0095-1137/07/$08.00⫹0 doi:10.1128/JCM.00842-06
Development of Multiplex Real-Time Reverse Transcriptase PCR Assays
for Detecting Eight Medically Important Flaviviruses in Mosquitoes
䌤
Day-Yu Chao,† Brent S. Davis, and Gwong-Jen J. Chang*
Arboviral Diseases Branch, Division of Vector-Borne Infectious Diseases, Centers for Disease Control and Prevention, Fort Collins, Colorado
Received 20 April 2006/Returned for modification 14 July 2006/Accepted 14 October 2006
A multiplex real-time reverse transcriptase PCR has been developed for the rapid detection and identifica-tion of eight medically important flaviviruses from laboratory-reared, virus-infected mosquito pools. The method used involves the gene-specific amplification of yellow fever virus (YFV), Japanese encephalitis virus (JEV), West Nile virus (WNV), St. Louis encephalitis virus (SLEV), and dengue virus (DENV) serotypes 1 to 4 (DENV-1 to DENV-4, respectively) by use of the flavivirus consensus amplimers located at the RNA-dependent RNA polymerase domain of nonstructural protein 5. Virus-specific amplicons were detected by four newly characterized TaqMan fluorogenic probes (probes specific for YFV, JEV, WNV, and SLEV) and four previously published probes specific for DENV-1 to -4 (L. J. Chien, T. L. Liao, P. Y. Shu, J. H. Huang, D. J. Gubler, and G. J. Chang, J. Clin. Microbiol. 44:1295-1304, 2006). This assay had a specificity of 100% and various sensitivities of at least 3.5 PFU/ml for YFV, 2.0 PFU/ml for JEV, 10.0 PFU/ml for WNV, and 10.0 PFU/ml for SLEV. Additionally, we have developed an in vitro transcription system to generate RNase-resistant RNA templates for each of these eight viruses. These templates can be incorporated into the assay as RNA copy number controls and/or as external controls for RNA-spiked mosquito pools for quality assurance purposes. Although further study with mosquitoes collected in the field is needed, the incorporation of this assay into mosquito surveillance could be used as an early-warning system for the detection of medically important flaviviruses, particularly when the cocirculation of multiple viruses in the same region is suspected.
Flaviviruses are significant causes of disease worldwide and can be classified serologically into several antigenic complexes (12, 20). Medically important members of the Japanese cephalitis virus (JEV) serocomplex include JEV, St. Louis en-cephalitis virus (SLEV), and West Nile virus (WNV). Each of these viruses causes similar disease syndromes in humans, ranging from an asymptomatic or a mild flu-like illness to clinical encephalitis (18). Until 1999, SLEV was the only mos-quito-borne flavivirus causing significant human morbidity and mortality in the United States (22). WNV, traditionally found in Europe, Africa, the Middle East, and Asia, emerged in New York City in the late summer of 1999 (1). By 2005 the distri-bution of WNV had expanded into areas of known recent SLEV activity, such as the states of Florida, Mississippi, Lou-isiana, Texas, Arizona, Colorado, and California (3). Mosquito surveillance for detection of virus activity during the transmis-sion season is an essential tool for implementation of an ef-fective mosquito control strategy. As WNV and SLEV occupy similar ecological niches in North America, it is critical to develop a cost-effective assay capable of detecting the presence of either one or both viruses simultaneously in the mosquito pools. In addition, dengue virus (DENV) serotypes 1 to 4 (DENV-1 to DENV-4, respectively), SLEV, and yellow fever virus (YFV) are endemic in Latin America (5). The situation is
further complicated by the detection of WNV activity in Mex-ico and Central America (3). Therefore, the development of a real-time, multiplex reverse transcriptase (RT) PCR platform for the simultaneous detection of viral RNA genomes in the Americas is crucial for supporting mosquito surveillance efforts and clinical diagnosis.
The RNA-dependent RNA polymerase (RdRp) domain, lo-cated at the carboxy terminus of nonstructural protein 5 (NS5),
is the most conserved coding region in theFlavivirusgenomes
(15, 16, 23). The consensus sequence primers (primers FU1 and CFD2; YFV genomic positions, nucleotide [nt] 8997 and nt 9233, respectively) have been used in our previous study for genetic characterization of this domain for all registered flavi-viruses (16). The nucleotide sequences flanked by these two primers were variable among the 72 aligned virus sequences. The potential to formulate a one-tube, multiplex TaqMan as-say for detection of DENV-1 to -4 was demonstrated in our previous publication (4). In the present study, we used this pair of consensus primers; further explored the variability of this region for the design of virus-specific probes; and optimized a multiplex RT-PCR for the simultaneous detection of viral RNA genomes of YFV, JEV, WNV, and SLEV from virus-containing cell culture supernatants. We examined the sensi-tivities and specificities of these four virus probes based on viral RNAs extracted from viruses of known titer. In addition to these four virus probes, we also included the previously described DENV-1 to -4 multiplex TaqMan assay (4) and de-veloped eight virus-specific, RNase-resistant in vitro-tran-scribed RNA templates for use as copy number and external RNA controls. These two real-time, one-tube, multiplex TaqMan assays were then used to detect RNAs extracted from the laboratory-reared, virus-inoculated mosquitoes.
* Corresponding author. Mailing address: Arboviral Diseases Branch, Division of Vector-Borne Infectious Diseases, Centers for Disease Con-trol and Prevention, 3150 Rampart Road, Fort Collins, CO 80521. Phone: (970) 221-6497. Fax: (970) 221-6476. E-mail: [email protected].
† Present address: Institute of Molecular Biology, Academia Sinica, Nankang, Taipei, Taiwan, Republic of China.
䌤Published ahead of print on 15 November 2006.
584
on May 16, 2020 by guest
http://jcm.asm.org/
TaqMan primers and probes. The RdRp domain at the carboxy-terminal one-third of NS5 is the most conserved
re-gion in theFlavivirusgenomes (16, 23). The flavivirus
consen-sus amplification primers (amplimers) and virus-specific probe sequences for WNV, JEV, SLEV, and YFV were located within this region (Fig. 1; Table 1). When these probes were designed, potential mismatched bases were taken into consid-eration by aligning the sequences of different strains of these
four different viruses available from the GenBank databases (data not shown). The DENV serotype-specific probes for the four different serotypes of DENV were included in this study
to detect DENV-1 to DENV-4 (4). The 5⬘
6-carboxyfluores-cein (FAM) reporter dye and 3⬘ black hole quencher 1
(BHQ1) thermoquench-labeled probes for YFV (YFVP), JEV (JEVP), WNV (WNVP), and SLEV (SLEVP) were used to optimize the assay. Amplimers (Table 1, mFU1 and CFD2) were synthesized by the CDC core facility, and the fluorogenic probes were synthesized by Operon Biotechnologies, Inc. (Huntsville, AL). After the evaluation of the specificities and sensitivities of YFVP, JEVP, WNVP, and SLEVP with a single dye, the probes were changed to four unique reporter dyes
(Texas Red, 4,4,7,2⬘,4⬘,5⬘,7⬘-hexachloro-6-carboxy-fluorescein
[HEX], FAM, and Cy5, respectively) for the multiplex appli-cation.
Viruses. Yellow fever virus strain 17D, JEV strain SA14-14-2, WNV strain NY99, SLEV strain MSI-7, DENV-1 strain Hawaii, DENV-2 strain 16681, DENV-3 strain H87, and DENV-4 strain H241 were propagated in C6/36 cells,
har-vested, aliquoted, and stored at ⫺70°C for later use. Virus
titers in the tissue culture fluid were determined by plaque assays with Vero cells in a six-well plate format with a double overlay of 2% agarose and 3% neutral red. The plaques were counted, and the units were converted to the numbers of PFU per milliliter.
Real-time TaqMan assay.Viral RNA was isolated by using
a QIAamp viral RNA kit (QIAGEN, Valencia, CA), and 10l
of the 50-l RNA eluate was used for amplification by a
one-step RT-PCR. For every assay, homologous viral RNA and water were included as positive and negative controls, respec-tively. The reactions were performed in a 96-well plate and were subjected to amplification in an iCycler IQ system (Bio-Rad Laboratories, Hercules, CA). The amplification and de-tection conditions were the same as those described previously (4), and the PCR amplification products were directly detected by monitoring the increase in fluorescence of a dye-labeled oligonucleotide probe.
Briefly, 10l of RNA isolated from the tissue culture fluid
or mosquito pool was mixed with 100 pmol of the mFU1 and
CFD2 amplimers (final concentration, 0.5M), 25 pmol each
of the virus-specific probes (final concentration, 0.2M), and
the mixture provided with the iScript one-step RT-PCR
ready-mix kit (Bio-Rad Laboratories) in a 50-l reaction volume.
The thermocycler program consisted of a 30-min RT step at 50°C, followed by 1 cycle of 95°C for 15 min to activate the
hot-startTaqenzyme and 45 cycles of 95°C for 15 s and 48°C
for 3 min with continuous fluorescence data collection. The 5⬘
nuclease TaqMan assay relies on the 5⬘exonuclease activity of
theTaqpolymerase to free the reporter dye in the quenched
probe. The accumulation of the amplified PCR product is proportional to an exponential increase in the fluorescence
emitted from the freed reporter dyes (⌬Rn). The detection
threshold (CT) is the cycle number at which the amplification
curve crossed the threshold determined by the average of the
⌬Rnof the samples between cycles 2 and 10. TheCTvalue used
to estimate the copy number of the initial viral template should remain within the range of linearity of a standard curve with a
minimum correlation coefficient of 0.98. LowerCTvalues
[image:2.585.44.284.64.516.2]cor-respond to higher copy numbers of the initial viral template,
FIG. 1. Multiple-nucleotide-sequence alignment of the YFV group, the DENV group, and the JEV group. The aligned region corresponds to nucleotides 8997 to 9258 of YFV. The 50% majority consensus sequence is listed as the reference to highlight the conservation of this region. In addition to the eight viruses used in this study, viruses in the YFV group (Sepik virus [SEPV], Yokose virus [YOKV] group, and Entebbe bat virus [ENTV] group) and the JEV group (Murray Valley encephalitis virus [MVEV] and Usutu virus [USUV]) are aligned with the respective virus group. The flavivirus consensus amplimers (amplimers mFU1 and CFD2) and eight virus-specific probes are highlighted in bold-face and italic.
on May 16, 2020 by guest
http://jcm.asm.org/
and aCTvalue of 42 or more cycles is considered a negative
result.
In vitro-transcribed RNA controls. In order to develop a reliable, quantitative, safe, and stable standard, we used the in vitro-transcribed RNA as the copy number control. These tem-plates were developed by amplifying YFV, JEV, WNV, SLEV, and DENV-1 to -4 with the flavivirus consensus primers (prim-ers mFU1 and CFD2) by using a Titan one-tube RT-PCR kit (Roche Diagnostics, Indianapolis, IN). The resulting PCR products were cloned into a pCR-II-TOPO vector (Invitrogen Corp., Carlsbad, CA), and the orientation of the correct se-quences within the recombinant plasmids was determined by nucleotide sequencing. The positive- or negative-sense RNA (depending upon the orientation of the insert in the pCR-II-TOPO vector) was transcribed with either T7 or SP6 RNA polymerase by using AmpliScribe or DuraScribe T7/SP6 tran-scription kits (Epicenter, Madison, WI), according to the man-ufacturer’s protocol. The RNase-sensitive or -resistant tem-plates were produced by incorporating ATP, CTP, UTP, and
GTP or replacing the CTP and UTP with 2⬘-fluorine-dCTP
(2⬘-F-dCTP) and 2⬘-fluorine-dUTP (2⬘-F-dUTP), respectively.
The resulting RNAs were treated with DNase I to remove the DNA templates, purified with an RNA column (QIAGEN), quantified by spectrophotometry, and expressed as the copy numbers/ml. The sizes of the in vitro runoff transcripts were 365 and 371 nucleotides for the transcripts derived from the SP6 and T7 promoters, respectively, both of which contain 266 bases of virus-specific sequence, as shown in Fig. 1.
Mosquito inoculation. Female Aedes aegypti (Puerto Rico strain) were infected with YFV and DENV-1 to -4 and female
Culex pipienswere infected with JEV, WNV, and SLEV by intrathoracic injection. The infected mosquitoes were kept at 28°C for 7 days before they were harvested. The infected mos-quitoes were pooled with uninfected mosmos-quitoes at ratios of 1:25 and 1:50, with a maximum of 50 mosquitoes per pool, and
were stored at⫺70°C until they were tested. The pools were
homogenized in an MM300 mixer mill (QIAGEN) at 25 Hz for 5 min in the presence of 1 ml BA-1 (Dulbecco minimal essen-tial medium with 3% bovine serum albumin) diluent and one
3-mm sterilized tungsten-carbide bead. The uninfected A.
aegyptiandC. pipiensmosquito controls and an extraction control consisting of 1 ml cold BA-1 diluent were processed in parallel
with each batch of samples. RNA was extracted from 140l of
the supernatants from each homogenized sample by using a
QIAamp viral RNA kit (QIAGEN), eluted in 50l of elution
buffer according to the manufacturer’s protocol, and stored at
⫺70°C before it was tested.
Mosquito-spiked external positive controls.In order to test whether the in vitro-transcribed RNase-resistant templates could be used as external positive controls, the uninfected
mosquito pools of 25 or 50 mosquitoes from bothA. aegypti
andC. pipienswere homogenized in the presence of 1 ml BA-1
diluent. Mixtures of 140l of supernatant from each
homog-enized sample and 10 l of 10-fold serial dilutions of the
RNase-sensitive or -resistant template with copy numbers ranging from 1 to 10,000,000 for YFV, JEV, WNV, and SLEV were subjected to RNA extraction. The final extracts were
eluted in 50l for testing.
Sensitivity and specificity evaluation. The sensitivities and specificities of the real-time RT-PCR assays for YFV, JEV, WNV, and SLEV were evaluated by testing FAM-labeled vi-rus-specific probes against a known virus panel, including
WNV (titer, 1.0⫻108 PFU/ml), JEV (titer, 2.0⫻107PFU/
ml), YFV (titer, 3.5⫻107PFU/ml), and SLEV (titer, 1.0⫻108
PFU/ml). The detection threshold of each assay was deter-mined by using 10-fold serial dilutions of RNA extracted from these stock viruses. The assay sensitivities were 3.5 PFU/ml for
YFV (CT ⫽ 40.8), 2.0 PFU/ml for JEV (CT ⫽ 39.8), 10.0
PFU/ml for WNV (CT⫽40.6), and 10.0 PFU/ml for SLEV
(CT⫽41.6). We also tested the specificity of the probe by use
of the flavivirus study panel, which consisted of YFV, JEV, WNV, SLEV, and DENV-1 to -4. Each probe was tested against eight different viral RNAs, and only homologous viral RNA templates extracted from the stock virus were detected. For instance, the YFV-specific probe detected only YFV RNA and did not detect the other seven flaviviruses in the test panel. We then replaced the single fluorophore (FAM) dye in the four virus-specific probes with Texas Red for the YFV-specific probe, Cy5 for the SLEV-specific probe, HEX for the JEV-specific probe, and FAM for the WNV-JEV-specific probe (Table 1). The four-color multiplex RT-PCR was performed under the same conditions as the single-dye assay with FAM. Again, the mixed four-color probes were tested against eight different viral RNAs, and the specificities were 100%, with only the homologous viral RNA detected in the multiplex assay. No cross-talking between different signal channels was observed in the multiplex assay. The detection sensitivities and specificities were compatible for the single-dye and multiplex assays (Fig.
2). The correlation coefficient of theCTvalue versus the input
[image:3.585.44.536.81.180.2]virus titer (in PFU) was as high as 0.99 for the four different
TABLE 1. Oligonucleotide amplimers and probes used in the TaqMan RT-PCR
Oligonucleotide Identification Specificity Sequence (5⬘–3⬘) Tm
a
(o
C)
5⬘Reporter
3⬘Quencher Single Multiplex
Amplimer mFU1 Flavivirus TACAACATGATGGGAAAGCGAGAGAAAAA CFD2 Flavivirus GTGTCCCAGCCGGCGGTGTCATCAGC
Probe WNVP WNV TGCGTGAAGTTGGCACCCGGCCT 62 FAM FAM BHQ1
YFVP YFV TCAGAGACCTGGCTGCAATGGATGGT 61 FAM Texas Red BHQ2
SLEVP SLEV TGCAAGAAATCTCCCAAATCCCAGGAGGA 60 FAM CY5 BHQ3
JEVP JEV TCCGTGACATAGCAGGAAAGCAAG 57 FAM HEX BHQ1
aT
m, melting temperature.
on May 16, 2020 by guest
http://jcm.asm.org/
viruses in duplicate experiments. These results indicate that these newly developed real-time RT-PCR assays are highly
effective, with a linear dynamic range of detection of 101to 107
PFU/ml.
Comparison of in vitro-transcribed RNase-resistant and RNase-sensitive template as copy number control.The mini-mum detection threshold of a TaqMan assay, expressed as the
CTvalue, correlates with the copy numbers of the nucleic acid
templates in the assay specimens, which in this case is the copy number of the reverse-transcribed cDNA from template viral RNA. The quantitative relationship between the infectivity measured by PFU and the true copy number of the viral RNA in the virus seed culture is usually unknown. In addition, re-agent preparation and sample handling must be carried out with extreme care to prevent RNase contamination, which may result in RNA degradation. Thus, it is challenging to develop a reliable and reproducible copy number control for real-time RT-PCR assays. In this study, we prepared the RNase-resistant positive- or negative-sense RNA copies by incorporating
RNase A-resistant 2⬘-F-dCTP and 2⬘-F-dUTP bases into the
templates by in vitro transcription with recombinant plasmids containing the viral sequences amplified with primers mFU1 and CFD2. To determine the ability of our multiplex assay to detect the RNase-resistant templates, the RNase-sensitive templates were transcribed and used in the side-by-side study for comparison. Again, the probe detected only the homolo-gous, in vitro-transcribed RNA templates, regardless of their orientations. Our assay had an identical sensitivity of detecting
the positive- or negative-sense RNase-resistant templates (104,
103, 103, and 104copies of RNA per reaction mixture for YFV,
JEV, WNV, and SLEV, respectively). Interestingly, the assay consistently showed a 1-log-unit difference between detecting RNase-resistant and RNase-sensitive RNA. The minimum
de-tection thresholds were 103, 102, 102, and 103copies of
RNase-sensitive RNA per reaction for YFV, JEV, WNV, and SLEV, respectively (Table 2).
RNase-resistant template as positive external control.The RNase-sensitive templates were rapidly degraded by the pres-ence of RNase in the homogenized mosquito preparation (data not shown). Thus, we chose to use the positive-sense RNase-resistant-template-spiked mosquito supernatants as an external control to monitor RNA extraction, RT-PCR, and possible enzyme inhibition. Similar detection sensitivities were observed for the same RNA template spiked with the 25- or the 50-mosquito pool and the RNA-template-spiked water control in the assay without enzyme inhibition (Table 2). These results suggest that the in vitro-transcribed RNase-resistant template can be used as an external control for the detection of flaviviruses in mosquito pools.
Detection of eight different viruses in mosquito pools.The feasibility of using multiplex probe assays for the detection of eight different flaviviruses was tested via two assays. One assay was designed to detect virus in a pool of mosquitoes infected with any combination of YFV, JEV, WNV, and SLEV; the other assay was designed to detect virus in a pool of mosqui-toes experimentally infected with any combination of DENV1, -2, -3, and -4. The assays were able to detect 1 virus-positive mosquito among 25 or 50 uninfected mosquitoes for eight different viruses without any observable false-negative results or cross-contamination.
Discussion.The emergence of flaviviruses has become an im-portant issue of great public health concern due to the recent incursion and continued transmission of WNV in the Americas and JEV in Oceania (9, 19). Sporadic cases of encephalitis, like those caused by the enzootic flaviviruses, require effective surveil-lance programs to identify areas of transmission and to enable the immediate implementation of procedures aimed at reducing transmission to humans, including vector control and vaccination. In this study, we successfully developed a multiplex TaqMan RT-PCR assay that simultaneously detected four different flavivi-ruses, including YFV, JEV, WNV, and SLEV, in a one-tube reaction. This assay has proven specific and sensitive and de-creases the risks of laboratory contamination.
Compared to the single-dye real-time assay, this multiplex platform reduces labor and reagent costs. More importantly, this and our previous studies demonstrate the potential for formulating a unified platform, based on the flavivirus consen-sus amplimers and virus-specific probes located at the RdRp domain of the NS-5 gene, for detection of the presence of any one or a combination of four different viral RNAs in a
single-FIG. 2. Performance of the TaqMan RT-PCR assay for detection of four different flaviviruses in a single-dye or four-dye multiplex for-mat. The detection thresholds, expressed asCTvalues representative of the two experiments, are plotted against the log of a known infec-tivity (PFU per reaction) of YFV, JEV, WNV, and SLEV in four-tube, single-dye probe assays (A) or in a one-tube, four-color multiplex probe assay (B).
on May 16, 2020 by guest
http://jcm.asm.org/
[image:4.585.45.286.71.411.2]tube reaction. Other published studies have used either four different reactions in four separate reaction tubes (2, 6, 11, 13) or a two-color reaction in one tube (10, 21, 24, 25). The re-placement of a fluorescent light quencher, such as
6-carboxy-N,N,N⬘,N⬘-tetramethylrhodamine, with a nonfluorescent
ther-moquencher (BHQ) allows the fluorescent reporters to use greater regions of the spectrum, thus allowing additional re-porters to be incorporated into additional probes specific for additional viral RNA types. The same fluorescence combina-tion format has been applied for deteccombina-tion of DENV-1 to -4 in serum specimens from patients with dengue fever (4, 14). The combination of universal primer pairs with four virus-specific probes simplifies the optimization step (4; this study); in con-trast, other multiplex designs require four unique primer pairs and four different probes (2, 14).
Another significant improvement is the development of an in vitro-transcribed RNase-resistant RNA template for use as the copy number control. This template control avoids both the haz-ards of handling infectious viruses and the difficulty in converting the numbers of PFU into reliable RNA copy numbers. Generally, RNA copy numbers were about 1,000 to 3,000 per 1 PFU in our study; however, converting infectivity (PFU) to an RNA copy
number contains a level of uncertainty exacerbated by differences among virus strains, tissue culture conditions, and the length of time that the virus was stored. In addition, viral RNA is labile and is subject to rapid degradation by the presence of RNase and by storage duration and/or conditions. Consequently, the use of RNA extracted from virus-infected culture material is often un-reliable, in particular among different laboratories. The use of in vitro-transcribed RNase-resistant RNA templates reduces the problems associated with the handling of RNA and allows reli-able quantification. The sensitivity of the real-time RT-PCR assay in amplifying an in vitro-transcribed RNase-resistant RNA tem-plate was independent of the virus species, although assays with RNase-resistant RNA templates were consistently shown to re-quire a 1-log-unit higher copy number than assays with an in vitro-transcribed RNase-sensitive RNA template. This difference may be due to the reduced enzymatic ability of the RT enzyme to convert the RNase-resistant RNA templates to cDNAs.
Another advantage of our in vitro-transcribed RNase-resistant RNA templates is their ability to be incorporated as positive external controls for viral RNA extraction from mosquito pools. Routine mosquito surveillance necessitates quality control to en-sure the validity of the method as well as the detection of
false-TABLE 2. Comparison of sensitivities and specificities of TaqMan one-step RT-PCR assay with the in vitro transcribed RNA and spiked 25- or 50-mosquito pools
Sample Quantity
(no. of copies/reaction)
AvgCTa
RNase-sensitive template
RNase-resistant template
RNase-resistant template spiked 25-mosquito pools
RNase-resistant template spiked 50-mosquito pools
YFV 10,000,000 22.59 28.88 29.18 29.02
1,000,000 27.29 33.08 33.25 33.08
1,00,000 32.06 37.46 37.59 37.46
10,000 36.10 40.54 41.04 41.54
1,000 40.17 NA ND ND
100 NA NA ND ND
10 NA NA ND ND
1 NA NA ND ND
JEV 10,000,000 19.37 23.54 24.14 24.00
1,000,000 24.91 28.00 28.79 28.56
100,000 28.01 32.46 33.12 33.69
10,000 32.18 37.01 37.81 38.01
1,000 36.78 41.12 ND ND
100 40.52 NA ND ND
10 NA NA ND ND
1 NA NA ND ND
WNV 10,000,000 10.92 21.74 22.14 22.52
1,000,000 15.55 26.03 26.20 27.00
100,000 20.01 30.22 30.81 31.26
10,000 24.96 34.92 35.32 35.98
1,000 29.37 39.21 ND ND
100 37.02 NA ND ND
10 NA NA ND ND
1 NA NA ND ND
SLEV 10,000,000 18.78 26.12 27.00 27.61
1,000,000 23.44 30.74 31.42 31.74
100,000 27.97 35.10 35.90 36.10
10,000 32.54 39.58 40.08 40.02
1,000 37.07 NA ND ND
100 NA NA ND ND
10 NA NA ND ND
1 NA NA ND ND
a
AverageCTfor triplicate reactions. NA, data beyond detection limit; ND, not done.
on May 16, 2020 by guest
http://jcm.asm.org/
[image:5.585.45.540.89.449.2]negative results due to a potential failure during RNA extraction or the presence of residual enzymatic inhibitors in mosquito ex-tracts. Traditional methods of using external quality assurance in PCR detection methods are accomplished by spiking mosquito samples with live viruses of known infectivity. Live viruses are not stable at room temperature and increase the likelihood of false-positive results due to cross-contamination (17). Armored RNA is formed by the assembly of bacteriophage coat proteins around a transcribed RNA target to form pseudoviral particles of defined target sequences, which stabilizes the RNA transcripts and which protects them from nuclease degradation. Although we have not conducted a side-by-side study due to template incompatibility, our in vitro-transcribed RNase-resistant template is expected to perform as well as the “armored RNA” product (Ambion, Inc., Austin, TX) (7). However, the simplicity of preparing an RNase-resistant RNA template should permit the routine application of this methodology in laboratories so that they may develop their own copy number control to monitor the processes of RNA ex-traction and detection of flaviviruses and other single-stranded RNA viruses as well.
Sequence similarity calculations revealed that the genes en-coding NS5 are the most conserved regions in the en-coding region of the flavivirus genome. The viability of using this region for the development of a real-time, multiplex RT-PCR to detect various flaviviruses has been demonstrated in this study for the detection of YFV, WNV, JEV, SLEV, and DENV-1 to -4 in virus-infected mosquito pools. We have also demonstrated the feasibility of this platform for use for the detection of DENV-1 to -4 in serum specimens from patients with dengue fever (4). The use of flavivirus-consensus am-plimers (primers mFU1 and CFD2) and virus-specific probes has great potential to differentiate virus species within a geo-graphic region. For example, flaviviruses, including DENV-1 to -4, SLEV, YFV, Bussuquara virus (BSQV), Cacipacore vi-rus, Iguape virus (IGUV), Ilheus vivi-rus, and Rocio virus (ROCV), have been isolated from mosquitoes, animals, and/or humans in Brazil (5, 8). Ideally, in Brazil the relevant probe combinations would include YFV and DENV-1 to -4 in one five-color multiplex assay and WNV, SLEV, ROCV, BSQV, and IGUV in a second five-color multiplex assay. We have shown the specificities of the probes for YFV, DENV-1 to -4, WNV, and SLEV, while in Brazil, ROCV-, BSQV-, and IGUV-specific probes were 100% virus IGUV-specific in detecting viral RNA extracted from virus seeds (data not shown). Recent improve-ments in instrument design, such as those found in the Bio-Rad iCycler IQ-5 system, may provide an opportunity for the de-velopment of various fiveplex assays based on five-probe com-binations for the detection of various flaviviruses. These assays would be well suited for routine mosquito surveillance and clinical diagnosis.
Day-Yu Chao’s training grant for the development of this study was provided by the Division of Vector-Borne Infectious Diseases, Centers for Disease Control and Prevention.
We thank Sherrie Vander Vliet and Nicole Trainor for editorial comments.
REFERENCES
1.Anderson, J. F., T. G. Andreadis, C. R. Vossbrinck, S. Tirrell, E. M. Wakem, R. A. French, A. E. Garmendia, and H. J. Van Kruiningen.1999. Isolation of West Nile virus from mosquitoes, crows and a Cooper’s hawk in Connecticut. Science286:2331–2333.
2.Callahan, J. D., S.-J. L. Wu, A. Dion-Schultz, B. E. Mangold, L. F. Peruski, D. M. Watts, K. R. Porter, G. R. Murphy, W. Suharyono, C.-C. King, C. G. Hayes, and J. J. Temenak.2001. Development and evaluation of serotype-and group-specific fluorogenic reverse transcriptase PCR (TaqMan) assays for dengue virus. J. Clin. Microbiol.39:4119–4124.
3.Centers for Disease Control and Prevention.2005. Update: West Nile virus activity—eastern United States, 2005. Morb. Mortal. Wkly. Rep.54:1105– 1106.
4.Chien, L. J., T. L. Liao, P. Y. Shu, J. H. Huang, D. J. Gubler, and G. J. Chang.2006. Development of real-time reverse transcriptase PCR assays to detect and serotype dengue viruses. J. Clin. Microbiol.44:1295–1304. 5.de Morais Bronzoni, R. V., F. G. Baleotti, R. M. R. Nogueira, M. Nunes, and
L. T. M. Figueiredo.2005. Duplex reverse transcription-PCR followed by nested PCR assays for detection and identification of Brazilian alphaviruses and flaviviruses. J. Clin. Microbiol.43:696–702.
6.Drosten, C., S. Gottig, S. Schilling, M. Asper, M. Panning, H. Schmitz, and S. Gunther.2002. Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR. J. Clin. Microbiol.40:2323–2330.
7.Eisler, D. L., A. McNabb, D. R. Jorgensen, and J. L. Isaac-Renton.2004. Use of an internal positive control in a multiplex reverse transcription-PCR to detect West Nile virus RNA in mosquito pools. J. Clin. Microbiol.42:841– 843.
8.Figueiredo, L. T. M.2000. The Brazilian flaviviruses. Microbiol. Immunol. 2:1–7.
9.Hayes, E. B., J. J. Sejvar, S. R. Zaki, R. S. Lanciotti, A. V. Bode, and G. L. Campbell.2005. Virology, pathology, and clinical manifestations of West Nile virus disease. Emerg. Infect. Dis.11:1174–1179.
10.Hindiyeh, M., V. Levy, R. Azar, N. Varsano, L. Regev, Y. Shalev, Z. Gross-man, and E. Mendelson.2005. Evaluation of a multiplex real-time reverse transcriptase PCR assay for detection and differentiation of influenza viruses A and B during the 2001–2002 influenza season in Israel. J. Clin. Microbiol. 43:589–595.
11.Houng, H.-S. H., R. C.-M. Chen, D. W. Vaughn, and N. Kanesa-Thasan. 2001. Development of a fluorogenic RT-PCR system for quantitative iden-tification of dengue virus serotypes 1–4 using conserved and serotype-specific 3⬘noncoding sequences. J. Virol. Methods95:19–32.
12.Iacono-Connors, L. C., and C. S. Schmaljohn.1992. Cloning and sequence analysis of the genes encoding the nonstructural proteins of Langat virus and comparative analysis with other flaviviruses. Virology188:875–880. 13.Ito, M., T. Takasaki, K.-I. Yamada, R. Nerome, S. Tajima, and I. Kurane.
2004. Development and evaluation of fluorogenic TaqMan reverse transcrip-tase PCR assays for detection of dengue virus types 1 to 4. J. Clin. Microbiol. 42:5935–5937.
14.Johnson, B. W., B. J. Russell, and R. S. Lanciotti.2005. Serotype-specific detection of dengue viruses in a fourplex real-time reverse transcriptase PCR assay. J. Clin. Microbiol.43:4977–4983.
15.Kuno, G.1998. Universal diagnostic RT-PCR protocol for arboviruses. J. Virol. Methods72:27–41.
16.Kuno, G., G.-J. J. Chang, K. R. Tsuchiya, N. Karabatsos, and B. C. Cropp. 1998. Phylogeny of the genusFlavivirus. J. Virol.72:73–83.
17.Lemmer, K., O. Donoso Mantke, H.-G. Bae, J. Groen, C. Drosten, and M. Niedrig.2004. External quality control assessment in PCR diagnositics of dengue virus infections. J. Clin. Virol.30:291–296.
18.Lindenbach, B. D., and C. M. Rice.2001.Flaviviridae: the viruses and their replication, p. 991–1110.InD. M. Knipe and P. M. Howley (ed.), Fields’ virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, PA. 19.Mackenzie, J. S., C. A. Johansen, S. A. Ritchie, A. F. van den Hurk, and R. A.
Hall.2002. Japanese encephalitis as an emerging virus: the emergence and spread of Japanese encephalitis virus in Australasia. Curr. Top. Microbiol. Immunol.267:49–73.
20.Murphy, F. A., C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo, and M. D. Summers.1995. Virus taxonomy, classification and nomenclature of viruses. Arch. Virol.10(Suppl.):1–586. 21.Pyke, A. T., I. L. Smith, A. F. van den Hurk, J. A. Northill, T. F. Chuan, A. J.
Westacott, and G. A. Smith.2004. Detection of Australasian Flavivirus encephalitic viruses using rapid fluorogenic TaqMan RT-PCR assays. J. Vi-rol. Methods117:161–167.
22.Reisen, W. K.2003. Epidemiology of St. Louis encephalitis virus. Adv. Virus Res.61:139–183.
23.Scaramozzino, N., J.-M. Crance, A. Jouan, D. A. Debriel, F. Stoll, and D. Garin.2001. Comparison ofFlavivirusuniversal primer pairs and develop-ment of rapid, highly sensitive heminested reverse transcription-PCR assay for detection of flaviviruses targeted to a conserved regions of the NS5 gene sequences. J. Clin. Microbiol.39:1922–1927.
24.van Elden, L. J., M. Nijhuis, P. Schipper, R. Schuurman, and A. M. van Loon.2001. Simultaneous detection of influenza viruses A and B using real-time quantitative PCR. J. Clin. Microbiol.39:196–200.
25.Warrilow, D., J. A. Northill, A. Pyke, and G. A. Smith.2002. Single rapid TaqMan fluorogenic probe based PCR assay that detects all four dengue serotypes. J. Med. Virol.66:524–528.