 randomlycoded serum specimens, including 91 positive and 24 negative byvirus
isolationinC6/36 cells and IFA,wasused in a blindtestto
determine the
sensitivity,
and specificity of the RT-PCR-ELISAas a diagnostic procedureforDENvirus infection. Resultswererecordedasflavivirusnegative,flavivirus pos-itive (with DEN virus serotype), orvirus species undeter-mined (Fig. 3). Specimens that gave disparate resultswere reevaluatedbyvirusisolation inC6/36cells and IFA(5)and nested PCR(8).RESULTS
SpecificityoftheELISAsignal amplification system. Spec-ificity of the ELISA in detecting flavivirus amplicons de-pendsontheprimary interaction of the target RNA sequence with amplimers used to prime synthesis of virus-specific amplicons during the RT-PCR. Althoughnonspecific target
amplification can bedecreased or eliminatedbyraising the
amplimer annealing temperature from 50 to 55°C, some nonspecific amplimer-RNA interaction can occur at higher
on May 15, 2020 by guest
http://jcm.asm.org/
Specimens Nucleic acidextraction
RT-PCR-ELISA using FUDJ-9166 & Bio-CFD2-4
Positive OD RT-PCR-ELISAusing VSS &Bio-CFD2-4
Positive OD Neg;
Determine viral Repe
Species usinc
ciIn
ruuL CFD:
Nucli
sequ
anal!
Negative OD Repeat
RT-PCR-ELISA using FUDJ-9166 &Bio-CFD2-4
iative OD zat RT-PCR 9
J-9166 & 2-4
leotide
jence
ysis
Negative OD
2.6 3.2 3.8 4.4 5 5.6
Log,,Reciprocal Amplicon Dilution
FIG. 5. Sensitivity oftheRT-PCR-ELISA for detection of YF viral RNA. Assays were performed with amplimers Bio-CFD2-4 and YF-9334at250nM for25PCRcycles.Colorimetric ELISA detec-tion(graphs) of the amplicon is compared with visual detection of the ethidium bromide-stained amplicon analyzed by agarose gel electrophoresis (AGE score; +or-) following RT-PCR using a 1.0 to5.2
log1o
PFUequivalent ofYFviralRNA.Determine viral species
FIG. 3. TestalgorithmforRT-PCR-ELISAdetection of
flavivi-rusRNA inclinicalspecimens.
amplimer concentrations and result in a highernonspecific
OD450.To illustratethe effectofamplimer concentrationon ELISA specificity, differentconcentrations (500, 250, 125, and62.5 nM)ofdown FGC amplimer CFD2-4andupVSS
amplimer YF-9334, DEN1-J9243, DEN2-9452, DEN3-9471, DEN4-9580, orJE-9574(Table 1)wereused todetecta6.2
log1o
PFU equivalentofYF viral RNA(Fig. 4).Down amplimer Bio-CFD2-4 paired with heterologous
1.5
0
0 1
0.5
-EROFi= -i-_
2 2.6 3.2 3.8 4.4 5
Log,,Reciprocal Amplicon Dilution
FIG. 4. Effect ofamplimerconcentrationonthespecificityofthe
RT-PCR-ELISA.Bio-CFD2-4(FGC)waspaired with different VSS amplimers,YF-9334(YF),JE-9574(JEV),andDEN2-J9452(DEN2) inanRT-PCR-ELISAtodetectYF viral RNA.Amplimer pairswere
testedat500, 250, 125,and 62.5 nM.
VSS upamplimers DEN2-J9452and JE-9574 at a
concentra-tion of 500nM gaveunacceptably high
OD45Os
of 0.58 and0.38,respectively, at anamplicon dilution of 1:100 (Fig.4). BackgroundODs werebelow 0.05when 250, 125, or 62.5 nM heterologous VSSamplimers were used in RT-PCRs (Fig. 4). The homologous Bio-CFD2-4-YF-9334 amplimer pair at
concentrations of500, 250, and 125 nM resulted insimilar
OD45Os
of1.62to1.88atthe 1:100dilutionof DNAamplifiedfrom YF viral RNA(Fig. 4). Amplicon yieldswere nearly
equal when this amplimer pair was used at concentrations of 500 and 250 nMbut decreasedby about80%atthe 125 nM
concentration(datanotshown).Atanamplimer concentra-tion of62.5nM,ampliconswereundetectablebyagarosegel electrophoresis (not shown) but were weakly positive by ELISA(Fig. 4). Experimentsusing heterologous and
homol-ogous amplimerswithDEN1, DEN2, DEN3, DEN4, orJE viral RNAs gave similar results (data not shown). On the basis ofhigh amplicon yield and lownonspecific reactivity, an amplimer concentration of 250 nMwas selected foruse throughout the remainder of this study.
SensitivityofRT-PCR-ELISA for detecting viral RNA. YF viral RNA was used to illustrate the sensitivity of the RT-PCR-ELISAas anintegratedamplificationand detection system. Various amounts of virus RNA, equivalent to5.2,
4.6, 3.4, 2.8,2.2, 1.6, or1.0
log1o
PFU of YFvirus, and250 nM amplimer pairBio-CFD2-4-YF-9334
were used. The relative sensitivities of the RT-PCR-ELISA and the agarosegelelectrophoresis-ethidiumbromidestainingmethodswere compared for detection of DIG-amplicons amplified from various amounts of YF viral RNA (Fig. 5). The RT-PCR-ELISA enabled detection ofa10-PFUequivalentof YF viral RNA(Fig. 5),incontrast toagarosegelelectrophoresis, with
which a specific amplicon band was visible only when greater thana640(or2.8
log1o)
PFU equivalentof YFviral RNA wasused (Fig. 5). Thus, ELISAwasat least 64-fold more sensitive than agarose gel electrophoresis-ethidiumbromidestaining for detection ofDIG-amplicons.
ViralRNAdetection inmosquitoes infected with SLEvirus.
Application of the RT-PCR-ELISA to detect viral RNA in flavivirus-infectedmosquitoeswasinvestigated by
analyzing
Amplimer
Pair ioncCno
\+-FGC-YF: n
\ \\ ~~~~~~1~FGC4JEV: I 00
\ FGC-DEN2:5
-+-FGC-YF: 5
FGC-YF: 1
-\-FGC-JEV: 1
-WFGC-DEN2: 1
9\0\ -FGC-YF:
<\
k
\S~~~fi-~
icentration
500 nM
500 1
500 1
250 "
125 1
125 '
125 11
62.5'
A
on May 15, 2020 by guest
http://jcm.asm.org/
TABLE 2. Comparisonbetween virus isolation and RT-PCR-ELISA in detection of SLE virus-infected mosquitoes
Result by:
No.of____________________________________
Time (h) p.i. specimens RT-PCR-ELISAb
tested Virusisolationa
Uncaptured RNAC CapturedRNAd
4.5 2 -, - -,-
-,-18.5 4 , , ,- 2.6, -,2.6
48.0 3 1.7, 2.4, 2.2 -, -,2.6 2.6, 2.6,2.6
96.0 3 3.4, 4.8,5.4 3.2,3.8, >4.4 3.2, 3.8, >4.4
144.0 4 5.7,4.6, 5.6, 5.9 >4.4, 3.8, >4.4, >4.4 >4.4, 3.8, >4.4, >4.4
0(uninfected controls) 16 - (all) <2.0(all)e <2.0 (all)
-,negative result. Numbers indicate
log1o
PFU/mlmeasured by plaque titrationin Verocells.b-,b negative result. Numbers indicatelog1oreciprocal endpoint titers determined by ELISA.
Nucleic acid extracted frommosquito homogenateswasuseddirectly in RT-PCR-ELISA. dVirus-specificRNApurified from nucleic acidextractsby Bio-probe-streptavidincapture.
eAlluninfected controlmosquitoeshadOD450Sof0.1to0.25ata1:100amplicon dilution.
mosquitoes inoculated with SLE virus. Mosquitoes were assayed forinfectious virus by plaque titration in Vero cell monolayers and for viral RNAby RT-PCR-ELISA at vari-oustimesp.i. SLE virus could be isolated frommosquitoes 48to 144 hp.i. (Table 2). Onlyoneofthe threemosquitoes tested at 48 h p.i. was positive by RT-PCR-ELISAwhen total nucleicacidwasused in thetestwithoutpurification of the viral RNA.However, followingcaptureandelutionfrom probe-magneticbeadcomplexes,viralRNAwasdetectedby RT-PCR-ELISAin all of themosquitoes tested at48to 144 hp.i., aswell asintwoof fourmosquitoes tested at 18.5 h p.i. (Table 2). Although detection of SLE viral RNA in mosquitoes by RT-PCR-ELISA without RNA capturewas less sensitivethan virus detectionbyisolation of virus in cell culture, RT-PCR-ELISAofcapturedSLE viral RNAwasat leastassensitive asvirus isolation(Table 2).
RT-PCR-ELISA for routine detection and typing of DEN
virusesfrom viremic humanserum. Todetermine the
sensi-tivityandspecificityof theRT-PCR-ELISA as adiagnostic
test,apanel of 115 randomlycoded humanserumspecimens was analyzed. Ninety-one of the serum specimens had previously been shown to contain DEN virus by virus isolation and IFA in C6/36cell cultures (5). By the testing algorithmshown inFig. 3, 97 of theserum specimenswere positivefor DEN viral RNAby RT-PCR-ELISA.A
compar-ison of the PCR resultswiththoseobtainedbyvirusisolation and IFArevealed discordance for 14specimens,asshown in Table 3. These 14 specimens were again tested by virus isolation and IFA inC6/36cell culture.Byvirus isolation and IFA, specimens 17, 30, 93, 107, 124, 163, 187,and200,which wereinitially reported asnegative, werepositivefor DEN2 virus on retrial (Table 3). The remaining six discordant specimens (8, 15, 48, 91, 135, and 180) were retested by RT-PCR-ELISAaswellasbythenested-PCRtechnique (8). Specimens 91 and 135, which were identified by virus isolation and IFA as positive for DEN3 and DEN4virus, tested positive for DEN2 and DEN3 viral RNA,
respec-tively, byRT-PCR-ELISA and nestedRT-PCR. These two
specimens were categorized as indeterminate and not ana-lyzedfurther. Specimens8 and 180wereclassified as nega-tivebyIFA but as DEN2positive by RT-PCR-ELISA and nestedPCR. Specimens 15 and 48were DEN1 positiveand DEN2positive byIFA butwerebothnegative by RT-PCR-ELISA and nested PCR.Specimens8and 180wererecorded asfalsenegative by IFA,whereasspecimens 15 and 48were falsenegative byRT-PCR-ELISA.
Two-way comparisonsweremade betweenthe
RT-PCR-ELISA results and those obtained by virus isolation and IFA
(Table 4). Both methods provided 89% overall specificity
and 98% overall sensitivity in the detection of specimens containingDENvirusorviral RNA. Both methodsshowed
95 to 100%sensitivity in the identification of human serum specimensinfected with each of the four serotypes of DEN
virus (Table 4). Identificationof DENvirusorviral RNA in these clinical specimensbyRT-PCR-ELISAwas compara-bletothe virusisolation-IFAmethod intermsofspecificity
andsensitivity.However, RT-PCR-ELISAoffersthe advan-tage ofspeedindiagnostic testing.
DISCUSSION
The epidemiology and clinical diagnosis of flaviviruses,
which are important causes of human disease, are major public health concerns (9). The RT-PCR amplification of viral RNAprovides a rapid and specific technique for the
detection andidentification offlavivirusesand isassensitive asvirus isolation in cell cultures and inmice(2, 3, 6-8, 10).
Because severalflavivirusesmaybetransmittedbythesame
TABLE 3. Repeattesting of14humanserumspecimens forthe presenceofDENvirus(C6/36 cell culture and IFA)
orDENviralRNA(RT-PCR) Serotypeidentifiedby: Specimen C6/36cellculture and IFA RT-PCR
no.
Preliminary Retrial ELISA Nested'
8 Nb N 2 2
15 1 1 N N
17 N 2 2 NDC
30 N 2 2 ND
48 2 N N N
91 3 N 2 2
93 N 2 2 ND
107 N 2 2 ND
124 N 2 2 ND
135 4 N 3 3
163 N 2 2 ND
180 N N 2 2
187 N 2 2 ND
200 N 2 2 ND
aThenested RT-PCR wasperformedasdescribedby Lanciottietal.(8).
bN,negative specimen.
cND,notdone.
on May 15, 2020 by guest
http://jcm.asm.org/
TABLE 4. Specificity and sensitivity of IFA or RT-PCR-ELISA to detect DEN virus or viral RNA from human serum specimens
Result and/or No. identified by IFA/no. No. identified by PCR/no. Specificity' Sensitivityd
serotype identifiedbyPCR' identifiedby
IFAb
IFA PCR IFA PCRPositive
DEN 97/95 97/95 89 89 98 98
DEN1 26/25 25/25 96 96
DEN2 36/35 37/35 97 95
DEN3 10/10 10/10 100 100
DEN4 25/25 25/25 100 100
Negative 16/14 16/14
False positive 2(IFA) 2 (PCR)
False negative 2(IFA) 2 (PCR)
aNumber ofspecimensidentifiedby IFA/number of the same specimensconfirmedby PCR.
bNumber of specimensidentified byPCR/numberof the samespecimens confirmed byIFA.
cSpecificity ofassay=no.ofnegative specimens/(no. of negative specimens +no.of false-positive specimens) x100.
dSensitivityof assay=no.ofpositivespecimens/(no.ofpositive specimens+no.of false-negativespecimens) x100.
speciesofmosquitoin thesamegeographicareaatthesame time, the isolation ofmorethan onevirus from mosquitoes
or clinical specimens is a possibility. By FGC- and VSS-amplimer-mediated RT-PCR (15), the RNA species of 11 medically important flaviviruses can be determined by the specific size of amplified DNA. This technique is also capableofidentifyingapreviouslyuncharacterizedornewly emerged flavivirus by use of the FGC amplimer pair and direct nucleotide sequence analysis of the amplified DNA
(15).
Oligonucleotide probe hybridization (2, 6, 8)and reampli-fication withinternal amplimers (8)utilize labeledprobes or reamplification toincrease thesensitivity and specificity of detection. These methods are more sensitive than agarose
gel electrophoresis but aretime-consuming and technically demanding. Detection and characterization of flaviviral RNAby the integratedtargetsequence(RT-PCR) and signal
(ELISA) amplificationsystemareaccomplished by usingthe previouslydefined FGC and VSS amplimersequenceswith some modifications (Table 1) (15). The Bio-CFD2-4 am-plimer and DIG-11-dUTP usedinthe RT-PCRincorporatea biotinmolecule and multiple DIG residues into the amplicon. This technique usesbiotin-streptavidin as a separation
sys-temandDIG-anti-DIG as an indicatorsystem to achieve a high level of sensitivity and technical simplicity. We de-tected as little as a 10-PFU equivalent of YF viral RNA, indicating this method is as sensitive as the nested-PCR method of Lanciottietal. (8).
As with PCR detection of other RNAviruses, sensitivityis largelydeterminedbytheefficiencyofreversetranscription of theflavivirus genomicRNA inproducingcDNApriorto PCR (13). False-negative RT-PCR results were obtained when DEN viral RNA isolated from DEN virus-infected mosquitoes was used in the PCR (8). Lanciotti et al. (8) speculated that an inhibitory component present in the mosquito extract inhibited the PCR. We have developed a method that facilitates capture of flaviviral RNA prior to RT-PCR and improves the quality of isolated viral RNA. Using Bio-CFDJ9977 to capture viral RNA, we detected SLE viral RNA in experimentally infected mosquitoes by RT-PCRpriortovirus isolation(Table 2).Thissuggeststhat the RNAcaptureproceduredoesremovenonspecific inhib-itors andconcentrates the viral RNA.
TheRT-PCR-ELISAwasequivalenttothe standard virus
isolation and IFAprotocol in terms of testspecificity (89%)
andsensitivity (95to100%)inidentifyingDENvirusorviral RNA in clinical human serum specimens (Table 4). Six
discordantspecimens (Table 3)gave identical resultswhen theywereretested byRT-PCR-ELISA and nested PCR(8) (Table 3). Specimen 15, from which DEN1 viruswas reiso-lated, was the only sample classified by the two PCRs as negative. Specimen 48,initiallyreportedtobepositive,was negative by thetwo PCRs and virusreisolation, suggesting
that thevirus had been inactivated and the RNA had been
degraded. Results obtained bytwo different RT-PCR tech-niques fortwoindeterminatespecimens, 91 and 135, differed from the initial results obtainedbyvirusisolationand IFA.
These discrepancies probably resulted from misinterpreta-tionof theinitialIFA.Unfortunately,wecouldnotreisolate virus from thesetwospecimens. Specimens8and180were positive by two different PCR techniques but negative by virusisolation, suggestingthatinactiveviruswaspresent in thesesera.Virus-antibody complexesorinactivationof viral
infectivity during manipulation of the specimenmay contrib-ute tofailure toisolate virus.
The RT-PCR for detection of flavivirus RNA is approxi-mately 100 times more sensitive than an antigen capture assay (16). A major advantage of RT-PCR is that it can detect multiple flavivirus species in a single test, whereas
antibodycapture assaysarevirusspecific.The
technique
we havedevelopedhas severaladvantagesoverotherflavivirusPCR techniques and conventional methods. The entire
method can be completed within 24 h, in contrast to the several days required to culture andperform immunologic
identification. Asingle amplificationwith FGCamplimersis
required todetectflavivirusRNA. Asecond testusesVSS
amplimers to identify virus. Unlike amplimers that are located invirus structural genes, whicharesubjectto more intense selection pressures, amplimers designed for this
study hybridize with the highlyconserved NS5 gene
(11),
which encodes a postulated viral RNA polymerase (14).
Nucleotide sequenceanalysisofamplicons generated bythe FGCamplimerscanbeusedtoidentify previously unrecog-nized flaviviruses and to construct newVSS
amplimers
to facilitate virusidentification in RT-PCR. The ELISA format for detection ofamplicons offers increasedsensitivity
and ismorereliable than thehybridizationornested-PCR meth-ods.on May 15, 2020 by guest
http://jcm.asm.org/
REFERENCES
1. Calisher, C. H., N. Karabatsos, J. M. Dalrymple, R. E. Shope, J. S. Porterfield, E. G. Westerway, and W. E. Brandt. 1989. Antigenic relationships between flavivirusesasdetermined by cross-neutralizationtestswithpolyclonal antisera. J. Gen. Vi-rol. 70:37-43.
2. Deubel, V.,M.Laille,J.-P. Hugnot, E.Chungue,J.-L.Guesdon, M. T.Drouet,S. Bassot, and D. Chevrier.1990.Identification of DEN sequences by genomic amplification: rapid diagnosis of DEN virus serotype in peripheral blood. J. Virol. Methods 30:41-54.
3. Eldadah,Z.A., D. M. Asher, M. S. Godec, K. L. Pomeroy, L. G. Goldfarb, S. M. Feinstone, H. Levitan, C. J. Gibbs, Jr., and C. D. Gajdusek. 1991. Detection of flaviviruses by reverse-transcriptase polymerase chain reaction. J. Med. Virol. 33:260-267.
4. Erlich, H. A., D. H. Gelfand, and R. K. Saiki. 1988. Specific DNAamplification. Nature(London) 331:461-462.
5. Gubler, D.J.,G.Kuno, G. E.Sather,M.Valez, and A. Oliver. 1984.Mosquito cell cultures andspecific monoclonal antibodies in surveillance for DEN viruses. Am. J. Trop. Med. Hyg. 33:158-165.
6. Henchal, E. A., S. L. Polo, A. Vorndam, C. Yaemsiri, B. L. Innis, and C. H. Hoke. 1991. Sensitivity and specificity of a universal primer set for the rapid diagnosis of DEN virus infections by polymerase chain reaction and nucleic acid hybrid-ization.Am. J.Trop. Med. Hyg.45:418-428.
7. Howe, D. K., M. H.Vodkin,R.J. Novak, R. E. Shope, andG. L. McLaughlin.1992. Useof the polymerase chainreactionforthe sensitive detection of St. Louisencephalitisviral RNA. J.Virol. Methods 36:101-110.
8. Lanciotti,R. S.,C. H.Calisher,D.J.Gubler,G. J.Chang,and V. A. Vorndam. 1992. Rapid detection and typing of dengue
viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. J. Clin. Microbiol. 30:545-551. 9. Monath, T. P. 1990. Flaviviruses, p.763-814. In B. N. Fields
and D. N. Knipe (ed.), Fields virology,2nd ed. RavenPress, NewYork.
10. Morita, K., M. Tanaka, and A. Igarashi. 1991.Rapid identifica-tion ofDENvirusserotypesby using polymerase chain
reac-tion. J.Clin.Microbiol. 29:2107-2110.
11. Pletnev, A. G., V. F. Yamshchikov, and V. M. Blinov. 1990. Nucleotide sequence of the genome and complete amino acid sequence of the polyprotein of tick-borne encephalitis virus. Virology174:250-263.
12. Rice, C. M., E. M.Lenches,S. R.Eddy,S. J.Shin, R. L. Sheets, andJ. H. Strauss. 1985. Nucleotide sequenceofyellow fever virus: implications forflavivirusgeneexpression andevolution. Science229:726-733.
13. Robart, H. 1990.Enzymatic RNAamplificationof the
entero-viruses. J. Clin.Microbiol.28:438-442.
14. Saiki, R. K., D. H.Gelfand,S. Stoffel,S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primer-directedenzymatic amplification ofDNAwith a thermostable DNApolymerase.Science 239:487-491.
15. Trent, D. W., and G. J. Chang. 1992. Detectionand identifica-tion offlaviviruses by reversetranscriptase polymerase chain reaction,p.355-371.InY. Becker and C.Darai(ed.), Frontiers ofvirology, vol. 1.Diagnosis of human viruses by polymerase chainreactiontechnology. Springer-Verlag, Berlin.
16. Tsai, T. F.,C.M.Happ, R. A. Bolin, M. Montoya, E.Campos, D. B.Francy, R. A. Hawkes, and J. T.Roehrig.1988.Stability of St. Louis encephalitis viral antigen detected by enzyme immunoassay in infected mosquitoes. J. Clin. Microbiol. 26: 2620-2625.