Adenoviral vector
Switching a Replication-Defective Adenoviral Vector into a Replication-Competent, Oncolytic Adenovirus
... RD vector that would be much less toxic and provide it with replication competence only when or where needed by provision of Flp may provide an avenue for mak- ing cancer gene and viral therapy ...“gutless” ...
9
Protective Efficacy and Immunogenicity of an Adenoviral Vector Vaccine Encoding the Codon-Optimized F Protein of Respiratory Syncytial Virus
... Protection against RSV-challenge. Three weeks after boost immunization animals were challenged with RSV intranasally. Five days after challenge, when the viral load peaked in the lungs, animals were sacrificed and BALs ...
10
Selection of Muscle-Binding Peptides from Context-Specific Peptide-Presenting Phage Libraries for Adenoviral Vector Targeting
... the vector to mediate binding to the cells of ...for adenoviral vectors, we have engineered a “context-specific” peptide-presenting phage ...ligand-modified adenoviral vector that mediated ...
6
Detection of Transgenes in Gene Delivery Model Mice by Adenoviral Vector Using ddPCR
... For acute experiments, total DNA was extracted from collected stool, plasma, and blood cell 224.. fractions.[r] ...
14
Improvement of adenoviral vector-mediated gene transfer to airway epithelia by folate-modified anionic liposomes
... airway epithelium, we investigated the function of EDTA on transduction. It was known that the CAR was located at the basolateral side of airway epithelia, and the tight junctions (TJs) play a central role in sealing the ...
11
Increased Mucosal CD4+ T Cell Activation in Rhesus Macaques following Vaccination with an Adenoviral Vector
... Adenovirus vector vaccination increases the frequency of ac- tivated memory CD4 ⴙ T cells in the rectal mucosa. To determine whether SAdV-7 vaccination affected the activation state of total CD4 ⫹ T cells in the ...
11
Prophylactic and therapeutic adenoviral vector-based multivirus-specific T-cell immunotherapy for transplant patients
... vaccine vector has the potential to reduce the cost associated with developing a vaccine platform for each ...Ad-MvP vector also has potential use as a vaccine vehicle to induce memory T-cell immunity ...
9
Characterization of transgene expression in adenoviral vector based HIV 1 vaccine candidates
... Figure 3 Normalizing total virus concentration with Ad5 empty vectors and impact on transgene expression. A549 cells were infected as de- scribed in figure 1. Detection of gag (A), pol (B), and nef (C) transgene ...
7
Regulated and Liver-Specific Tamarin Alpha Interferon Gene Delivery by a Helper-Dependent Adenoviral Vector
... HD vector constitutively expressing woodchuck IFN- ␣ under the control of TTR liver-specific promoter were described by our group in the woodchuck hepatitis model ...IFN vector in vitro ...same ...
9
Cre Levels Limit Packaging Signal Excision Efficiency in the Cre/loxP Helper-Dependent Adenoviral Vector System
... Three lines of evidence indicated that the contaminating helper viruses were not Cre-resistant mutants. First, like the parent virus, their plaque-forming ability was about 10-fold lower in 293Cre4 cells compared to 293 ...
9
Chromosomal Integration of Adenoviral Vector DNA In Vivo
... Ad vector integra- tion would result in the inactivation of genes is relatively ...the vector genome, can activate genes in the neighborhood of the integration side, although we believe that this may well ...
8
A New Hybrid System Capable of Efficient Lentiviral Vector Production and Stable Gene Transfer Mediated by a Single Helper-Dependent Adenoviral Vector
... LA vector system, an HDAdV was used because of its large cloning capacity (up to 35 kb) ...LA vector to regulate LV ...the vector and thus reduce leaky expres- sion of the lentiviral proteins (10, ...
8
Epithelium-specific Ets transcription factor-1 acts as a negative regulator of cyclooxygenase-2 in human rheumatoid arthritis synovial fibroblasts
... helper‑dependent adenoviral vector; cDNA: complementary deoxyribonucleic acid; C/EBP: CAAT enhancer binding protein; COX‑2: cyclooxygenase‑2; CRE: cyclic AMP response elements; DEAE‑Dextran: ...
12
Adenoviral mediated gene transfer to fetal pulmonary epithelia in vitro and in vivo
... recombinant adenoviral vectors to test the feasibility of gene transfer to the fetal pulmonary epithelium in vitro and in ...the adenoviral vector directly into the trachea of fetal lambs, the lacZ ...
14
Phase I trial of recombinant adenovirus gene transfer in lung cancer Longitudinal study of the immune responses to transgene and viral products
... mouse, adenoviral vec- tors have been successfully used as vaccine vectors to immu- nize against a variety of viral pathogens (18, ...recombinant adenoviral vector allows for efficient immunization ...
10
Increased BST2 expression during simian immunodeficiency virus infection is not a determinant of disease progression in rhesus monkeys
... Ad: adenoviral vector; AIDS: acquired immune deficiency syndrome; APC: allophycocyanin; APOBEC: apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like; ART: antiretroviral therapy; BST2: bone ...
14
Reversal of impaired wound repair in iNOS deficient mice by topical adenoviral mediated iNOS gene transfer
... of adenoviral vector origin were used to detect transferred iNOS expression in some ex- ...9 adenoviral splice site, while the 3 9 primer (3 9 - TGGCCTTATGGTGAAGTGTGT) is complementary for human iNOS ...
6
Development of an Adenovirus-Based Respiratory Syncytial Virus Vaccine: Preclinical Evaluation of Efficacy, Immunogenicity, and Enhanced Disease in a Cotton Rat Model
... The RSV fusion glycoprotein (RSV-F) is a major target antigen for induction of humoral and cellular protective immunity. F pro- tein is highly conserved between RSV subtype A and B strains. In previous studies, different ...
10
Readministration of Adenovirus Vector in Nonhuman Primate Lungs by Blockade of CD40-CD40 Ligand Interactions
... in adenoviral vector-mediated immune responses to rhesus ...to adenoviral vectors and the ability to readminister vector were studied in rhesus monkeys in the presence or absence of a ...
8
Enhanced Breadth of CD4 T-Cell Immunity by DNA Prime and Adenovirus Boost Immunization to Human Immunodeficiency Virus Env and Gag Immunogens
... replication-defective adenoviral (ADV) vectors encoding foreign antigens has proven particularly effective in eliciting enhanced cellular and humoral immunity compared to either agent ...Because adenoviral ...
8