Bcr/Abl and the PI3 kinase pathway
BCR ABL KINASE INHIBITORS FOR CANCER THERAPY
... ABSTRACT BCR-ABL tyrosine kinase inhibitors have started era of molecular targeted therapy and marked a greatest milestone in cancer drug ...tyrosine kinase activity of the ...
11
BCR ABL kinase is dead; long live the CML stem cell
... This is not to say that targeting the CML stem cell is impossible or should be cast off as a therapeutic goal. Eight-year survival for a previously uniformly fatal disease is a wonderful result of imatinib therapy, but ...
5
Combination of the ABL kinase inhibitor imatinib with the Janus kinase 2 inhibitor TG101348 for targeting residual BCR-ABL-positive cells
... STAT5 pathway [27]. We demonstrated that inhibiting JAK2 by either JAK2 siRNA transfection or the JAK2 in- hibitor TG101348 downregulated STAT5 activity. More- over, STAT5 phosphorylation decreased considerably ...
11
Design of substrate-based BCR-ABL kinase inhibitors using the cyclotide scaffold
... against Abl kinase, the grafted peptides MTAbl06, MTAbl07, MTAbl13, and MTAbl15 showed no significant effect on the growth of K562 cells when administered at concentrations up to 64 μ ...reach ...
15
Activity of histone deacetylase inhibitors and an Aurora kinase inhibitor in BCR-ABL-expressing leukemia cells: Combination of HDAC and Aurora inhibitors in BCR-ABL-expressing cells
... of HDAC proteins (Figure 2A). As such, our data indicated that vorinostat or pracinostat and tozasertib affected the activities of both Aurora kinase and HDAC, in turn in- creasing antitumor activity in this ...
9
Combination of Bortezomib and Mitotic Inhibitors Down-Modulate Bcr-Abl and Efficiently Eliminates Tyrosine-Kinase Inhibitor Sensitive and Resistant Bcr-Abl-Positive Leukemic Cells
... sensitive Bcr-Abl-positive leukemic ...inhibit Bcr-Abl activity and its downstream signaling, and to activate caspase-dependent cell ...by Bcr-Abl protein overexpression or ...
15
Sequential ABL kinase inhibitor therapy selects for compound drug resistant BCR ABL mutations with altered oncogenic potency
... targeted kinase inhibitor cancer therapies are currently administered sequentially rather than ...oncogene BCR-ABL. Analysis of BCR-ABL genotypes in CML patients who relapsed after ...
9
Sequential ABL kinase inhibitor therapy selects for compound drug-resistant BCR-ABL mutations with altered oncogenic potency
... targeted kinase inhibitor cancer therapies are currently administered sequentially rather than ...oncogene BCR-ABL. Analysis of BCR-ABL genotypes in CML patients who relapsed after ...
8
Importance of adherence to BCR-ABL tyrosine-kinase inhibitors in the treatment of chronic myeloid leukemia
... Myelosuppression is observed in a significant proportion of CML patients treated with TKIs, especially among those with more advanced disease, and in those receiving dasatinib or nilotinib after previous imatinib ...
6
The Effect of Bcr-Abl Protein Tyrosine Kinase on Maturation and Proliferation of Primitive Haematopoietic Cells
... initial Bcr-Abl translocation event occurs in primitive multipotent stem cells and acquisi- tion of Bcr-Abl has been demonstrated in all pop- ulations of stem cells investigated so far, ...
11
Pharmacophore mapping: Prediction of BCR–ABL kinase inhibitory activity of α-benzylthio chalcones
... predicted BCR–ABL tyrosine kinase inhibitory activity of training set molecules on the pharmacophore hypothesis HNRRR 1501 are shown in Table 5 ...predicted BCR–ABL tyrosine ki- nase ...
6
E2A/PBX1, MLL/AF4, BCR/ABL (M-BCR), BCR/ABL(m-BCR) gene rearrangements in acute lymphoblastic leukemia in Iranian children
... TTCCCCATTGTGATTATAGCCTA ABL-a3-E3’ 505 (23) TGACTGGCGTGATGTAGTTGCTT the data for all morphologic, immunologic and genetic studies of cases for diagnosis as well as the outcomes of sev- eral years’ treatment with ...
8
BCR: a new target in resistance mediated by BCR/ABL-315I?
... of BCR/ABL [1, 34, ...of BCR seen in the presence of the T315I substitutes for the role of the Y177 in BCR/ABL itself and adopted by the endogenous ...endogenous Bcr by RNAi not ...
11
Subcellular localization of Bcr, Abl, and Bcr Abl proteins in normal and leukemic cells and correlation of expression with myeloid differentiation
... of Bcr, Abl, and Bcr-Abl proteins in leukemic cell lines and in fresh human leukemic and normal samples at various stages of myeloid ...
16
Therapeutic approaches to enhance the BCR-ABL tyrosine kinase inhibitors efficacy in chronic myeloid leukemia
... product, BCR-ABL, a constitutively expressed tyrosine kinase that is present in the majority of the ...a BCR-ABL tyrosine kinase inhibitor (TKI) which dramatically increased the ...
12
Analysis of BCR/ABL transcripts in healthy individuals
... of BCR/ABL in healthy subjects between 20 and 80 years of age, while Bose et ...of BCR/ABL and its mechanisms of interaction with cellular components have also been ...
5
Bcr Abl regulates phosphatidylinositol 3 kinase p110gamma transcription and activation is required for proliferation and drug resistance
... The BCR-ABL oncogene is the hallmark of chronic myeloid leu- kemia, a clonal hematopoietic stem cell ...disorder. BCR-ABL displays constitutive tyrosine kinase activity, required for ...
10
Upregulation of the TGFβ signalling pathway by Bcr-Abl: Implications for haemopoietic cell growth and chronic myeloid leukaemia
... by Bcr-Abl, which would suggest that one of the mechanisms by which Bcr-Abl promotes the transforma- tion of haemopoietic progenitor cells, is by influencing the level of TGFb signalling ...
6
A Critical Role of CDKN3 in Bcr-Abl-Mediated Tumorigenesis
... of Bcr- Abl-mediated transformation of FDCP1 cells to growth factor ...in Bcr-Abl-mediated leukemogenesis, and provide new insights into diagnostics and therapeutics of the ...
12
Induction of apoptosis by directing oncogenic Bcr-Abl into the nucleus
... chimeric Bcr-Abl oncoprotein, which causes chronic myeloid leukemia, mainly localizes in the cytoplasm, and loses its ability to transform cells after moving into the ...convert Bcr-Abl to be ...
12