Four different mutations in codon 28 of alpha
spectrin are associated with structurally and
functionally abnormal spectrin alpha I/74 in
hereditary elliptocytosis.
T L Coetzer, … , J Manaster, J Palek
J Clin Invest.
1991;
88(3)
:743-749.
https://doi.org/10.1172/JCI115371
.
Hereditary elliptocytosis (HE) Sp alpha I/74 is a disorder associated with defective spectrin
(Sp) heterodimer self-association and an abnormal tryptic cleavage of the 80-kD alpha I
domain of Sp resulting in increased amounts of a 74-kD peptide. The molecular basis of this
disorder is heterogeneous and mutations in codons 28, 46, 48, and 49 (codons 22, 40, 42,
and 43 in the previous nomenclature which did not include the six NH2-terminal amino
acids) have been reported. In this study we present data on seven unrelated HE Sp alpha
I/74 kindred from diverse racial backgrounds in whom we identified four different mutations
all occurring in exon 2 of alpha Sp at codon 28. Utilizing the polymerase chain reaction we
established a CGT----CTT; Arg----Leu 28 mutation in one kindred of Arab/Druze origin. In
two unrelated white kindred of English/European origin the substitution is CGT----AGT;
Arg----Ser 28 and in two apparently unrelated white kindred from New Zealand, the mutation is
CGT----TGT; Arg----Cys 28. Finally, in one American black kindred and in a black kindred
from Ghana the mutation involves CGT----CAT; Arg----His 28. Allele specific oligonucleotide
hybridization confirmed that the probands are heterozygous for the respective mutant
alleles. All four point mutations abolished an Aha II restriction enzyme site which allowed
verification of linkage of the mutation with HE Sp alpha I/74. Our results […]
Research Article
Find the latest version:
Four Different
Mutations
in
Codon 28 of
aSpectrin
Are
Associated
with
Structurally
and
Functionally Abnormal Spectrin
al/74
in
Hereditary
Elliptocytosis
Theresa L. Coetzer,** Ken Sahr,* JosefPrchal,1 Hilary Blacklock,11 LoAnnPeterson,' Robert Koler,** JohnDoyle,**J. Manaster,f and Jiri Palek*
*DepartmentofBiomedical Research, DivisionofHematology/Oncology,St. Elizabeth's Hospital ofBoston, Tufts University School of
Medicine, Boston, Massachusetts 02135; tDepartment ofHaematology, South African Institutefor Medical Research, University ofthe
Witwatersrand, Johannesburg, South Africa;
lUniversity
ofAlabama, Birmingham, Alabama 35294; 1lMiddlemoreHospital, Auckland, New Zealand; 'Hennepin County Medical Center, Minneapolis, Minnesota 55415; **University of Oregon Health Science Center, Portland, Oregon 97201; :The Hospitalfor Sick Children, Toronto,Canada;andfNahariya
Hospital, Nahariya, IsraelAbstract Introduction
Hereditary elliptocytosis (HE)Sp
aoP4
is adisorder associatedwithdefective spectrin (Sp) heterodimer self-association and an abnormal tryptic cleavageofthe80-kD aI domain ofSp
resulting in increased amounts of a 74-kD peptide. The molecu-lar basis of this disorder is heterogeneous and mutations in codons 28, 46, 48,and 49 (codons 22, 40, 42, and 43in the
previousnomenclaturewhichdid notincludethesix
NH2-termi-nalamino acids) have been reported. In this study we present data onseven unrelated HESp
all4
kindredfrom diverse racial backgroundsin whom weidentified fourdifferentmutations alloccurringin exon 2ofaSpatcodon 28. Utilizingthe polymer-asechain reactionweestablishedaCGT 7CTT;Arg-- Leu
28mutation in one kindredofArab/Druze origin. In two unre-lated whitekindredofEnglish/Europeanorigin the substitu-tion is CGT --
AGT;
Arg -- Ser 28 and in twoapparently
unrelated white kindred from New Zealand, the mutation is CGT--
TGT; Arg
-*Cys
28.Finally,
inoneAmerican blackkindred and in a black kindred from Ghana the mutation in-volvesCGT--
CAT; Arg
-- His 28. Allelespecific
oligonucleo-tide hybridization confirmed thatthe probands are heterozy-gous for therespectivemutantalleles. All four point mutations
abolishedanAha IIrestrictionenzyme sitewhichallowed
verifi-cation of linkage of the mutation with HE Sp
all4.
Our resultsimplythatcodon 28 of a Sp is a "hot spot" for mutations and alsoindicatethat Arg28is criticalfortheconformational
stabil-ityand functional selfassociationof Spheterodimers.(J.Clin. Invest. 1991. 88:743-749.) Key words: aspectrin gene* "hot
spot" mutations *hereditary pyropoikilocytosis- polymerase
chain reaction * clinical heterogeneity
Portions of thiswork werepresentedat the 32nd Annual Meeting ofthe
American Society of Hematology, November 1990, and have been
publishedas anabstract (1990. Blood.76:37a).
Addressreprintrequests toJiriPalek, M.D., St.Elizabeth's
Hospi-talof Boston,TuftsUniversitySchool of Medicine, Dept. of
Biomedi-calResearch, Division of Hematology/Oncology,736 Cambridge St.,
Boston,MA02135.
Receivedforpublication5February 1991 and in revisedform I May 1991.
Hereditary
elliptocytosis (HE)'
is heterogeneous in terms ofclinicalpresentation, inheritance,andtheunderlying molecu-lar defect (1, 2). The most common abnormalityinvolves a
defective spectrin (Sp) selfassociation
(3-6).
Sp,themajor com-ponentoftheredcellmembraneskeleton,consistsof twoelon-gated chains which arearrangedin anantiparallel fashion to
form
a(3
heterodimers(SpD); theSpD,
in turn, interact in thehead region ofthe two chains formingtetramers(SpT) and
oligomers (3, 7). Limited
tryptic digestion
ofSphas allowed theidentification of five a Sp (aI-aV) and four
fl
Sp((3I-fIV)
structural domains
(8).
Theselfassociation ofSpD
intoSpT
involves the
NH2-terminal
alandthe COOH-terminal 3I do-mains (7). a andf3Sp
arecomposed of multiple homologousrepeatunits,eachconsisting of - 106amino acids (9),except
fortheNH2- and COOH-terminal residuesof bothaand ,B
Sp,
aswellassegment10ofaSp, whichare
atypical
andunrelatedto theconservedrepeatmotif
(10,
11).Seven distinct structural defects ofthe al domain,
asso-ciated with
impaired SpD-SpD interaction,
havebeendefinedonthebasis of abnormal limited
tryptic digest
maps inwhichthereisadecreaseinthenormal 80-kDaldomainanda
con-comitant increase inone ormorelowermolecularweight
pep-tides(2). Thesedefects of Spare
designated according
tothe molecularweight oftheabnormalpeptide
(1).HEsubjects
who carry one or moreoftheseabnormalspectrins exhibit
marked variation in clinical severityas well as the degreeof functional impairment ofSpDself association (12). RecentstudieshaveindicatedthatSp a1174is the most severedefect,whereasSpa165
results in only mild dysfunction (13). Partial amino acid
se-quencing
oftheNH2-terminal portion oftheabnormalpep-tideshas revealedaminoacidchanges in close
proximity
to the cleavagesite in subjects withSpaI/65,
Spa146,and SpaI/S5b
(14). Knowledgeof the genomic exon/intronarrangementofthe aIdomain of Sp
(15)
has allowed theverification ofthesechangesatthe DNA level and has alsofacilitatedthestudyof defects
locatedeitherupstream orfurtherawayfromthecleavagesite. Sp
a1/65
appears to be a homogeneous defectdue to a single mutationbecause all cases thusfar investigatedinvolve a dupli-cation oftheleucinecodon (TTG) at position 154(formerly1. Abbreviations used in this paper: ASO,allele-specific oligonucleo-tide;HE,hereditaryelliptocytosis;HPP,hereditarypyropoikilocytosis;
PCR, polymerase chain reaction; RFLP, restrictionfragment length polymorphism; Sp, spectrin; SpD, spectrin heterodimer; SpT,
spectrin
tetramer.
Codon 28 Mutations inSpectrin //74 Elliptocytosis 743
J.Clin.Invest.
© The American Society forClinicalInvestigation,Inc.
148, see abstract and below) of a Sp
(16-18).
In contrast, recentstudies on Sp
a1174
have revealed thatthis defect is heteroge-neousin origin and that the primary mutation may occur in either thea Sp or#Sp genes(18-20).
Thus far, four a Sp and oneASppoint mutationshave been described in Spa1/74sub-jects involvingchangesofaSp amino acids 22 (21), 40 (22), 42 (23), and 43 (22)andaminoacid 2053 inA Sp (20). In these reports, theaminoacidsofaSp have been numbered accord-ingtotheaminoacid sequence of limited tryptic digest
pep-tidesofaSp (9).However, thefull-lengthcDNA sequence ofa
Sp predictsan additional six
NH2-terminal
amino acids (10). Therefore, by agreement with other researchers in the field (Al-loisio,N., J. Delauney, D. Dhermy, and B. Forget), the number-ing usedinthis report has now been modified to include the additional six residues. The previously reported mutations (20-23) are thus located in codons 28, 46, 48, and 47.Inthisstudy, we describe four mutations in codon 28 (new nomenclature; this corresponds to codon 22 of previous no-menclature) ofaSp in seven unrelated kindred with HE from diverse racialbackgrounds. Allele specific oligonucleotide hy-bridization confirmedthat the probands were heterozygous for the defects. All four point mutations abolished an AhaII restric-tionenzymesiteand this allowed screening of family members toverify linkage of the mutation with HE.
Methods
Subjects. The pedigrees of the seven unrelated Sp a"'74 kindred are shown in Fig. 1. Family 6 is one of the two original black American kindred in whom the Spa1174defect was first detected (24) and clinical and protein data on family 4 have been reported previously (25). Data on the remaining five kindred have not been published. Clinical and
Family1 Arg-Cys28
1 2
Family 2
1
12
114
Family3 Arg -Ser28 Family4
1 2
II
E-1KC
ti
SW6
6
6§Th
Family5 Arg-His28 Family6 I K
II
IKFb
M
IC
E
1 2 3 1 2 3
Family7
Arg- Lu 28
II A
1 2
X HPPSpa
Normal
8
notstudied 1/74 Aasymptomatic11 K"~~~carrier
Figure1. Pedigreesof the seven unrelated HE Sp
a174kindredwith
four differentcodon28 mutations. Families 1-4areCaucasian,
fam-ilies 5 and6 are Black,andfamily 7is ofArab/Druzeorigin.
biochemical dataonaffectedindividualsaregivenin Table I. Criteria for thediagnosisof the clinicalphenotypehave beenoutlined(2)and
arebasedmainlyon(a)reviewof theperipheralbloodfilm, (b)
pres-ence orabsenceofhemolysis,and(c)theinheritancepattern.
Inallsevenkindred,theclinical severityvariesmarkedlybetween
familymembers and ranges fromasymptomaticcarrierto HPP(Fig.1 andTable
I).
Families 1 and 2areapparentlyunrelated white kindred from New Zealand and families 3 and4 arewhite kindred ofEnglish/European origin. Family 5 isablackkindred from Ghana, whereas
family7is ofArab/Druzeorigin.
Inall theseindividuals,there isanincrease in the percentage SpD
extracted from the membraneat4VCcomparedtocontrol values of 5.0±3.6% (n=35).
Asymptomatic
carriers have 25-31%SpD;HEsub-jectsrange from 36-55%SpDandHPPindividualshave 60-70%SpD
in their membraneextracts.Thisfunctional Sp self association defect is duetothe presence of abnormalSp
al174
in allcases asevidencedby limitedtryptic digestion ofSp (datanot shown). The membrane Sp content,expressed as aSp/b3 ratio, is decreased in all HPPsubjects(normalSp/b3 1.0±0.1, n= 60), as well as in some of the HE
individ-ualswithseverehemolysis (Table
I).
TheremainingHE subjectsand asymptomaticcarriers haveanormalSpcontent.Erythrocyte membraneprotein analysis. Themethods used have been previously referredto ordescribed in detail (24, 26, 27). They includeerythrocytemembraneprotein preparation(26,28) and analy-sisbySDS-PAGE(3.5-17%acrylamidegradient gels) (26,29);spectrin
extraction (26)and analysisofSpD and SpTby nondenaturinggel electrophoresis (4); limitedtryptic digestion ofSp (24) followed by SDS-PAGE
(10%
acrylamide)(30)andimmunoblottingwithapolyclo-nal anti-a I Sp antibody (26). On some probands, two-dimensional isoelectric-focusing/SDS-PAGE of limited tryptic digests of Sp was per-formed(24).Amino acid sequenceanalysis (31)ofthe abnormal74-kD
aIpeptidewascarriedoutin thelaboratoryof Dr. P. Matsudairaat
MassachusettsInstitute ofTechnology,Cambridge, MA.
Restrictionfragment length polymorphism (RFLP) analysis. Geno-micDNA wasisolated fromperipheralleukocytes of ACD
anticoagu-lated blood (32) and 10 ug DNA were digested with the restriction endonucleases Xba
I,
MspI,
PvuII,
and TaqI(BoehringerMannheim GmbH, Mannheim, FRG). DNA fragments were fractionated ona0.7% agarosegel (33)andtransferredto anylonmembrane(Zetaprobe,
Bio-RadLaboratories,Inc.,Richmond, CA)by alkaline Southern blot-ting (34)in 0.4 M NaOH.A 13-kbgenomicaISp probe (clone3021 El) (35) and a 738 bp, Sp cDNA probe (36) were labeledwith 32p dCTP (New England Nuclear, Boston, MA) by random priming (37) andhybridized tothe filtersasdescribed bytheZetaprobe
manufac-turer.
GenomicDNAamplificationandsequencing. Exons1 and 2 ofaSp
wereamplified by the polymerase chain reaction (PCR) (38)utilizing oligonucleotide primers complementary to the flanking intron
se-quences (Fig. 2). P1
(5'GAATTCGACTGGACAGTTCCAT3')
and P2(5qTAGGGTCTGCTCTGAGGCAAT3) amplified a ±1,500-bpfragmentcontaining both exons, whereas P2 and P3 (5'CACATATA-AGCGGGGCAACAT3)amplifieda348-bpfragment containing only
exon2. 1 Mg ofgenomicDNA wasamplified for 30cyclesusing Taq polymerase (Perkin Elmer Corp., Norwalk, CT) in a Perkin Elmer Cetus DNA thermal cycler. Eachcycleconsisted of1 min denaturation
at
94°C,
1min
annealingat55°C
and 2 min extensionat72°C.Subcloning
and sequencingofamplifiedDNA. ThePCR reaction mixeswereanalyzed on1% agarosegels and theamplifiedDNAwaspurified by elution from the gelusingGeneclean (Bio 101,LaJolla,
CA). The PCR productswereblunt-endligatedinto Hinc IIdigested
pGEM 3Z vector(PromegaBiotec, Madison, WI) (33). Positive sub-clones were sequenced on both strands bydideoxy sequencing(39)
using T7 DNA polymerase (Sequenase; United States, Biochemical Corp., Cleveland,OH)andplasmid
Sp6
andT7promoterprimers.Direct sequencingofamplifiedDNA.Genomic DNA wasamplified
asaboveusing primersP2 and P3. 5 Ml of the PCR reaction mixwere
reamplified
asdescribed,usingonly P2. This resulted in accumulation ofsingle stranded DNA which was purified either on Centricon 30TableLClinical and Biochemical Data on HE Sp
a"17"
KindredSubject Splenectomy Hct Retics %SpD* Sp/b3* Clinicalphenotype Mutation
Family 1
1.2 Yes 30 2.1 52 0.74 HPP Arg Cys28
11.2' No 41 1.5 49 0.91 MildHE Arg Cys28
111.1 Yes 34 6.3 68 0.67 HPP Arg- Cys 28
Family 2
1.2 Yes 34 2 53 0.86 SeverehemolyticHE Arg Cys28 II.2 Yes 36 1.5 53 0.83 Severe hemolyticHE Arg- Cys 28 I1.3 Yes 32 1.8 55 0.81 Severe hemolytic HE Arg- Cys 28
III.2 No 36 1.9 48 0.90 MildHE Arg Cys 28
III.4 Yes 15 17$ 60 0.71 HPP Arg Cys28
Family 3
1.1 No 45 2 36 1.00 MildHE Arg Ser 28
11.3 No 12-18 5-14 50 0.77 Severe hemolyticHE Arg - Ser 28 Family4
II.2 Yes 35 4-5 61 0.69 HPP Arg Ser 28
III.1 No 35 1.9 44 0.96 Mild HE Arg- Ser28
Family5
1.1 No NA N 26 0.99 Asymptomatic carrier Arg- His28
11.1 No NA t 48 0.97 HemolyticHE Arg - His 28
II.2 No NA t 51 0.96 HemolyticHE Arg- His28
11.3 No NA t Transfused HemolyticHE Arg - His28
Family 6
1.2 No 40 0.9 25 1.02 Asymptomaticcarrier Arg - His 28 1.3 No 47 1.8 31 0.97 Asymptomaticcarrier Arg - His 28
11.2 No 21-25 8-16 76 0.80 HPP Arg His 28
11.3 No 34.5 5.2 32 0.98 MildHE Arg - His 28
Family7
1.2 No NA 1.4 39 0.91 MildHE Arg Leu28
11.1 No NA 12 73 1.00 SeverehemolyticHE Arg - Leu28
111.2 No NA 20 66 0.82 HPP Arg - Leu 28
NA, not available.
*Normal values for%of SpD,
5.0±3.6%;
Sp/b3,(Amersham,UK) ormodel 30,000filters(Millipor MA). The supernatantwasconcentratedbyethanol sequenced usingT7 DNApolymeraseandP3asseq
Allele-specificoligonucleotide hybridization. Noi allele-specific oligonucleotides (ASO)weresynthesize Biosystemsoligonucleotide synthesizer (AppliedBim
terCity, CA)andpurified.Thenormal ASO sequenc GAGGCGTCAGGAAGTG3'(codon28 isunderlir
tantASO sequenceswereidentical except for the re] substitutionatcodon 28.
EXON
P1 I
E XON
P3
51
44bp 240bp
1.0±0.1. *Presplenectomy values.
e Corp., Bedford, Genomic DNAwas
amplified
asdescribed and 10 ul of the PCRprecipitationand reaction mixweretransferredtoanylonmembrane
(Zetaprobe) using
luencing
primer. aslot blot apparatus(40).
Normal andmutantASOprobes
wereendrmal and mutant labeled with gamma 32PATP
using
T4polynucleotide
kinase(33).
Theedon anApplied slotblotswere
hybridized
with eithermutantornormal ASOprobes
for systemsInc.,Fos- 2 hat 620CinSX SSPE, 5X Denhardtssolution,
0.5% SDS.Mem-:ewas5'CAGGA- braneswerewashed twice for 15 minat roomtemperaturein 2X
SSPE,
ied) and themu- followedbytwotothree washes for 5-10 minat620Cin 2x
SSPE,
levant nucleotide 0.1% SDS andsubjectedtoautoradiographyat-70'Cusing
intensify-ingscreens(NewEngland Nuclear).
Restriction endonucleaseanalysis of
amplified
DNA. DNA from normal and affectedfamilymemberswasamplifiedasdescribedusingP2andP3. Theamplified productwas
purified
byphenolchloroform3' DNA extraction and ethanol
precipitation; digested
with Aha II(New
En-- 3 glandBiolabs, Beverly, MA)andanalyzedon2% agarosegels.
Results
8AA
I-8
80 AA
9-88
Figure 2. Exon/intronarrangement of theNH2-terminal portionof aSp.Pl-P3areoligonucleotide primersusedfor PCRamplification.
AAdenotesaminoacids.
Coinheritance
ofmutant Sp
a'74
withHEand
HPP. In allsevenkindred,
theclinically
affected individuals exhibitedastriking
increasein theamount of
SpD
in thered cell membrane ex-tracts(TableI), ranging
from 25-76%SpDoutofthetotalSpD andSpT pool
ascompared
withcontrol valuesof 5.0±3.6%(n
= 35). Limited trypticdigestionofSp revealed thepresenceof mutant Sp a1/74 as evidenced by a marked increase in the amount ofthe 74-kD a Ipeptideanda concomitantdecreasein the normal 80-kD a I domain ofSp (data not shown). The clinical presentation was variable, includingasymptomatic car-rier state, mild HE, HE with hemolysis and HPP. The latter wascharacterizedbymicrospherocytosisand micropoikilocy-tosis with onlyoccasional elliptocytes,which correlated with a
decreasedmembranespectrincontent as well as a more severe
clinicalandbiochemicalpresentation (TableI).In
hematologi-cally normal family members, SpD selfassociation and limited
tryptic digests,aswell asSpcontent, were all normal.
Assignmentofthe defect toaSp.The primary defect in Sp a1/74canreside either on theaSp orthe (3 Sp chain as indicated
by RFLPstudies (18) orlimited tryptic digestion ofa ( Sp
mixed hybrids (19).In the present study, either RFLP analysis orlimited tryptic digestion of isolateda and
#
chains wasem-ployed insome kindred inanattempttoassign thedefect to oneof the two Spchains. For RFLPstudies, DNA from
af-fected andnonaffected individualswere analyzedwitha
geno-micaISp probewhichispolymorphicforthe restriction en-zymes Xba I, Pvu II, and Msp I (41). The Xba Ipolymorphism, for example,
distinguishes
twoalleles corresponding torestric-tionfragment lengths of 4.05and2.20+ 1.85 kb,respectively.
Inthreepedigrees,oneofthe4.05-kb allelessegregatedwiththe
inheritance ofHE Sp a174 which would be compatible with
linkageto a Spindicatingthat the primary defect could be in theaIdomainofSp(data notshown). RFLPstudies usinga Taq Ipolymorphismfor(3 Sp were notinformative.
Elucidation
of the a Sp gene mutation. Amino acid se-quencingof the 74-kD al peptide in four probandsrevealedthat the cleavage site was at Lys 48 (residue 42 in previous nomenclature) comparedwith thenormalcleavage siteatArg 45(previously residue 39) (42).Wethereforeanalyzed exons 1 and 2 ofa Sp, which code for the first 88 amino acids (six NH2-terminalamino acidsaspredictedbytheDNA sequence [15] plus 82 amino acids accordingtoSpeicher's nomenclature [42]). Genomic DNA was amplified by PCR andsequenced either
directly
or aftersubcloning.
DNAsequencing
ofsub-cloned DNAfrom probandsJF
(family
1) andBF(family
2) revealed asingle
base change of C -* T in exon 2 of both probandsasexemplifiedinFig.
3 forJF.Toverify
themuta-Normal
G A T C
dw
am
do T
_ ,_ -G
UL
CGT Arg 22
Mutant
tion,
several subclones from separate PCR reactionswerese-quenced
to ensurethat both alleleswereanalyzed. Insubject
JF, fouroutof 10subclonesof PCR 1containedthemutation,
aswellasthreeoutof four subclones of PCR 2. Insubject
BF,
the mutationwaspresent in fouroutof 12 subclones of PCR 1
and,
two outof 11 subclones of PCR 2(Fig.
3).Thischanged
the normal CGT codon to TGT
resulting
in anArg
-.Cys
substitutionatamino acid 28 (previouslyresidue 22). All
re-mainingcodonsofexon2,as well as exon 1, werenormal. Intheremaining five kindred, direct sequencing of PCR-amplified DNAwascarriedoutand threedifferent mutations
atcodon 28wereidentified(Fig. 4).In this type ofsequencing
both normal andmutantallelesaresequenced
simultaneously
resultinginthepresence ofthenormal and mutantnucleotides
atthe same position in the sequencing ladder. In twounrelated white families (kindred 3 and 4), the point mutation was CGT -* AGT which resulted in an
Arg
-- Ser substitution(Fig. 4, left). In the Arab Druze kindred (family 7) (Fig. 4,
center),
thepoint
mutationwasCGT-- CTTcausing
substitu-tion ofArgbyLeuand intwounrelated black kindred(families
5and
6),
aCGT-- CATmutationchanged Arg
toHis(Fig. 4,
right).
Allele-specific
oligonucleotide hybridization. Toverifythevarious different nucleotide substitutions, PCR-amplified
DNA oftheprobandswerehybridized with either a normal ora mutantASO probe and the results are shown in Figs. 5 and 6. CE(II.2, family 6)and KF(II. 1, family 5)areheterozygous for theCAT(His 28)defect because their DNA hybridized to both the normal and the mutant probe (Fig. 5).Likewise,SW(I1.2,
family4)andKC (11.3, family 3) areheterozygousfor the AGT
(Ser 28)mutation and AP(II.1,family 7) is a heterozygote for theCTT(Leu 28) abnormality (Fig. 6).
Linkage of the codon 28 mutations to HE
Sp a74.
Thenormal DNA sequence has an Aha II restriction cleavage site at codon28 which is eliminated by the base changes and therefore restriction enzyme analysis could be used to test for the pres-enceof the mutations. Exon 2 ofaSp wasamplifiedin affected and normal individuals from all kindred and afterdigestion withAha II,thesamples wereanalyzedon 2% agarosegels.An example of one kindred(family 1) is shown inFig. 7. In the normal individual from thiskindred,both normal alleles con-tain the restriction site and are therefore cleaved intotwo frag-ments of 222 and 126 bp, respectively. In contrast, the HE individuals from this family areheterozygousforSp
aI/74
and contain a normal allele which isdigested byAha II andamu-G A T C
-
_
-_. ,.... f...
._
^!-i
-T
-G
-T
TGT Cys 22
Figure 3. Normal and mutant DNA sequence of part of theaSpgene in proband11.2(JF)offamily 1. Genomic DNA was amplified by PCR,subcloned,and sequenced.Apoint mutation in codon 28 that changes the normal subclone sequence of CGT (Arg)toTGT (Cys) in the mutant subclones was detected.
G A T C
.~t'
4--_
Arg -Ser 28
G1 A T C
I= .. I,,w,"
...
~~~~~~~~~-G
C
Arc
' -_eG2 T
G A T C
imii.k4- r..
GA C
Arq -His 28
Figure 4. Normal andmutantDNA sequence of partoftheaSpgene inproband 11.3 of family 3 (left, CGT-- AGT); proband I. 1 of
fam-ily7(center, CGT -* CT1)andprobandII.1 offamily5 (right, CGT-- CAT).Genomic DNAwasamplified byPCR andsequenced
directlyresultingin the presence of the normal andmutantnucleotide
atthesameposition inthesequencingladder.
Mutant CAT
His 28 12 112 liii 1112 M
*t
1
CE4
a.
4.
Figure 5.Allele specific oligo-nucleotide(ASO)
hybridiza-tion. DNA from various af-fected HESpa1/74and normal
familymemberswere ampli-fied byPCRandhybridizedto
eitheranormal ASOor a
mu-KF~
~ (11.2,family 6)andKF(11. 1, family 5)arebothheterozygous for the mutation.
tant allele which lacks the cleavage site and remains intact, resulting in thepresenceof threefragmentsonthe gel (348 bp
and 222+ 126bp). The codon 28 mutation is therefore linked
tothe inheritance of HESpaT'74inthis kindred. AhaIIdigests
ofamplifiedDNAfrom theremaining six kindredgave
identi-cal results(datanotshown).
Discussion
In this study, we have described four different mutationsin codon 28(previously referredtoascodon22) ofaSpinseven
unrelatedHESp
a1174
kindred from diverse racialbackgrounds. Thepoint mutations resultedinthe substitution of Arg 28by eitherCys,Ser,Leu,orHis. The latter mutation is identicaltothatpreviously describedinonewhite French kindred(21).In
anindependentsimultaneousstudytheArg Leu mutation
was also found in one black individual and the Arg -> Ser
substitutioninonewhitesubject (23).
Normal CGT
Arg 28
Mutant AGT
Ser 28
Mutant CTT
Leu 28
APAUM
SW Avo
Figure6. Allelespecific oligonucleotide (ASO) hybridization. DNA
from variousaffected HE Sp a1/74 and normal family memberswere
amplified byPCR andhybridizedtoeitheranormalASOor amutant
ASO. Note thatSW(11.2, family 4),KC(11.3, family 3)and AP(11.1
family 7)areheterozygousfor therespectivemutations.
bp
348-222s.
126\
Figure7.Aha IIrestriction enzymeanalysis. Genomic DNAfrom family 1 was amplified by PCR produc-ing a 348-bp fragment which was digested with AhaIIandanalyzed on 2% agarosegels.AffectedHE/ HPPSp a/14individuals are heterozygousfor the
mu-tantallelewhich has lost the Aha IIsite and hence remains intact (348-bp fragment), and the normal allele which is cleaved by Aha 11 (222- and 126-bp fragments). The normal familymember doesnot
contain themutantallele.
Mdenotessize markers.
The Arg 28 mutations only occurred in individuals whose red cells contained the structurally and functionally defective Spa1/74andwereabsent innormal family members and control
individuals. Furthermore, because Arg 28 is locatednearthe
74-kD tryptic cleavage site and ispart of the self-association site, these data imply that the codon 28 mutationsareinvolved
in the observed functional and structural Spa174
abnormali-ties. Inthetriple-helical model proposed for Sp (9), Arg 28 is located inrepeat IofaSp,attheNH2-terminal end of helix 3, adjacenttotheturnregion. Helix 3 thusappearstobecritical in maintaining the structural and functional integrity of the Sp molecule. The importance of helix 3 is further evidenced by the
presenceof mutations in this helix in various otherrepeatunits ofaSp. In thesecasesthemutations occurredatthe COOH-terminal end of thehelix, adjacenttotheconnecting region: in Sp aI/65 (repeat 2), Spa1/46(repeat 3), Sp a1I/S' (repeat 5), Sp Lyon (repeat 1), and Sp Culoz (repeat 1) (14-16, 22).
Ourstudies further indicate that Arg28 isavital residue for
thenormal function andconformationalstability ofaSp.
Sub-stitutionof Arg 28 withanaminoacid residue of different size
and/or charge alters the conformation of the head region ofa
Sp which inturninfluences thefunction and structural integ-rity of the molecule. This is manifested bya decreased SpD
self-association interaction and anenhancedsusceptibility of
the a1/74tryptic cleavage site atArg 45 or Lys 48(previously
residues 39 and 42), resulting inanincreased production ofthe
74-kD peptide after digestion with trypsin. Interestingly, the typeof amino acid substitutionatposition 28 doesnotappear
toaffect thestability of the molecule inadifferentialmanner,
becauseall four mutations (Arg 28-* Cys/Ser/His/Leu)
pro-duceasimilarrangeoffunctional(%SpD) and structural
(74-kDpeptide) abnormalities (Table I).
Within each familyinvestigated, there isa marked varia-tioninthe clinicalexpression ranging fromanasymptomatic
carrierstate to HPP. This heterogeneity has previously been showntocorrelate with theamountsof bothSpD and the 74-kDpeptide,aswellaswith theabsoluteSpcontentofthe
mem-brane(12). Becauseall affectedindividuals from onekindred areheterozygotes for the identical mutation, which ispresent inonlyoneof thetwoalleles, it is clear that additional factors modulate the expression of the defectivegeneand the
abnor-malprotein product. Thesemaybecis-acting factors suchas a
Codon 28 Mutations inSpectrina1174Elliptocytosis 747
Normal CGT Arg 28
4.0
a.
m.a.0
a.M
linked
polymorphism
ormutation occurringelsewhereinthe aSp
geneoralternatively,
trans-acting factors involving linkage with another,asyet unknown,defect.Anexampleof the latterpossibilitywould be the concurrentinheritance ofan aSp co-don 28 mutation
together
witha"thalassemia-like" defect ofSp synthesis (1),
which wouldcause apartial Sp deficiencyandresult in an altered red cell morphology and a more severe
clinical
presentation,
asseeninsomeindividuals
withseverehemolytic
HEand HPP.Identicalpoint mutations,
associated with variable clinical severity, have also been noted inhemo-philia
A(43).The occurrence of fourdifferent mutations in one codon allows
interesting speculation
as totheorigin
of thesemuta-tions.
Firstly,
theexistence ofapositive
selectionpressurefor individuals heterozygous for a mutantallele has been docu-mented inthe caseof hemoglobin S, E, and thalassemicdis-orders,
whereresistancetomalaria caused byamutationin one of theglobin
genes confersaselective survival advantage(44). In ourstudy
ofaSp mutations,
this would probably be anunlikely
eventbecause thefamiliesareof different ethnic andgeographic origins
unrelatedtomalarialendemic regions.Sec-ondly,
Arg28 may beacrucialamino acid intheSp moleculesothat any
change
in thisresidue wouldalterthefunctionand structuralconformation ofSp
and hencemanifestas adiseasestate, whereas
changes
in thesurrounding
residueswould not haveadeleteriousinfluenceand henceonlyresult inclinically silentpolymorphisms
whichwould notbedetected.This like-wiseseems anunlikely explanation
because the molecularbasis ofSp a1174
isheterogeneous
and mutationsat codons46, 48,and49
(previously
referredto ascodons40, 42, 43)
havebeenreported (22, 23).
Anequallyunlikely possibility
is that theArg28mutationsaretoleratedbecause the
resulting
structural and functionalalterations couldbeassimilatedby
the red cellmem-brane,
whereasmutationsin otherpossibly
morecritical resi-duesmaybe
potentially
lethal and thus selectedagainst.
A strongcaseagainst
thispossibility
isa recentstudy
ofafamily
witha
severely
dysfunctional Sp
mutation(13).
Thehomozy-gote
proband
carrying
thismutantSp
had a lifethreatening
hemolysis
and her mutantSp
wascompletely
devoid of thepropensity
to formSpT.
In contrast,heterozygote family
members hada
relatively
mildhemolytic
HEonly,
because the adverse consequencesof this mutantSp
werediminishedby
the
product
ofthe normalSp
allele.Webelievethatthemost
likely
conclusion is that thecodon28may representa"hotspot" for mutationsbecauseit is en-coded
by
the nucleotidesCGT,
and CG dinucleotides havebeen
implicated
asmutation "hotspots"
for severalreasons:(a)
CGdinucleotidesare observedat amuch lowerratethanexpected
inexonsequences,implying negative
selectionorre-pression (45); (b) evolutionary
studiesonvertebrate genesindi-cated a
high
rate of CG substitution(46); (c)
restriction en-zymes thatcontain CG dinucleotides in theirrecognition
se-quence(e.g.,
TaqI,
MspI)
detect ahigh frequency
ofpolymorphisms (47);
and(d)
alarge
numberofrecurrentpoint
mutations
involving
CG-- TG and CG-- CAtransitions havebeenfound inhuman
genetic disease,
e.g.,hemophilia
A(48,49)
andadenosine deaminasedeficiency
(50).Themechanism
underlying
thisfrequent generation
ofmu-tations is
presumably
duetopreferred methylation
of C resi-duesinthisposition
in theheavily methylated
human genome(51)
which cansubsequently undergo
spontaneousdeamina-tiontoT
(52, 53).
This would result inaC Ttransition oralternatively in a G -E A transition if 5 methyl-C deamination occurred on theantisense strand. Two of the mutations noted in our study, in four unrelated kindred, involve such transi-tions
(LGT
TGT;Arg
-*Cys
andCGT--CAT;Arg
-*His)
and thus codon 28 may be regarded as a "hot spot" for a Sp
mutations. The mechanism underlying the recurrent muta-tions
involving
C -- AandG - Ttransversions(Arg
28 -iSer/Leu)remainstobe resolved.
Acknowledgments
Wewish to thank Tricia Duquette and Patty Cerulle for expert techni-cal assistance; Joan Joos for the artwork, and Loretta Wencis and Gabriella Maitino for typing the manuscript. We also thank Dr. Ber-nard Forget, YaleUniversity School of Medicine, New Haven, CT, for providing us the information on the DNA sequence and exon-intron boundaries of theaIdomain before the publication of these data in Reference 15.
This study was supported by grants HL3746 and HL27215 from theNational Institutes of Health, Bethesda, MD, and by a grant from theMedical Research Council of SouthAfrica.
References
1. Palek, J. 1987. Hereditary elliptocytosis, spherocytosis and related dis-orders:consequenceofadeficiencyor amutation of membrane skeletal proteins. Blood Rev. 1:147-168.
2. Palek, J., and S. Lambert. 1990. Genetics of the red cell membrane
skele-ton.Semin. Hematol. 27:290-332.
3.Ungewickell,E., and W. Gratzer. 1978. Self-association ofhuman spectrin.
Athermodynamic and kinetic study. Eur. J.Biochem.88:379-385.
4.Liu, S. C.,J.Palek,J.Prchal, and R. P. Castleberry. 1981. Altered spectrin dimer-dimer associationandinstabilityof erythrocyte membrane skeletons in hereditary pyropoikilocytosis.J.Clin.Invest.68:597-605.
5.Liu, S. C., J. Palek, and J. Prchal. 1982. Defective spectrin dimer-dimer association inhereditary elliptocytosis. Proc. Natl. Acad. Sci. USA.
79:2072-2076.
6.Coetzer, T., and S. Zail. 1982. Spectrin tetramer-dimer equilibriumin
hereditaryelliptocytosis. Blood. 59:900-905.
7.Morrow, J.S.,D.W.Speicher, W. J. Knowles, C. J. Hsu, and V. T. Mar-chesi. 1980.Identification of functional domains of human erythrocyte spectrin.
Proc.Natl. Acad.Sci. USA. 77:6592-6596.
8.Speicher,D. W.,J.S.Morrow, W. J. Knowles, and V.T.Marchesi. 1980.
Identification ofproteolyticallyresistant domains ofhumanerythrocyte spectrin. Proc.Natl. Acad.Sci. USA.77:5673-5677.
9.Speicher,D.W., andV.T.Marchesi. 1984.Erythrocyte spectrin is
com-posed ofmanyhomologoustriplehelicalsegments. Nature(Lond.).311:177-180. 10. Sahr,K.E.,P.Laurila, L. Kotula,A.L.Scarpa, E. Coupal, T.L.Leto,A.J. Linnenbach, J. C. Winkelmann,D.W.Speicher, V. T. Marchesi,P.J.Curtis,and B.G. Forget. 1990. The complete cDNA andpolypeptide sequences ofhuman
erythroid a-spectrin.J.Biol. Chem.265:4434-4443.
11.Winkelman,J.C.,J.G.Chang,W.T. Tse,A. L.Scarpa, V. T.Marchesi,
andB.G.Forget. 1990. Full-lengthsequenceof the cDNA for human erythroid ,B-spectrin.J. Biol. Chem. 265:11827-11832.
12.Coetzer, T., J. Lawler, J.T.Prchal,and J. Palek. 1987. Molecular
determi-nantsof clinicalexpressionofhereditaryelliptocytosisandpyropoikilocytosis.
Blood. 70:766-772.
13. Coetzer, T., J. Palek, J. Lawler, S. C.Liu,P.Jarolim,M.Lahav,J. T. Prchal, W. Wang, P. B. Alter, G.Schewitz,V.Mankad, R.Galanello,andA.Cao.
1990. Structural and functionalheterogeneityofaspectrinmutationsinvolving
thespectrinheterodimer self-association site:relationshipstohematological
ex-pressionof homozygousHEand HPP. Blood. 75:2235-2243.
14.Marchesi, S. L., J.T.Letsinger,D.W.Speicher,V.T.Marchesi,P. Agre, B.Hyun, and G. Gulati. 1987. Mutant forms ofspectrina-subunits inhereditary elliptocytosis.J.Clin. Invest. 80:191-198.
15.Sahr,K.E., T.Tobe,A.Scarpa,K.Laughinghouse,S. L.Marchesi,P.
Agre,A.J.Linnenbach,V.T.Marchesi,and B.G.Forget. 1989.Sequenceand
exon-intronorganizationof the DNAencodingtheaIdomainof human
spec-trin.Applicationtothestudyof mutationscausinghereditary elliptocytosis.J. Clin. Invest. 84:1243-1252.
16. Roux,A.F.,F.Morle,D.Guetarni,P.Colonna,K.Sahr,B.G.Forget,J.
Delaunay, and J. Godet. 1989. Molecularbasis ofSpa1065hereditary elliptocytosis
in NorthAfrica: insertion ofaTTGtripletbetween codons 147 and 149 in thea
spectringene from five unrelated families. Blood. 73:2196-2201.
17. Sahr, K. E., T. Tobe, K. Laughinghouse, T. L.Coetzer,J.Palek, M. Garbarz,P. Boivin, S. L. Marchesi,V. T.Marchesi, and B. G. Forget. 1989. Exon-intronorganization ofthe DNAencoding theaIdomainof human spec-trin: applications to the study of mutations causing hereditaryelliptocytosis(HE). J.Cell Biochem. 13B(Suppl.):219.
18. Coetzer, T., J. Lawler, J. Prchal, K Sahr, B. G. Forget, andJ. Palek. 1990. Molecularheterogeneity of aspectrin mutants in hereditary elliptocytosis/pyro-poikilocytosis. In Cellular and Molecular Biology of Normal and Abnormal Ery-throid Membranes. C.M.Cohen andJ.Palek, editors.Wiley/Liss,New York.
211-221.
19. Pothier, B., N.Alloisio, J. Mar6chal,L.Morle, M. T. Ducluzeau, C. Caldani, N. Philippe, and J. Delaunay. 1990. Assignment of Spa7"4hereditary elliptocytosistothea- ora-chain ofspectrinthrough in vitro dimer
reconstitu-tion. Blood.75:2061-2069.
20. Tse, W. T., M.-C. Lecomte, F. F. Costa, M.Garbarz, C. Feo, P.Boivin, D. Dhermy,andB.G. Forget. 1990. Pointmutationin thef-spectringeneassociated witha1'14hereditaryelliptocytosis. Implications for the mechanism ofspectrin dimerself-association.J.Clin. Invest. 86:909-916.
21. Garbarz, M., M. C. Lecomte, C. Feo, I. Devaux,C. Picat, C.Lefebvre,F.
Galibert,H.Gautero, 0.Bournier,C. Galand,B.G. Forget,P.Boivin,andD.
Dhermy. 1990. Hereditary pyropoikilocytosis and elliptocytosis in a white Frenchfamily with the spectrin a '74variant related to a CGT to CAT codon change (ArgtoHis)atposition22of thespectrina Idomain.Blood. 75:1691-1698.
22. Morle, L., A.-F. Roux, N.Alloisio, B. Pothier, J. Starck, J. Denoroy, F. Morle, R.C.Rudigoz, B.G. Forget,J. Delaunay, andJ.Godet. 1990.Two
elliptocytogenetic a"74 variants of thespectrin a I domain: spectrin Culoz (GGT -. GTT;all'Gly-*Val) andspectrinLyon (CTT- TTT;a,143Leu
-Phe). J.Clin.Invest.86:548-554.
23.Floyd, P. B.,P.G.Gallagher, S. L. Marchesi, andB.G.Forget. 1990. Heterogeneity in the molecular basis ofa 74hereditary elliptocytosis (HE) and hereditary pyropoikilocytosis (HPP).Blood.76:31a.(Abstr.)
24.Lawler, J., S. C.Liu, J. Palek, and J. Prchal. 1984.Amoleculardefectof
spectrin inasubsetof patients with hereditaryelliptocytosis.Alterations in thea
subunit domain involved inspectrinself-association. J.Clin.Invest. 73:1688-1695.
25. Peterson,L.C., C. Dampier, and T. Coetzer. 1987. Clinical and laboratory study of twoCaucasion families with hereditary pyropoikilocytosis and heredi-taryelliptocytosis.Am.J.Clin.Pathol.88:58-65.
26.Coetzer,T.L., and J. Palek. 1986. Partialspectrin deficiency inhereditary
pyropoikilocytosis.Blood. 67:919-924.
27.Coetzer, T., J. Lawler, J. T. Prchal, and J. Palek. 1987. Moleculardetermi-nantsof clinicalexpression of hereditary elliptocytosis and pyropoikilocytosis. Blood. 70:766-772.
28. Dodge, J. T., C.Mitchell, and D. J. Hanahan. 1963. Thepreparation and chemicalcharacteristics ofhemoglobin-freeghosts of humanerythrocytes. Arch.
Biochem.Biophys. 100:119-130.
29.Fairbanks, G., T. L. Steck, and D. F. H. Wallach. 1971. Electrophoretic
analysisofthemajor polypeptidesofthe human erythrocyte membrane.
Biochem-istry. 10:2606-2617.
30.Laemmli,U.K.1970.Cleavage of structural proteins during the assembly of the headof bacteriophageT4.Nature(Lond.).227:680-685.
31.Matsudaira, P. 1987. Sequence from picomole quantities of proteins elec-troblottedontopolyvinylidenedifluoride membranes.J.Biol. Chem.
262:10035-10038.
32.Sykes, B. G. 1983. DNA in heritable disease. Lancet. ii:787-788. 33.Maniatis, T.,E. F.Fritsch, and J. Sambrook J. 1989. Molecular Cloning.
ALaboratory Manual. Second ed. Cold Spring Harbor Laboratory, Cold Spring Harbor,NY.
34.Southern,E. M.1975.Detectionofspecificsequencesamong DNA
frag-mentsseparated byelectrophoresis.J.Mol. Biol. 98:503-517.
35.Linnenbach,A.J., D. W.Speicher,V.T.Marchesi,and B. G.Forget.
1986.Cloning ofaportionof the chromosomal gene for humanerythrocytea
spectrin by usingasyntheticgenefragment.Proc.Natl.Acad. Sci. USA. 83:2397-2401.
36.Prchal,J.T., B. J.Morley,S.H.Yoon,T. L.Coetzer,J.Palek,J.G.
Conboy,and Y. W. Kan. 1987.Isolation and characterization ofcDNA clones for humanerythrocytePspectrin.Proc.Natl. Acad.Sci. USA. 84:7468-7472.
37.Feinberg,A.P.,and B.Vogelstein. 1984.Atechniqueforradiolabelling
DNArestriction endonucleasefragmentstohighspecific activity.Anal. Biochem.
137:266-267.
38.Saiki,R.K.,D.A.Gelfand,S.Stoffel,S. J.Scharf,R.Higuchi,G. T.Horn,
K. B.Mullis,andH. A.Erlich. 1988. Primer-directedenzymaticamplificationof
DNAwithathermostableDNApolymerase.Science(Wash.DC).239:487-491. 39.Sanger, F.,S.Nicklen,andA.R.Coulson. 1977. DNAsequencingwith
chainterminatinginhibitors. Proc.Natl.Acad. Sci. USA.74:5463-5467.
40.Kogan,S.C.,M.Doherty,and J.Gitschier.1987.Animprovedmethod forprenataldiagnosisofgeneticdiseasesbyamplifiedDNAsequences.N.Engl.J.
Med.317:985-990.
41.Hoffman,N.,P.Stanislovitis,P.C.Watkins,K. W.Klinger,A.J.
Linnen-bach,and B.G.Forget.1987. Three RFLPsaredetectedbyan aspectringenomic
clone.NucleicAcids Res. 15:4696.
42.Speicher,D.W.,G.Davis,and V. T.Marchesi. 1983. Structure ofhuman
erythrocyte spectrin. II. The sequence of the a I domain. J. Biol. Chem. 258:14938-14947.
43.Schwaab, R.,M.Ludwig,J.Oldenburg,H. H.Brackmann,H.Egli,L.
Kochhan, andK.Olek. 1990. Identicalpoint mutationsin thefactor VIII gene that have different clinical manifestations ofhemophiliaA. Am.J. Hum. Genet. 47:743-744.
44. Nagel, R.L. 1990. Innateresistancetomalaria. Theintraerythrocytic
cycle. Blood Cells.16:321-348.
45.Nussinov,R.1981. Nearestneighbournucleotide patterns, structural and
biologicalimplications.J. Biol.Chem.256:8458-8462.
46.Cooper,D.N.,and M. Krawczak. 1989.Cytosinemethylationand the fate ofCpGdinucleotides invertebrategenomes. Hum. Genet. 83:181-188.
47.Barker, D.,M.Schaefer,andR.White. 1984.Restriction enzyme sites
containing CpGshowahigher frequencyofpolymorphismin humanDNA.Cell. 36:131-138.
48.Youssoufian, H.,H.H.Kazazian,D.G.Philips,S.Aronis,G.Tsiftis,
V. A.Brown, S. E. Antonarakis. 1986. Recurrent mutations inhaemophiliaA
giveevidenceforCpGmutationhotspots.Nature(Lond.).324:380-382. 49.Pattinson,J.K.,D.S.Millar,J. H.McVey,C.B.Grundy,K.Wieland,
R.S.Mibashan,U. Martinowitz,K. Tan-Un,M. Vidaud,M. Goossens,M.
Sampietro,P. M.Mannucci,M.Krawczak,J.Reiss,B.Zoll,D.Whitmore,S.
Bowcock,R.Wensley,A.Ajani,V.Mitchell,C.Rizza,R.Maia,P.Winter,E. E.
Mayne,M.Schwartz,P.J.Green,V.V.Kakkar,E.G. D.Tuddenham,and D. N.
Cooper.1990. The moleculargenetic analysisofhemophiliaA: adirected search strategy for the detection of pointmutations in the human factorVIIIgene.
Blood.76:2242-2248.
50.Hirschorn, R.,S.Tzall,andA.Ellenbogen. 1990. Hot spot mutations in adenosinedeaminasedeficiency.Proc.Natl. Acad. Sci. USA. 87:6171-6175.
51.Cooper,D. N.1983.EukaryoticDNAmethylation.Hum.Genet. 64:315-333.
52.Duncan,B.K.,and J. H.Miller. 1980.Mutagenicdeamination ofcytosine
residues in DNA. Nature(Lond.).287:560-561.
53.Coulondre, C.,J. H.Miller,P. J.Farabaugh,andW.Gilbert. 1978. Molec-ular basis of base substitution hotspotsinEscherichia coli. Nature(Lond.).
274:775-780.