• No results found

Eukaryotes. PSI Biology Eukaryotes & Gene Expression

N/A
N/A
Protected

Academic year: 2021

Share "Eukaryotes. PSI Biology Eukaryotes & Gene Expression"

Copied!
11
0
0

Loading.... (view fulltext now)

Full text

(1)

Eukaryotes The Eukaryotic Cell

Classwork

1. Identify two characteristics that are shared by all cells.

2. Suppose you are investigating a cell that contains a nucleus. Would you categorize this cell as a prokaryote or eukaryote? Explain your answer.

3. Is it more efficient for cells to have a high or low surface area to volume ratio?

Explain.

4. Explain, in terms of cell function, why it is more advantageous for cells to be small.

5. Organelles are to cells as organs are to the human body. Explain why this analogy is true.

Homework

6. What are two differences between prokaryotic and eukaryotic cells?

7. Would you be more likely to observe a prokaryotic cell or eukaryotic cell under the lowest magnification available on your microscope? Explain your answer.

8. Explain, in terms of surface area to volume ratio, why cells are small.

9. Identify the four major categories of eukaryotic cells.

The Nucleus and Gene Expression Classwork

10. Explain how the meaning of the terms prokaryote and eukaryote help explain the structure of the cell.

11. Why is it important that the nucleus of a cell contains nuclear pores?

12. How is it possible that even though all the cells of a multicellular organism contain the same DNA, there are many different types of cells that differ in structure and function?

13. How are chromosomes related to chromatin?

14. How does the ‘packing’ of DNA impact the process of gene expression in cells?

15. How does the presence of transcription factors influence the process of gene expression?

16. How is the presence of transcription factors related to external stimuli in an environment?

17. Explain the observable differences that would exist between a molecule of pre-mRNA and a finished molecule of mRNA?

18. In what way does the splicing of a molecule of mRNA alter the contents of the molecule? Be sure to use appropriate terminology.

19. How does alternative splicing affect the ability of a molecule of mRNA to produce multiple proteins?

20. Explain how nuclear pores are like the ‘gatekeepers’ of the nuclear membrane.

(2)

21. How does the length of a poly-A tail on mRNA impact the amount of protein can be produced from the mRNA?

22. Given the sequence of eukaryotic DNA below, transcribe the gene and complete all three steps of RNA processing. (Exons are bold)

Non-template strand:5’ATTATGGGCATATATCCGGCGCCTTAATTATTC3’

Template strand: 3’TAATACCCGTATATAGGCCGCGGAATTAATAAG5’

23. How is the process of transcription related to the process of translation in the cell?

Homework

24. Why is the nucleus often referred to as the ‘control center’ of the cell.

25. Is the process of gene expression the same in prokaryotes as it is in eukaryotes? Explain your answer.

26. What is the difference between prokaryotic and eukaryotic DNA?

27. What role do histones play in the packing of DNA?

28. How is the presence of transcription factors related to the characteristics that define living organisms?

29. Identify the purpose of the modification of pre-mRNA by adding the nucleotide cap and poly-A tail.

30. Why are coding segments of mRNA referred to as ‘exons?’

31. Explain how alternative splicing allows a cell to produce different proteins from the same segment of mRNA.

32. Given the sequence of eukaryotic DNA below, transcribe the gene and complete all three steps of RNA processing. (Exons are bold)

Non-template strand:3’GGCCGGCTATAATCGATACTTACGAATGTAAAA5’

Template strand: 5’CCGGCCGATATTAGCTATGAATGCTTACATTTT3’

33. What role do hydrolytic enzymes play in the production of protein in a cell?

Endomembrane System Classwork

34. What are the components of the ‘endomembrane system?’

35. How does the role of the smooth endoplasmic reticulum relate to the amount of smooth E.R. found within different types of cells?

36. Explain the progression of a protein through the endomembrane system of a cell.

37. Compare the Golgi apparatus to a component of a city or town, based on the function of the organelle.

38. How is the creation of lysosomes related to the Golgi apparatus?

39. How is a peroxisome related to a lysosome?

40. Why are cell membranes often referred to as semipermeable?

(3)

41. Identify and explain the process by which large proteins created in the cell are transported to the extracellular environment?

42. What is a ‘secretory protein?’

Homework

43. Identify the relationship between ribosomes and the rough endoplasmic reticulum.

44. How does a glycoprotein help determine the role of a protein within a cell?

45. What is the function of the Golgi apparatus in the process of protein production within a cell?

46. Identify three different cellular functions accomplished by the smooth E.R.

47. What is the purpose of lysosomes for the cell?

48. What function do peroxisomes perform for the cell?

49. What role might a protein play that is created within the cell and becomes embedded in the cell membrane?

50. Why is endocytosis important for efficient cellular function?

Energy-Converting Organelles Classwork

51. Explain the structure of a chloroplast, identifying the areas where the light reactions and Calvin cycle occur.

52. What is the function of the mitochondria for the cell?

53. Do prokaryotic cells contain mitochondria? Explain your answer.

54. Both mitochondria and chloroplasts contain highly folded internal

membranes. Explain the importance of these membranes for the organelle, including the importance of the folded nature.

55. Briefly summarize the endosymbiotic theory as proposed by Lynn Margulis.

56. According to the endosymbiotic theory, before they were eukaryotic organelles, the chloroplast and mitochondria more closely resembled what type of organism?

57. Why is mitochondrial DNA utilized to trace maternal heritage?

Homework

58. Identify the role of the chloroplast for a plant cell.

59. Do plant cells contain mitochondria even though they are photosynthetic?

Explain your answer.

60. Explain the meaning of the term endosymbiosis.

61. What is the evidence used to support the endosymbiotic theory?

62. What is the ‘mitochondrial eve?’

63. Why do organisms receive all of their mitochondrial DNA from their mother?

Other Organelles and Cellular Structures Classwork

64. How is the central vacuole of a plant cell related to wilting?

65. How do a food vacuole and lysosome help to digest particles within a cell?

66. What is the role of a contractile vacuole in a cell?

(4)

67. How are sugars related to the cell wall of plant cells?

68. Why is it important that adjacent plant and animal cells contain cell junctions?

69. Suppose you are investigating a cell that contains plasmodesmata. Would you label this cell as a plant or animal cell? Explain your answer.

70. Which sort of cell junction would you most likely observe between adjacent cells that cannot experience leakage? What type of cells may you be

observing?

71. If animal cells need to transport ions and sugars, what sort of cell junction would you predict they would utilize? Support your response.

Homework

72. What is a vacuole?

73. How is a central vacuole related to turgor pressure in a cell?

74. What is a cytoskeleton and what does it do for the cell?

75. Compare and contrast the external structure of plant cells and fungi.

76. What role does the extracellular matrix provide for a group of cells?

77. Do plant and animal cells contain the same type of cell junctions? Why or why not?

78. Finish the following analogy. Plasmodesmata: plant cells:: __________________:

animal cells.

79. Identify three differences between the structure of plant and animal cells.

Free Response

1. Most eukaryotes are multicellular organisms. Explain why a large organism must consist of many cells, by responding to the prompts below:

a. The amount of chemical activity in a cell is determined by which characteristic, and why?

b. The amount of substances that can enter and leave a cell are determined by which characteristic and why?

c. As a cell grows in size, explain how its surface area to volume ratio is affected.

(5)

2. Below is an illustration of transcription. Respond to the prompts below based upon this illustration.

http://ajplung.physiology.org/content/277/4/L667

a. In this illustration we can see that an external signal (1) activates a membrane bound protein called a receptor. In step 2, what is the molecule that is produced?

b. How do the molecules produced in step 2 interact with DNA?

c. What is the role of the molecules produced in step 2, in the process of transcription?

3. The illustration below represents the steps of mRNA processing. Use this illustration to respond to the prompts below.

a. Identify and describe the alteration of the mRNA end labeled “1”.

b. Identify and describe the alteration of the mRNA end labeled “2”.

c. Describe what has occurred during the step labeled “3”. How and why has the mRNA been changed?

1 2

3

(6)

4. The theory of endosymbiosis states that the mitochondria and chloroplast were once free-living prokaryotes that were taken up by another prokaryote.

a. Explain the four pieces of evidence that support this theory.

5. Mitochondrial Eve is the first human female that gave rise to all humans.

a. From whom do eukaryotic organisms inherit their mitochondria and therefore their mitochondrial DNA?

b. Explain why the mitochondrial DNA can only be inherited from one parent.

(7)

Eukaryotes Answer Key

1. Plasma membrane, chromosomes, cytoplasm, ribosomes 2. Eukaryote, prokaryotic cells do not have a nucleus

3. High. A higher ratio keeps cells small, and allows for more efficiency in moving substances in and out of the cell, and an overall more efficient cell 4. Cells need to be small because they need to be able to move substances in

and out of the cell at a fast enough rate to sustain life and conduct the chemical processes necessary to support life

5. Organelles are structures within a cell that perform a certain task for the cell, just as an organ is a structure within the body that performs a certain task for the body

6. Prokaryotes lack a nucleus, lack all membrane bound organelles, are smaller than eukaryotes, evolved earlier than eukaryotes, have a single, circular chromosome

7. A eukaryotic cell. Because eukaryotes are much larger than prokaryotes, you would be more likely to see a eukaryotic cell under the lowest power on your microscope

8. The smaller the cell, the higher the surface area to volume ratio. Smaller cells are more efficient because substances can be transported in and out of the cell at a much higher rate in a small cell than a large cell

9. Animal, plant, fungi, protist

10. Prokaryote means ‘before nucleus’ and eukaryotes means ‘true nucleus’

11. Ribosomes are produced in the nucleus, as is mRNA, the nuclear pores allow for these molecules to leave the nucleus

12. Different segments of DNA can be activated or deactivated, leading to specialization and differentiation of cells, depending on what segment of DNA is activated, the cell will develop and perform differently

13. Chromatin is chromosomes tightly packed and condensed, wound around histone proteins

14. DNA packed in chromatin cannot be accessed by RNA polymerase and thus cannot be transcribed

15. Transcription factors have the ability to determine which segments of DNA are transcribed and which are not

16. Transcription factors can be produced according to environmental cues, allowing an organism to respond to environmental stimuli

17. Finished mRNA would have a 5’ G cap and a poly-A tail, the pre-mRNA does not have these features

18. Splicing removes segments called introns and joins together segments called exons

19. Alternative splicing allows one molecule of mRNA to change which segments are treated as exons, so it can produce multiple proteins depending on which exons are used

20. Nuclear pores keep the interior of the nucleus separate from the rest of the cell, but also allow necessary molecules to leave the cell.

(8)

21. The longer the poly-A tail, the longer an mRNA molecule can produce

protein. When the poly-A tail degrades, the mRNA can no longer be used for translation

22. 5’AUUAUGGGCAUAUAUCCGGCGCCUUAAUUAUUC3’

5’GAUGGGCAUGCGCCUAUUCAAAAA3’

23. Transcription produces the mRNA that will be used for the process of translation

24. The nucleus contains the DNA, which contains the instructions for creating proteins and regulating cell development and function

25. Not entirely, because prokaryotes do not have a nucleus, the transcription process occurs in within the cytoplasm of the cell

26. Prokaryotic DNA is circular in nature while eukaryotic DNA is linear 27. Histones are proteins around which the DNA is wound, allowing it to pack

more tightly

28. Transcription factors allow an organism to respond to environmental stimuli, which is one of the characteristics of life

29. The cap and tail help the mRNA to leave the nucleus, protect the coding segments from deterioration by enzymes and make it easier for ribosomes to bind to the mRNA

30. ‘Exons’ receive their name because they are the segments of RNA that are

‘expressed’

31. Alternative splicing allows the mRNA to rotate the segments that will be expressed into proteins, so the same segment may produce multiple proteins through multiple exon combinations

32. 3’GGCCGGCUAUAAUCGAUACUUACGAAUGUAAAA5’

3’AAAAGGCCUAAUCACGAAUGUAG5’

33. Hydrolytic enzymes break down the mRNA in the cytoplasm, so each

molecule will only have time to produce a certain amount of protein before it is degraded

34. Nucleus, rough endoplasmic reticulum, smooth endoplasmic reticulum, golgi apparatus, plasma membrane, lysosomes

35. The smooth E.R. detoxifies substances for the cell, therefore cells in the body that are exposed to toxic substances, such as the liver, have a higher

proportion of smooth E.R. than other cells

36. A protein is made on a ribosome on the rough E.R., enters the E.R., is modified and then packaged into a vesicle where it is transported to the Golgi, modified and repackaged, and then either stays in the cell or exits the cell through the cell membrane

37. The Golgi is like a UPS store, in that it accepts proteins, modifies and repackages them, and then redistributes them throughout the cell

38. The Golgi produces vesicles containing powerful digestive enzymes called lysosomes.

39. A peroxisome is a lysosome that is specialized to break down hydrogen peroxide for the cell.

40. Semipermeable means that they allow some things to pass while keeping

(9)

41. Exocytosis- the vesicle containing the proteins binds with the cell membrane and in doing so releases its proteins to the extracellular environment

42. A secretory protein is a protein that is secreted out of the cell 43. Ribosomes are attached to the surface of the rough E.R.

44. They work like a label to identify where the protein will function in or out of the cell.

45. The Golgi modifies and repackages proteins for the cell 46. Calcium storage, detoxification, produce lipids

47. Lysosomes help to break down and recycle old organelles, help digest food and can be used to protect the cell from infection.

48. They break down hydrogen peroxide for the cell

49. It is likely to be used in transporting substances in and out of the cell

50. Endocytosis allows the cell to absorb necessary substances that are too large to move across the membrane

51. A chloroplast is a disk-shaped organelle contained within a double membrane, which is filled with a jellylike substance called stroma and contains stacks of smaller disks called thylakoids. The light reactions occur within the thylakoid membranes, the Calvin Cycle occurs in the stroma 52. Produces ATP for the cell

53. No, mitochondria are membrane bound organelles, and prokaryotes do not contain any membrane bound organelles

54. The membranes allow for a concentration gradient to be created which is used by both of these organelles to accomplish their task. The folded nature of the membranes increases surface area, allowing for more efficiency in production

55. Mitochondria and chloroplasts were once prokaryotic cells, over time they were engulfed by other prokaryotic cells, which would eventually become eukaryotes, and they continued to produce ATP and conduct photosynthesis within their host cell, developing into the organelles that they are today 56. Prokaryotes

57. Mitochondria produce other mitochondria, since mtDNA is found only in the mitochondria, and we receive all of our mitochondria from our mother, the mtDNA remains relatively unchanged for generations

58. Conduct photosynthesis and produce sugar for the cell

59. Yes, even though they can produce their own sugar, they still need mitochondria to convert the sugar to usable ATP

60. Endosymbiosis is one organism living within another organism

61. Mitochondria and chloroplasts have their own DNA and ribosomes, they reproduce on their own and they are approximately the same size as a prokaryotic cell

62. The first female human on Earth

63. The egg cell contains mitochondria, the sperm cell that fertilizes the egg does not contribute any mitochondria. All mitochondria in the body are derived from these mitochondria

(10)

64. The central vacuole provides turgor pressure for the plant cell, increasing rigidity and preventing wilting. If the vacuole does not have enough water, it will lose turgor pressure and the plant will wilt

65. A lysosome can bind to a food vacuole and release its enzymes into the vacuole to aid in digestion

66. The contractile vacuole is used to pump water out of the cell 67. Cellulose, a sugar, is the primary component of the cell wall

68. Cell junctions allow adjacent cells to communicate and transport substances back and forth

69. Plant cell. Animal cells do not contain plasmodesmata

70. Tight junctions, animal cells that cannot allow leakage utilize tight junctions- stomach and epithelial lining use these

71. Gap junctions- these work almost like pores that can open and close to allow substances to pass.

72. Membranous sacks found in plant and animal cells that perform a variety of functions

73. The central vacuole is the organelle that creates turgor pressure for the plant cell based on the amount of water it contains

74. A cytoskeleton is a system of tubules and filaments that is used for structure, support and movement

75. Both have cell walls, plant cell walls are composed of cellulose, fungi of chitin 76. Structural support, healing, communication, tissue separation

77. No. plant cells use plasmodesmata, because they have a cell wall, animal cells have tight junctions, gap junctions and adhering junctions

78. Gap junctions

79. Plant cells have cell walls, chloroplasts, central vacuole. Animal cells lack each of these features but do contain centrioles, which plants do not 1. Cell Size

a. The amount of chemical activity in a cell is determined by its volume.

If the volume is too large, then interactions are fewer, distances molecules must travel are farther. Therefore the cell must have enough volume to contain cell organelles, nutrients, water, and for materials to move, but not so large that materials cannot reach their destination.

b. The amount of substances that can enter and leave a cell are

determined by the cell’s surface area. The surface area must be large enough that transfer into and out of the cell provides the nutrients and molecules required to maintain equilibrium. Too small a sruafce area would not apply enough movement to support the volume of the cell.

c. As a cell grows in size, the relationship between its surface area and volume changes. This ratio changes such that the surface area becomes smaller relative to the volume of the cell (or stated

differently, the volume increases more rapidly than the surface area).

(11)

At some point the materials needs to move into and out of the cell can’t do so effectively enough to support the processes within the cell.

2. Gene Expression

a. the molecule produced is a transcription factor

b. transcription factors can bind with DNA near the promoter region of a gene. The combination of the transcription factor and RNA

polymerase initiates the transcription of that gene.

c. The transcription factors allow an external signal or stimulus to initiate the transcription of a particular gene, whose protein is needed by the cell.

3. RNA Processing

a. the mRNA end labeled 1 is the 5’ end of the pre-mRNA molecule. A nucleotide cap is attached to this 5’ end. This helps the ribosomes attach to the mRNA so that translation can begin and it protects the mRNA from hydrolytic enzymes.

b. The 3’ end of the pre-mRNA receives a “poly A tail”. This is the addition of a series of adenosine nucleotides.

c. The pre-mRNA is altered by the removal of introns (intervening nonecoding regions) leaving the exons (the expressed coding

regions). Essentially the non-coding is removed to leave a continuous coding sequence in the mature mRNA.

4. Mitochondria and chloroplasts can only arise from existing mitochondria and chloroplasts. A cell without these structures cannot produce them.

Mitochondria and chloroplasts have their own DNA, that resembles bacterial DNA. Mitochondria and chloroplasts have a single circular DNA strand, identical to the DNA found in prokaryotes. Mitochondria and chloroplasts synthesize their own proteins utilizing their own mechanisms. These mechanisms are similar to those found in bacteria.

5. Mitochondria

a. eukaryotic cells and therefore eukaryotic organisms inherit their mitochondria from the female contribution.

b. mitochondria are carried within the female egg contribution to

offspring. The male sperm cell contains a portion of the DNA from the nucleus. The sperm cells are small and do not carry any organelles however, the much larger egg contributes a portion of the DNA from the nucleus as well as the mitochondria, containing the mitochondrial DNA

References

Related documents

The focus of the plantar fasciitis and exercise webinar will be exercise program design and exercises for a client that has plantar fasciitis..

Reduced decision cost Reduced decision time Better knowledge processing Effective decisions Competitive advantage Stakeholders’ satisfaction Providing experiments and

In this study, I examined the perceptions of the administrators and staff regarding whether or not the bullying prevention program implemented at the target school helped to

Next, it appeared that indeed both mental states could be estimated from the EEG spectral features of each operator with classification accuracies above the adjusted chance level

For example, specifying date parameters in an advanced search screen (when conducting a metadata search) might not produce the expected results if the user is unaware that there

We have examined the effects of tax and transfer programs in a model charac- terized by idiosyncratic shocks and incomplete markets, with a particular focus on assessing the extent

Though, the Northern League was a populist party and thus against the government of Rome, Bossi decided to walk the fine line populists face and become intertwined in politics

These can be split in principle split into three components: diverted demand, which derives from the travelers’ mode choice diversion toward HSR either from other modes (e.g.