• No results found

Supplementary Materials for

N/A
N/A
Protected

Academic year: 2021

Share "Supplementary Materials for"

Copied!
30
0
0

Loading.... (view fulltext now)

Full text

(1)

stm.sciencemag.org/cgi/content/full/13/578/eaaz8697/DC1

Supplementary Materials for

Extracellular vesicles deposit PCNA to rejuvenate aged bone marrow–derived

mesenchymal stem cells and slow age-related degeneration

Qian Lei, Fei Gao, Teng Liu, Wenxiang Ren, Li Chen, Yulin Cao, Wenlan Chen, Shaojun Guo, Qiong Zhang, Weiqun Chen, Hongxiang Wang, Zhichao Chen, Qiubai Li*, Yu Hu*, An-Yuan Guo*

*Corresponding author. Email: [email protected] (Q. Li); [email protected] (Y.H.); [email protected] (A.-Y.G.) Published 27 January 2021, Sci. Transl. Med. 13, eaaz8697 (2021)

DOI: 10.1126/scitranslmed.aaz8697 The PDF file includes:

Materials and Methods

Fig. S1. Age-associated BMSC senescence.

Fig. S2. UC-EV uptake by AB-MSCs and the effect of EVs on AB-MSCs. Fig. S3. UC-EVs rejuvenate the senescence of PCNA-knockdown AB-MSCs.

Fig. S4. Inhibition of PCNA activity in AB-MSCs by inhibitor (PCNA-I1), and UC-EVs reverse the senescence of PCNA-inhibited AB-MSC.

Fig. S5. UC-EVs promote osteogenic differentiation and attenuate adipogenic differentiation of AB-MSCs.

Fig. S6. UC-EV–treated AB-MSCs promoted revascularization and were not tumorigenic. Fig. S7. Effect of UC-EV administration in mice.

Table S1. Sequence of primers used for qPCR. Table S2. The samples of RNA-seq.

References (69–75)

Other Supplementary Material for this manuscript includes the following:

(available at stm.sciencemag.org/cgi/content/full/13/578/eaaz8697/DC1) Data file S1 (Microsoft Excel format). Individual subject-level data.

(2)

Materials and Methods

Transmission electron microscopy

EV samples (20 μl) were deposited on formvar-carbon-coated grids for 2 min and gently blotted on filter paper. Next, the grids were stained with 1% uranyl acetate solution for 2 min at room temperature and quickly washed with deionized water. After drying, the grids were examined in a Hitachi HT7800 transmission electron microscopy at 80 kV.

Nanoparticle tracking analysis

The size and concentration of EVs were measured by nanoparticle tracking using a NanoSight NS300 system equipped with a 405 nm laser and a scientific complementary metal-oxide semiconductor camera (sCMOS, NanoSight Ltd). Data acquisition and analysis using nanoparticle tracking analysis (NTA) software. EVs were isolated from 40 ml cell supernatant and resuspended in 100 µl particle-free PBS. Then, the sample of EVs was diluted in particle-free PBS and then measured at room temperature. The videos were recorded the Brownian motion of each particle, generating several parameters, such as concentration, mean and mode.

Western blotting

Cell and EV pellets were lysed with RIPA lysis buffer contained with protease inhibitor for 30 min on ice. BCA Protein Assay Kit was used to determine protein concentration. The samples were separated by 4%-20% SDS-PAGE followed by transferred onto polyvinylidene difluoride membranes (Millipore). Membranes were blocked with 5% non-fat dry milk for 1 h and incubated overnight at 4 ºC with the following primary antibodies: anti-Annexin A1 (Cell signaling Technology;

(3)

Cat#32934; 1:1000 dilution); anti-CD9 (Abcam; Cat#ab92726; 1:2000 dilution); anti-TSG101(Abcam; Cat#ab30871; 1:1000 dilution); anti-Alix (Abcam; Cat#ab76608; 1:1000 dilution); anti-PCNA (Cell signaling Technology; Cat#13110; 1:1000 dilution); anti-IL-6 (Abcam; Cat#ab6672; 1:500 dilution); anti-IL-8 (Abcam; Cat#ab18672; 1:500 dilution); anti-MCP-1 (Affinity; Cat#DF7577; 1:1000 dilution); anti-γH2AX (Cell signaling Technology; #9718; 1:1000 dilution). The membranes were incubated with horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibodies for 1 hour at room temperature. Signal was detected with enhanced chemiluminescent substrate (GE healthcare).

Tracking of UC-EV uptake

For colocalization studies, UC-EV labeling used PKH67 dye (Sigma-Aldrich) according to the manufacturer’s instruction. Briefly, the isolated UC-EVs were diluted using Diluent C from PKH67 kit, then PKH67 dye solution was added into each sample, mixed and kept at room temperature for 5 min. The reaction was stopped by adding EV-depleted fetal bovine serum (FBS, Gibco) and removal of redundant dyes by centrifugation. After washing twice with PBS, PKH67-labled UC-EVs were incubated with AB-MSCs at 37 ºC for 24 h. Cells were rinsed and stained with Golgi-, ER- and Lyso-Tracker Red (Beyotime), respectively, and visualized using a Zeiss LSM880 confocal microscope. Images were collected using the Zeiss Zen software. Fluorescence intensity was measured by ImageJ software. Pearson’s correlation

coefficient was calculated from randomly 10 regions of interest (69).

Flow cytometry

(4)

anti-human CD73 (BD Biosciences; 1:100 dilution), CD90 (BD Biosciences; 1:100 dilution), CD105 (BD Biosciences; 1:100 dilution), CD45 (BD Biosciences; 1:100 dilution) and isotype control for 20 minutes. Cells were washed three times with PBS and detected by FACSCalibur (BD Biosciences). Cell cycle distribution of AB-MSCs, FB-MSCs, AB-MSCsEV- and AB-MSCsEV+ were performed by flow cytometry using propidium iodide (PI) staining.

AB-MSC proliferation

Initially, 2 × 104 AB-MSCs were cultured in 12-well plates and treated with UC-EVs (2.5, 5 and 10 μg/ml; Dilution of UC-EVs using α-MEM medium) or an equal volume α-MEM medium (as control) once a day. After 3 days, the cells were collected and

counted under a microscope. Crystal violet staining was used to observe the morphological change of AB-MSCs.

Senescence-associated β-galactosidase (SA-β-Gal) staining assay

AB-MSCs were cultured in 6-well plates and fixed fixative solution for 30 min. After washing with PBS, AB-MSCs were stained with SA-β-Gal staining solution (Beyotime) and incubated overnight at 37ºC. Images were captured with an inverted microscope (Olympus), and positive cells were calculated with GraphPad Prism 6.0 Software.

Clonal formation assay

Initially, 1 × 103 AB-MSCs were seeded on 6-well plates and treated with UC-EVs (10 μg/ml) or equal volume α-MEM medium once a day for 2 weeks. Cells were washed and fixed with 4% paraformaldehyde for 15 min. Fixed cells were stained

(5)

with Giemsa staining, and colonies were counted under an inverted microscope.

5-Ethynyl-2’-deoxyuridine (EdU) assay

DNA synthesis was detected by Cell-Light EdU Apollo567 In Vitro Kit (Ribobio) according to the manufacturer’s instruction. AB-MSCs were cultured in 12-well plates and incubated with 50 μM EdU solution for 10 hours and washed with PBS for twice.

Then, cells were fixed with 4% paraformaldehyde for 30 min and neutralized with glycine for 5 min. After washing with PBS, cells were permeabilized with 0.5% Triton X-100 for 10 min. Cells were incubated with freshly prepared dyeing solution for 30 min in the darkness and gently shaken on the platform of a shaker. Cellular DNA were stained with Hoechst 33342 for 30 min, washed with PBS for 3 times and visualized using a fluorescence microscope.

Quantitative Real-time PCR (qPCR)

Total RNA was extracted from AB-MSCs using Trizol reagent (Invitrogen) according to the manufacturer’s instructions. About 1 μg RNA was reverse transcribed using the

ReverTra Ace qPCR RT Kit (TOYOBO). qPCR was performed using the SYBR Green PCR master mix using the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific Inc.). The specific primer sequences are displayed in table S1. GAPDH and β-actin were used as housekeeping genes. The values for telomere length

were normalized to the 36B housekeeping control.

Osteogenic differentiation

Osteoblast differentiation was induced using the osteogenic differentiation medium (Cyagen Biosciences Inc.) according to the manufacturer’s protocol. After 7 days,

(6)

AB-MSCs were washed with PBS, fixed in 4% formaldehyde at room temperature for 30 min, rinsed with PBS, and then stained with ALP staining solution (Solarbio) for 20 min at room temperature. Osteoblastic mineralization was verified by Alizarin red staining. Cells were cultured with osteogenic differentiation medium for 14 days. Cells were washed, fixed in 4% formaldehyde at room temperature for 30 min and then stained with Alizarin red solution (Cyagen Biosciences Inc.) for 5 min at room temperature. After washing with PBS, the cells were photographed with an inverted microscope. The expression of osteogenic gene was detected using qPCR.

Adipogenic differentiation

Adipogenic differentiation was induced using the adipogenic differentiation medium (Cyagen Biosciences Inc.) according to the manufacturer’s protocol. After 14 days,

cells were washed with PBS, fixed in 4% formaldehyde at room temperature for 30 min, rinsed with PBS, and then stained with Oil red solution for 30 min at room temperature. After washing with PBS, cells were photographed with an inverted microscope. Adipogenic gene expression was detected using qPCR.

RNA-seq data summary and analysis procedure

We performed RNA sequencing for 31 samples (table S2), and mRNA sequencing was performed with HiSeq2500 at BGI-Shenzhen, China. After filtering, clean reads were mapped to the human hg38 reference genome by STAR (Spliced Trans Alignment to a Reference). We normalized the gene expression by Fragments Per Kilobase of transcript per Million mapped reads (FPKM) with StringTie. Batch effects were removed by the removeBatchEffect tool from limma package when analyzing the repeated RNA-seq data.

(7)

Differentially expression and enrichment analysis for RNA-seq data

The differentially expressed gene cutoff was FPKM > 10, |fold change| > 1.5 and p value < 0.05. The cutoff for highly expressed gene was FPKM > 100. We also required FPKM > 100, |fold change| > 1.5 and p value < 0.05 for the highly differentially expressed gene. The enrichment analysis was performed on the Database for Annotation, Visualization and Integrated Discovery (DAVID) online server (https://david.ncifcrf.gov/).

Cell cycle and DNA repair expression analysis

We collected cell cycle and DNA repair related gene sets from Kyoto Encyclopedia of Genes and Genomes (KEGG) database (https://www.kegg.jp). We obtained the log2 fold change (UC-EVs vs. AB-EVs) of these gene sets, then applied R package ggplot2 to draw the fold change density of these gene sets. The distribution peak greater than 0 indicates the gene expression of the gene set in UC-EVs is upregulated compared to AB-EVs. We showed the heatmap of top 20 upregulated genes from cell cycle and DNA repair functional terms by the R package pheatmap.

The gene-gene interaction relationship for cell cycle and DNA repair related-genes expressed (FPKM > 10) in AB-MSCsEV+ was collected from STRING database (https://string-db.org/). We used the cytoscape software to draw and analyze the interaction network and CDK2, PCNA and CDK1 were the top 3 genes ranked by interaction degree. To perform activity analysis for pathways of cell cycle and DNA repair, we applied z-score to normalize the pathway activity with gene set variation analysis (GSVA) R package.

(8)

accumulated their core marker genes from Qiagen website (https://www.qiagen.com), which are less than KEGG pathways. To show the change in AB-MSCsEV+ by marker genes in heatmap, we applied R package pheatmap to draw the heatmap for the expressed marker genes (FPKM > 10).

Principal component analysis and aging-related gene analysis

We obtained the average gene expression values of AB-MSCsEV- samples, AB-MSCsEV+ samples and FB-MSCs. Then, we applied the “princomp” command in R to perform the principal components analysis (PCA), and applied R package ggplot2 to visualize the PCA result. To explore the expression change of aging related genes in AB-MSCsEV+, we collected aging related genes from GenAge database (https://genomics.senescence.info).

In vitro cell migration assay

The conditioned media (CM) of AB-MSCsEV- or AB-MSCsEV+ were harvested, centrifuged at 800 g for 10 min to remove cell debris, and filtered through 0.2 µm filters. Human umbilical vein cell line (EA.hy926) was seeded and cultured in DMEM medium supplemented with 10% FBS. When EA.hy926 cells reached confluence, cells were treated with 10 μg/ml mitomycin C for 2 h at 37°C. The mitomycin C treated cells were extensively washed in PBS and a scratch wound was created across each well using a p200 pipette tip. Then cells were cultured in Dulbecco modified eagle media (DMEM) supplemented with 50% CM from AB-MSCsEV- or AB-MSCsEV+ for another 24 and 48 h. The migration of cells into the “wound area” was photographed and measured by ImageJ software. The rate of migration was

(9)

represents the initial wound area and An represents the remaining wound area at the

measured time point.

In vitro tube formation assay

EA.hy926 cells (1 × 105) were seeded onto the Matrigel-coated wells of a 24-well plate and cultured in DMEM supplemented with 50% conditional medium of AB-MSCsEV- or AB-MSCsEV+. Tube formation in each group was examined after 8 h by an inverted phase-contrast microscopy. The number of meshes and the branching length were measured by ImageJ software.

Lentiviral transduction, siRNA knockdown and small molecule inhibitor treatment

To stably reduce the expression of PCNA in AB-MSCs, PCNA-targeted shRNA and control lentivirus were designed and synthesized by Genechem Co. Ltd (Shanghai, China). The targeting sequence of the shRNA was CGTATATGCCGAGATCTCA, and the Lentiviral vectors GV493-GFP-puro was used for plasmid construction and transfected into 293T cells with helper plasmids.After 48 h, culture supernatants were collected, filtered and concentrated by ultracentrifugation. For lentiviral-shRNA transduction, AB-MSCs were seeded in a 6-well plate and incubated with lentiviral-shRNA at a multiplicity of infection of 60 with HitransG P transfection reagent (cells were grown at a final confluence of 50%). Cells transduced with non-targeting shRNA serves as a control. After 12 h, viral supernatants were removed and the cells were washed with PBS. Cells were then replaced with fresh medium and continued culture for additional 60 h. Transduced cells were selected with 2 µg/ml puromycin. The knockdown efficiency of shRNA was confirmed by qPCR and

(10)

western blotting analysis. For UC-EV treatment, 4 × 104 shPCNA AB-MSCs were plated in a 6-well plate and cultured with complete medium, shPCNA + UC-EVs groups were treated with 10 μg/ml UC-EVs once a day for 3 days. Dilution of

UC-EVs using α-minimum essential medium (α-MEM). The shPCNA AB-MSCs groups were treated with equal volume α-MEM.

For siRNA knockdown of AB-MSCs, 4 × 104 AB-MSCs were plated in a 6-well plate and cultured with complete medium. After 24 h, the supernatants were removed and supplemented with fresh medium and transfected with PCNA siRNA (Ribobio, Guangzhou, China) at a final concentration of 50 nM according to the manufacturer’s instructions. After 12 h of transfection, the supernatants were removed and the cells were washed with PBS. Cells were then replaced with fresh medium. For UC-EV treatment, siPCNA + EVs groups were treated with UC-EVs once a day for 3 days after 12 h of transfection. Dilution of UC-EVs using α-MEM. The siPCNA AB-MSCs groups were treated with equal volume α-MEM. The efficiency of siRNA knockdown

was confirmed by qPCR and western blotting. The targeting sequence of the siRNA was GCCGAGATCTCAGCCATAT. Nontargeting control siRNA was used as control.

For UC-EV siRNA loading, UC-EVs were incubated with 50 nM PCNA-siRNA (Ribobio) for 8 h at 37℃ and washed with PBS via ultracentrifugation at 16,000 × g for 60 min (70-72). The loading efficiency of siRNA was confirmed by qPCR.

For small molecule inhibitor treatment, AB-MSCs were treated with PCNA inhibitors (PCNA-I1, Sigma-Aldrich) (73) at different concentrations of 0.25, 0.5 and 1µM for 24 h. After washing with PBS, cells were supplemented with fresh medium. The efficiency of PCNA-I1 was confirmed by western blotting.

To inhibit RNA transcription in target cells, AB-MSCs treated with Actinomycin D (ActD, 1μg/ml, Absin) (33) followed by indicated UC-EV treatment for 24 h. The

(11)

transfer of PCNA to target cells was detected by qPCR.

For RNase experiment, UC-EVs were treated with RNase for 3 h at 37 ºC and the reaction was stopped by addition of RNase inhibitor, then RNase treated-UC-EVs were washed twice with PBS by centrifugation (55, 74). Then RNase treated-UC-EVs (RNase-UC-EVs) were washed with PBS and centrifuged at 16,000g for 60 min at 4˚C. Next, PBS was removed and EV pellet was resuspended in FBS-free α-MEM

medium. In order to detect the effect of RNase digestion, we took out part of RNase-UC-EVs to extract RNA using TRIZOL reagent, the efficiency of RNase treatment was confirmed by Nanodrop (Thermo). The total extracted RNA was analyzed by Nanodrop (untreated: about 7.76 μg RNA/mg protein EV; RNase treated: < 1.2 μg RNA/mg protein EV). For RNase-UC-EV treatment experiments, 4 × 104 AB-MSCs were plated in a 6-well plate and cultured with complete medium. After 24 h, cells were treated with UC-EVs or RNase-UC-EVs once a day for 3 days.

Labeling of UC-EV RNA and membrane components using fluorescent dye

The SYTO RNASelect green fluorescent stain (Invitrogen) is cell-permeant nucleic acid stain that is selective for RNA and very efficiently labels the exosomal RNA cargo (75). The isolated UC-EVs were stained for 5 min in PKH26 dye and washed twice with PBS by centrifugation. The PKH26-labled UC-EVs resuspended in 100 µl of PBS and add SYTO RNASelect stock solution to the sample at a final dye concentration of 10 µM. After incubating at 37ºC for 20 min, the excess unincorporated dye was removed by centrifugation. After washing twice with PBS, the dye-stained UC-EVs were resuspended in medium. AB-MSCs were seeded into 6-well plate and incubated with PKH26-labeled UC-EVs at 37ºC for 12 h. After washing with PBS, micrographs were captured with a fluorescence microscopy.

(12)

UC-EV DiR labeling procedure

UC-EVs were incubated in 15 µL fluorescent dye DiR (Rengen Biosciences) for 30 minutes at 37ºC and then they were centrifuged at 16,000g for 1 hour at 4°C to abandon excess dye. Next, UC-EVs were washed twice with PBS and then resuspended in PBS for use freshly.

Micro-computed tomography analysis

Micro-computed tomography (µCT) was used for quantitative evaluation of microstructure. For ectopic bone formation assay, explants were removed from BALB/c nude mice after 2 months of implantation. Explants were fixed in 4% paraformaldehyde and analyzed using a high-resolution Bruker SkyScan 1176 microCT according to the scanning protocol (voltage of 40 kV, current of 600 µA and image pixel size of 9 µm). For mice injected with UC-EVs tail vein, the mice were anaesthetized and the right femora were analyzed by microCT (voltage of 50 kV, current of 500 μA and image pixel size of 9 μm). We defined the regions of interest were placed 0.215 mm from the distal growth plate and extended for 1.29 mm. The three-dimensional reconstruction was performed using the NRecon software (Bruker) and the parameters of trabecular bone volume fraction (BV/TV), bone surface to tissue volume ratio (BS/TV), trabecular number (Tb. N) and trabecular thickness (Tb. Th) were analyzed by CTAn software (Bruker).

Tartrate-resistant acid phosphatase (TRAP) staining

To analyze osteoclastic activities, 4 to 6-μm-thick longitudinally oriented right femur slices of mice were performed with TRAP staining. The paraffin embedded right

(13)

femur slices were de-waxed, rehydrated and washed. Then the bone sections were stained with TRAP using a leukocyte acid phosphatase kit according to the manufacturer's instructions. Finally, the slices were observed under a microscope and TRAP+ cells were counted using ImageJ software.

Terminal dUTP nick-end labeling (TUNEL) assay

The murine kidney tissue samples went through deparaffination and rehydration, after which antigen retrieval was performed by soaking in sodium citrate solution for 5 min at 98°C. Then the sections were incubated with 20 mg/ml proteinase K for 15 min at room temperature, subsequently incubated in the TUNEL reaction mixture (Roche) for 1 h at 37°C and soaked in TUNEL blocking solution for 5 min at room temperature. The renal tubular cell apoptosis index was taken as the apoptotic cell number (brown)/the total cell number (blue) × 100%.

Immunohistochemical staining

The samples (decalcified bone matrix scaffolds, Matrigel implants and bone) were fixed in 4% paraformaldehyde, dehydrated, embedded in paraffin. Then samples were routinely dewaxed and hydrated, followed by antigen retrieval in sodium citrate buffer at 98°C for 5 min and incubation in 3% hydrogen peroxide. After blocking with 10% goat serum at 37°C for 1 h, the sections were incubated with primary antibody at 4°C overnight and subsequently dipped in Horseradish Peroxidase (HRP)-labeled secondary antibody for 1 h. The following primary antibodies were used: anti-OCN

(Abcam; Cat#ab93876; 1:200 dilution), anti-OPN (Abcam; Cat#ab8448; 1:100

(14)

sections were stained with HRP-DAB detection kit and counterstained with hematoxylin.

(15)

Fig. S1. Age-associated BMSC senescence. (A) Bright-field micrographs and the number of

FB-MSCs (P7) and AB-MSCs (P7). The morphology of BMSCs were stained by crystal violet and the cell number were calculated by ImageJ (n = 3). Scale bars, 50 μm. P7: passage 7. (B)

(16)

Representative SA-β-Gal staining (blue) images and quantification of FB-MSCs (P7) and AB-MSCs (P7) observed under an inverted microscope (n = 3). Scale bars, 100 μm. (C) Representative EdU staining of FB-MSCs and AB-MSCs (n = 3). Scale bars, 100 μm. (D) Flow cytometry of cell cycle and the proportion of each cell cycle phase in FB-MSCs and AB-MSCs (n

= 3). (E) Representative western blot for IL-6, IL-8, MCP-1 and γ-H2AX is shown (P9). (F) Telomere length assessment by qPCR (n = 3). (G) Representative images of Alizarin Red staining of FB-MSCs (P7) and AB-MSCs (P7) were detected 14 days after initiating osteogenic differentiation. Scale bars, 100 μm. CM: complete medium; OIM: osteogenic induction medium.

(H) Representative images of Oil Red O staining of FB-MSCs (P7) and AB-MSCs(P7) after inducing adipogenic differentiation for 14 days. Scale bars, 50 μm. AIM: adipogenic induction

medium. (I) Venn graphs of the number of differentially expressed genes in FB-MSCs (681 upregulated) and AB-MSCs (305 upregulated) (Top), and the number of highly differentially expressed genes (FPKM > 100) in FB-MSCs and AB-MSCs (Bottom). (J) KEGG analysis of up-regulated genes in FB-MSCscompared with AB-MSCs. Data are presented as mean ± SD. **p < 0.01, ***p < 0.001 (A to D, and F) Student’s t test.

(17)

Fig. S2. UC-EV uptake by AB-MSCs and the effect of EVs on AB-MSCs. (A) Fluorescent

micrographs of AB-MSCs (P6) that have been incubated with PKH67-UC-EVs (green). The red channels represent endoplasmic reticulum (ER, top second column) or Golgi apparatus (Golgi, top far right). Scale bars, 10 μm. Intensity profiles (dashed lines) of high magnification of red boxed regions showing signals from the two fluorescent channels are plotted at the bottom. Scale bars,

(18)

1μm. The mean Pearson’s correlation coefficient (bottom right) was quantified using the ImageJ

software (10 regions of interest analyzed). (B) Flow cytometry of cell cycle and the proportion of each cell cycle phase of AB-MSCsEV- and AB-MSCsEV+ (P7) (n = 3). (C) Representative western blot for IL-6, IL-8, MCP-1 and γ-H2AX (P8). (D and E) Telomere length of AB-MSCs (P7) in the presence of AB-EVs (D) or the EV-depleted UC-MSC supernatant (EV-depleted sup) (E) (n = 3). Data are presented as mean ± SD.**p < 0.01, ***p < 0.001 (B, D and E) Student’s t test.

(19)
(20)

degree of protein-protein interaction network of Fig. 4A. (B) Expression of PCNA in FB-MSCs (P8) and AB-MSCs(P8) was analyzed by western blotting (n = 3). (C) Expression of PCNA in AB-MSCsEV- and AB-MSCsEV+ by RNA-seq (n = 4). (D) Expression of PCNA in AB-EVs and UC-EVs by RNA-seq (n = 3). (E) AB-MSCs (P5) transduced with lentiviruses expressing either shRNA of PCNA or control. The transfection efficiency was observed under fluorescence microscope 72 hours after lentiviral-PCNA-shRNA transduction. Scale bars, 100 μm. (F) Lentiviruses expressing either shRNA of PCNA (shPCNA) or control were transduced to AB-MSCs (P6), and the third group of shPCNA-treated AB-MSCs continued to be treated with UC-EVs for 3 days (shPCNA + UC-EVs). qPCR analysis of PCNA in AB-MSCs (Control), shPCNA AB-MSCs (shPCNA) and shPCNA + UC-EVs groups (n = 3). (G) Western blotting and semi-quantification analysis of PCNA in Control, shPCNA and shPCNA + UC-EVs (n = 3). (H) The transfection efficiency was observed under fluorescence microscope 24 h after Cy3 dye labeled-siRNA transfection. Scale bars, 100 μm. (I) qPCR analysis of PCNA in AB-MSCs (P7) (Control), siPCNA AB-MSCs (siPCNA) and UC-EV-treated-siPCNA AB-MSCs (siPCNA + UC-EVs) (n = 3). (J) Western blotting and semi-quantification analysis of PCNA in AB-MSCs (Control), siPCNA AB-MSCs (siPCNA) and siPCNA + UC-EVs (n = 3). (K) Proliferation of control (P8), siPCNA AB-MSC and siPCNA + UC-EVs (n = 4). Scale bars, 100 μm. (L) SA-β-Gal staining of control (P8), siPCNA AB-MSC and siPCNA + UC-EVs (n = 3). Scale bars, 100 μm. (M) EdU staining of control (P7), siPCNA AB-MSC and siPCNA + UC-EVs (n = 3). Scale bars, 100 μm. Data are presented as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001. (B) and (D) Student’s t test. (F, G and I to M) One-way ANOVA and Bonferroni's multiple comparisons.

(21)

Fig. S4. Inhibition of PCNA activity in AB-MSCs by inhibitor (PCNA-I1), and UC-EVs reverse the senescence of PCNA-inhibited AB-MSC. (A) AB-MSCs were treated with PCNA

(22)

analysis of AB-MSCs (control) and PCNA-inhibited AB-MSCs (P6) (n = 3). Scale bars, 100 μm. (B) AB-MSCs (P10) treated with PCNA-I1, and the third group of PCNA-I1-treated AB-MSCs continued to be treated with UC-EVs for 3 days (PCNA-I1 + UC-EVs). Western blotting and semi-quantification analysis of PCNA in AB-MSCs (Control), PCNA-I1-treated AB-MSCs (PCNA-I1) and PCNA-I1 + UC-EVs groups (n = 3). (C) Proliferation of PCNA-inhibited AB-MSCs (P10) treated with UC-EVs (n = 3). Scale bars, 100 μm. (D) EdU staining of UC-EV treatment effects on replicative potential of senescent PCNA-inhibited AB-MSCs (P8) (n = 3). Scale bars, 100 μm. (E) Cell cycle and DNA repair-related gene expression in AB-MSCs after

siPCNA, PCNA-I1 treatment, and UC-EV treatment (n = 2). (F) The expression of PCNA in UC-EVs and siRNA treated-UC-EVs (siPCNA-UC-EVs) (n = 3). (G) Proliferation of AB-MSCs (P7) treated with UC-EVs and siPCNA-UC-EVs and PCNA expression (n = 3). Scale bars, 100 μm. Data are presented as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001. (A to D and G)

(23)

Fig. S5. UC-EVs promote osteogenic differentiation and attenuate adipogenic differentiation of AB-MSCs. (A) Alizarin red staining (red, mineralized bone matrix) were detected 14 days after

initiating osteogenic differentiation (AB-MSCs: P8). EV treatment was given daily for 14 days in osteogenic induction media. Scale bars, 100 μm. (B) Expression of osteogenesis-related genes

(ALP, BMP2, RUNX2 and OCN) after initiating osteogenic differentiation for 14 days (n = 3). (C) Alizarin red staining of AB-MSCs (P6) (Control), shPCNA AB-MSCs (shPCNA) and shPCNA + UC-EVs. Scale bars, 100 μm. (D) Oil red O staining of AB-MSCs (P6) (Control), shPCNA AB-MSCs (shPCNA) and shPCNA + UC-EVs. Scale bars, 100 μm. (E) Alizarin red staining in AB-MSCs (P8) treated with UC-EVs or RNase-UC-EVs after initiating osteogenic differentiation for 14 days. Scale bars, 100 μm. (F) The expression of osteogenesis-related genes (BMP2 and

(24)

SD. *p < 0.05; **p < 0.01. (B) Student’s t test. (F) One-way ANOVA and Bonferroni's multiple comparisons

(25)

Fig. S6. UC-EV–treated AB-MSCs promoted revascularization and were not tumorigenic. (A)

Expression of VEGF, FGF2 and HGF in AB-MSCsEV- and AB-MSCsEV+ (n = 4). AB-MSCs 1 to 4, at the bottom of the heatmap, represent samples from 4 donors. (B) Macroscopic view of Matrigel plugs. The Matrigel plug was harvested 2 months after subcutaneous implantation in mice; macroscopic vessels were seen in the Matrigel plugs in the AB-MSCEV- and AB-MSCEV+ groups (P8). (C) Representative H&E staining images of control, AB-MSCEV- and AB-MSCEV+. Scale bars, 100 μm. (D) Representative images and quantification of CD31-positive cells in the Matrigel

plug from AB-MSCEV-and AB-MSCEV+ groups (n = 4). Scale bars, 100 μm. Data are presented as mean ± SD, *p < 0.05, Student’s t test.

(26)
(27)

Fig. S7. Effect of UC-EV administration in mice. (A) Body weight of two groups of mice was

recorded three times per week after PBS (n = 3) or UC-EVs (n = 5) injection. (B to D) Temperature (B), Heart rate (C) and Spinal curvature (D) were measured 4-weeks after UC-EV administration in UC-EV-treated mice (n = 5) and PBS vehicle controls (n = 3). Heart rate

represented as beats per minute (bpm). (E) Plasma IL-1α concentration in UC-EV-treated mice (n = 5) and PBS vehicle controls (n = 3). (F) Plasma IL-1β concentration in UC-EV-treated mice (n = 7) and PBS vehicle controls (n = 6). (G) Blood urea nitrogen concentration in UC-EV-treated mice (n = 7) and PBS vehicle controls (n = 6). (H) Creatinine concentration in UC-EV-treated mice (n = 5) and PBS vehicle controls (n = 3). (I to P) Histological analysis of indicated organs (Heart, Liver, Spleen, Skin, Stomach, Muscle, Lung and Brain) of aged mice upon UC-EVs administration and control groups. (I, J and L to P) Scale bars, 50 μm. (K) Scale bars, 200 μm. Data are presented as mean ± SD. *p < 0.05. (B to H) Student’s t test.

(28)

Table S1. Sequence of primers used for qPCR.

Gene Forward Reverse

ALP AACACCACCCAGGGGAAC TGGCATGGTTCACTCTCGT

RUNX2 AATGGTTAATCTCCGCAGGTC TTCAGATAGAACTTGTACCCTCTGTT

BMP2 CCAGCCGAGCCAACACTGTGC TCTCCGGGTTGTTTTCCCACTCG

OCN AGCAAAGGTGCAGCCTTTGT GCGCCTGGGTCTCTTCACT

FABP4 GGCCAGGAATTTGACGAAGT TTTCCATCCCATTTCTGCAC

PPAR-γ TGCAGTGGGGATGTCTCATA CAGCTGGTCGATATCACTGGA

LPL CCCTAAGGACCCCTGAAGAC GGTTTTGCTGCTGTGATTGA

PCNA GGGCTCCATCCTCAAGAA GCCAAGGTATCCGCGTTA

Telomere ACACTAAGGTTTGGGTTTGGGT TTGGGTTTGGGTTAGTGT TGTTAGGTATCCCTATCCCTATCCCT ATCCCTATCCCTAACA 36B CAGCAAGTGGGAAGGTGTAATC C CCCATTCTATCATCAACGGGTACAA

GAPDH CTCTGCTCCTCCTGTTCGACA ACGACCAAATCCGTTGACTC

(29)

Table S2. The samples of RNA-seq.

Sample Corresponding

figures

Mapped reads All reads Mapping rate

FB-MSCs-1 Fig. S1, I and J 48546015 50026037 97.01% FB-MSCs-2 64443790 64223288 99.66% AB-MSCs-1 57293488 59790488 95.81% AB-MSCs-2 60538068 60288800 99.59% AB-MSCs-3 71390259 71067366 99.55% UC-EVs-1 Fig. 1, H to J 55437911 59197142 93.64% UC-EVs-2 fig. S3D 67609980 67093381 99.24% UC-EVs-3 70179611 69314140 98.77% AB-EVs-1 45724313 49680516 92.04% AB-EVs-2 75979003 74718553 98.34% AB-EVs-3 73809352 71622216 97.04%

AB-MSCsEV--1 Fig. 3, A to F 70118708 72612927 96.57% AB-MSCsEV--2 Fig. 4A 69342424 66435318 95.81% AB-MSCsEV--3 fig. S3C 70780661 70425958 99.50% AB-MSCsEV--4 fig. S6A 65634525 65320206 99.52%

AB-MSCsEV+-1 64397060 66899226 96.26%

AB-MSCsEV+-2 70897332 68687989 96.88%

AB-MSCsEV+-3 65684569 65407481 99.58%

AB-MSCsEV+-4 68859313 68568560 99.58%

Control-1 fig. S4E 39199782 41048680 95.50%

Control-2 32312629 40906022 78.99%

PCNA-I1-1 41494440 43418668 95.57%

PCNA-I1-2 38718130 40478622 95.65%

PCNA-I1 + UC-EVs-1 43210898 45935146 94.07%

PCNA-I1 + UC-EVs-2 41368265 43389378 95.34%

(30)

Control-2 45611604 47713406 95.59%

siPCNA-1 40887811 42969900 95.15%

siPCNA-2 49950755 52461860 95.21%

siPCNA + UC-EVs-1 39183108 41142328 95.24%

References

Related documents

In conclusion, we can state that the proposed approximation method using Chebyshev wavelets can create an accurate RSSI fingerprint database for indoor

Thetraitfertile tillers per plant, unfilled grains per panicle and grain yield have great potential which may respond positively to selection owing to their better

Reliability (a) , MSE (b) , ensemble variance (c) and CRPSS (d) of global mean surface temperature without any correction (black line), after drift correction (red line)

The specific objective of the present study were: [a] to compare the cost of cultivation of wheat under zero- tillage and conventional method; [b] to analyse

Primary gastrointestinal lymphomas in Turkey: a retrospective analysis of clinical features and results of treatment. Gastrointestinal lymphoma in southern

The activities of the JRC Bangladesh include negotiation with coriparian countries on the development, management and sharing of water resources of common rivers,

Although the results of the study show a significant and positive correlation between job happiness and the 4 I‟s (I enjoy my work, I care about my health, I respect my colleagues,

The cellular mobilisation of mice with granulocyte colony-stimulating factor (G-CSF) results in an egress of haematopoietic stem/progenitor cells from the bone marrow and