Angiotensin-converting enzyme gene
“The Relationship between the Insertion/Deletion Polymorphism of the Angiotensin-Converting Enzyme Gene and Myocardial Infarction in Algerian Population” by Ouarda Semmame, Noreddine Abadi, Djallila Chellat, Hadia Ziada, Yasmina Benchabi, Algeria.
... In the coronary artery diseases (CAD), there are many genes whose products are involved in the development of the disease and for which a genetic polymorphism has been described. Among these, the gene for the ...
6
Assessment of Angiotensin-Converting Enzyme Gene in Idiopathic Pulmonary Fibrosis
... At initial phase of PCR two primers were used: ACE 1 (5'-cat cct ttc tcc cat ttc tc-3') as forward primer (TIB MOL BIOL, GER) and ACE 3 (5'-att tca gag ctg gaa taa aat t-3') as reverse primer to amplify outside of the ...
7
High frequency of the D allele of the angiotensin converting enzyme gene in Arabic populations
... The human population samples used for this study have been described previously and were available from previ- ous studies [13]. The samples studied were collected from unrelated individuals from three Arab populations: ...
5
Angiotensin-converting enzyme gene insertion/deletion polymorphism in migraine patients
... μL, enzyme activation at 94°C for 20 min, denaturation at 94°C for 1 min, annealing at 58°C for 1 min and extension at 72°C for 2 min for a total of 32 ...with enzyme activation at 95°C for 10 min, ...
5
Association between an angiotensin-converting enzyme gene polymorphism and Alzheimer’s disease in a Tunisian population
... D versus I as risk factors) given the dual activities of ACE (cleavage of Aβ versus possible vascular dysfunction via endothelia damage). The proposals include a theory of homeostasis disruption whereby increased levels ...
8
Effect of Flavourzyme® on Angiotensin-Converting Enzyme Inhibitory Peptides Formed in Skim Milk and Whey Protein Concentrate during Fermentation by Lactobacillus helveticus
... bioactive peptides produced by protease-facilitated lactic acid fermentation of milk. The angiotensin-converting enzyme gene family: Genomics 558[r] ...
30
Genetic influences on right ventricular systolic pressure (RVSP) in chronic obstructive pulmonary disease (COPD)
... Kanazawa H, Okamoto T, Hirata K, Yoshikawa J: Deletion polymorphisms in the angiotensin converting enzyme gene are associated with pulmonary hypertension evoked by exercise challenge in [r] ...
9
Insertion/Deletion Gene Polymorphism and Serum Level of Angiotensin Converting Enzyme
... 5. Rigat B, Hubert C, Corvol P, Soubrier F. PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). Nucleic ...
5
ANGIOTENSIN I CONVERTING ENZYME GENE POLYMORPHISM IN PATIENTS WITH CHRONIC RENAL FAILURE
... angiotensinogen gene (AGT), the angiotensin converting enzyme gene (ACE) and the aldosterone synthase gene (CYP11B2) are of particular ...
11
Insertion/Deletion Polymorphisms and Serum Angiotensin-converting Enzyme Levels in Iranian Patients with Sarcoidosis
... DNA extraction and PCR amplification PCR was used to identify I and D alleles, a seg- ment from the Intron 16 on ACE gene that the size fractionation was detected by electrophore- sis. Genomic DNA was extracted ...
8
Impact of I/D polymorphism of angiotensin converting enzyme (ACE) gene on myocardial infarction susceptibility among young Moroccan patients
... ACE gene polymorphism may be associated with MI sus- ceptibility in Moroccan ...ACE gene was not associated with MI risk among the total of analyzed patients (all ages ...
6
ACE insertion/deletion polymorphism and diabetic nephropathy: an evidence-based meta-analysis
... The angiotensin-converting enzyme (ACE) gene, located on chromosome 17, expressed in a vast variety of tissues, including lungs, vascular endothelium, kidney, heart and testicles, has been the ...
11
The critical role of tissue angiotensin converting enzyme as revealed by gene targeting in mice
... Angiotensin-converting enzyme (ACE) generates the vaso- constrictor angiotensin II, which plays a critical role in maintenance of blood pressure in ...the enzyme is bound to tissues ...
12
Angiotensin-converting enzyme I/D polymorphism in chronic obstructive pulmonary disease
... Polymerase chain reaction (PCR) was used to deter- mine the genotype of the ACE gene. As it has been described, that in some cases the insertion-allele is not amplified by the primer-pair we used in the first ...
5
Evaluation of G2350A Polymorphism of the Angiotensin-Converting Enzyme (ACE) Gene in Chronic Kidney Disease
... polymorphisms (I/D, G2350A and A–240T) in ACE gene with the risk of CKD, but the results were inconsistent and contradictory. In this regard, the association based studies have indicated that ACE I/D polymorphism ...
5
Angiotensin converting enzyme as a genetic risk factor for coronary artery spasm Implication in the pathogenesis of myocardial infarction
... the angiotensin converting enzyme (ACE) gene are at greater risk for myocardial infarction (MI), especially among subjects normally considered to be at low ...
6
Original Article Meta-analysis of the association between angiotensin-converting enzyme I/D polymorphism and chronic obstructive pulmonary disease risk
... [18] Ulasli SS, Eyuboglu FO, Verdi H, Atac FB. Asso- ciations between endothelial nitric oxide syn- thase A/B, angiotensin converting enzyme I/D and serotonin transporter L/S gene polymor- ...
6
The relationship of the factor V Leiden mutation or the deletion deletion polymorphism of the angiotensin converting enzyme to postoperative thromboembolic events following total joint arthroplasty
... V gene that includes nucleotide 1691 was amplified utilizing the polymerase chain reaction (PCR) with the forward prim- er 5'CATACTACAGTGACGTGGAC3' and the reverse primer ...
6
Angiotensin-converting enzyme genotype and late respiratory complications of mustard gas exposure
... Renin Angiotensin System (RAS) has been implicated in lung inflammatory and fibrotic ...the gene coding for the Angiotensin Converting Enzyme (ACE), specifically the Insertion/Deletion ...
5
Resveratrol inhibits growth of experimental abdominal aortic aneurysm associated with upregulation of angiotensin-converting enzyme 2
... (QT00034055), Sirt1 (QT00051261), NFKB1 (QT00063791), and AGTR1 (QT00233548) in human tissue samples and AoSMC, and ACE2 (QT00111293), Sirt1 (QT01055642), Nfkb (QT00154091), Agtr1 (QT00261464), Col1a1 (QT00162204), ...
34