• No results found

CT cisternography

Air CT cisternography and canalography for small acoustic neuromas

Air CT cisternography and canalography for small acoustic neuromas

... Despite wid e acceptance of Pantopaque cisternography I canalography as the definitive study for d iagnosis o r exclusion of acoustic neuromas, the examination frequently yields false-po[r] ...

7

Brainstem Evaluation with CT Cisternography

Brainstem Evaluation with CT Cisternography

... Abnormal Brainstem In the 2 year period of review, nine patients with progressive brainstem and/or cranial nerve disease had radiographic studies demonstrating brainstem enlargement.. Br[r] ...

6

The value of metrizamide CT cisternography in the management of cerebral arachnoid cysts

The value of metrizamide CT cisternography in the management of cerebral arachnoid cysts

... LP: MTZ into cyst only; ventriculogram: OP = 130 mm H 2 0; cyst communicat ion with ventricles LP after cyst biopsy and shunt; late filling of cyst by diffusion 1 Not performed; 2 MTZ in[r] ...

7

Intrathecal Gadolinium Enhanced MR Cisternography: A Comprehensive Review

Intrathecal Gadolinium Enhanced MR Cisternography: A Comprehensive Review

... ⫽ CT cisternography; CTM ⫽ CT myelography; ETV ⫽ endoscopic third ventriculostomy; Gd ⫽ gadolinium; Gd-DTPA ⫽ gadopentetate dimeglumine; IHS ⫽ intracranial hypotension syndrome; ICP ⫽ intracranial ...

9

Gadolinium Enhanced MR Cisternography to Evaluate Dural Leaks in Intracranial Hypotension Syndrome

Gadolinium Enhanced MR Cisternography to Evaluate Dural Leaks in Intracranial Hypotension Syndrome

... compare CT, RC, spinal MR imaging, or intrathecal gadolinium-injected MR ...RC, CT cis- ternography, and MR imaging all revealed multiple meningeal diverticula, some of which were giant; however, we could ...

6

Detection of CSF Leak in Spinal CSF Leak Syndrome Using MR Myelography: Correlation with Radioisotope Cisternography

Detection of CSF Leak in Spinal CSF Leak Syndrome Using MR Myelography: Correlation with Radioisotope Cisternography

... (RIC) or CT cisternography (CTC). MR myelography (MRM) is a noninvasive method that can also be used for demonstrat- ing CSF leak. It has no radiation hazard and can be performed without intrathecal ...

6

Cisternography and Ventriculography Gadopentate Dimeglumine–Enhanced MR Imaging in Pediatric Patients: Preliminary Report

Cisternography and Ventriculography Gadopentate Dimeglumine–Enhanced MR Imaging in Pediatric Patients: Preliminary Report

... with CT myelography/cister- nography or radionuclide cisternography was not specifically addressed in our ...intrathecal CT cisternography with wa- ter-soluble iodinated contrast ...MR ...

6

Cerebrospinal fluid fistula: detection with MR cisternography

Cerebrospinal fluid fistula: detection with MR cisternography

... All patients were examined with a 1.5-T Signa 5.4 MR system (General Electric Medical Systems, Milwaukee, Wis) with 5X Advantage software and a standard head coil. A fast spin-echo sequence with fat suppression was used ...

5

A proposed model of cerebrospinal fluid circulation: observations with radionuclide cisternography

A proposed model of cerebrospinal fluid circulation: observations with radionuclide cisternography

... RC was performed in 10 women with venous vasculitis (8) (mean age, 43 years; age range, 22 to 63 years). In each patient, high intracranial pressure had been recorded at least once before the examination. The reason for ...

8

Evaluation of CSF Leaks: High Resolution CT Compared with Contrast Enhanced CT and Radionuclide Cisternography

Evaluation of CSF Leaks: High Resolution CT Compared with Contrast Enhanced CT and Radionuclide Cisternography

... High-resolution CT used initially to screen for CSF leak showed bone defects in 71% of the pa- ...at CT cisternography or radionuclide cisternogra- phy who did not initially have bone defects re- ...

7

Evaluation of high resolution CT and MR cisternography in the diagnosis of cerebrospinal fluid fistula

Evaluation of high resolution CT and MR cisternography in the diagnosis of cerebrospinal fluid fistula

... High-resolution CT should be the first line of in- vestigation in patients with clinically diagnosed CSF rhinorrhea (and after confirming the presence of CSF by laboratory analysis in doubtful ...on CT ...

7

3D CT Arteriography and 3D CT Venography: The Separate Demonstration of Arterial Phase and Venous Phase on 3D CT Angiography in a Single Procedure

3D CT Arteriography and 3D CT Venography: The Separate Demonstration of Arterial Phase and Venous Phase on 3D CT Angiography in a Single Procedure

... On the basis of the results of the dynamic CT scan, the optimal scan delays for 3D-CT arteriography and 3D-CT venography were determined (Fig 1). Because the time interval between the ...

7

A Nordic survey of CT doses in hybrid PET/CT and SPECT/CT examinations

A Nordic survey of CT doses in hybrid PET/CT and SPECT/CT examinations

... NB devised the study concept with HB. NB, MS, BH, HB, EH, and EMH were involved in the study design. The data capture form and instructions were designed by NB and HB (which utilised the design of the data capture form ...

16

Archaeogenetic evidence of ancient Nubian barley evolution from six to two row indicates local adaptation

Archaeogenetic evidence of ancient Nubian barley evolution from six to two row indicates local adaptation

... ACCCCT AGGT CT CT CCCT GGAGACACGCACT CCCCT CCT T CAACT AGT GCT T T GCGGCCCGT GGT CCT CCT CT CGAT CCAGT T CCT GAGCACACCAACAGGCAACAGAACAACCT ACCGT GT CT CCCCT CCAAT CT CCT CACGAT CCCT T CT[r] ...

31

Influence of thresholding in mass and entropy dimension of 3-D soil images

Influence of thresholding in mass and entropy dimension of 3-D soil images

... largest thresholding values, followed by the equi-probability value for the two distributions. Though the thresholding val- ues corresponding to the other two criteria were consistently lower than those obtained from ...

11

High Resolution MR Cisternography of the Cerebellopontine Angle: 2D versus 3D Fast Spin Echo Sequences

High Resolution MR Cisternography of the Cerebellopontine Angle: 2D versus 3D Fast Spin Echo Sequences

... cisternographic effects than 2D images, even with the same voxel size. Intravoxel dephasing is there- fore not a main cause of the signal loss in CSF. Images obtained with thicker sections and shorter TEs showed better ...

7

Impact of CT slice thickness on volume and dose evaluation during thoracic cancer radiotherapy

Impact of CT slice thickness on volume and dose evaluation during thoracic cancer radiotherapy

... Eleven CT datasets from patients with thoracic cancer were ...external CT Reference markers. Struc- tures and plans on 2–CT images, as a reference data, were copied to the reconstructed ...

8

Malignant isolated cortical vein thrombosis with type II protein S deficiency: a case report

Malignant isolated cortical vein thrombosis with type II protein S deficiency: a case report

... Here, we presented an extremely rare case of a patient with ICVT and type II PS deficiency, who experienced a stroke. The patient was successfully treated with external decompression and anticoagulants. Venous thrombosis ...

5

Fluid Attenuated Inversion Recovery MR Imaging in Acute and Subacute Cerebral Intraventricular Hemorrhage

Fluid Attenuated Inversion Recovery MR Imaging in Acute and Subacute Cerebral Intraventricular Hemorrhage

... Two experienced raters who were unaware of the clinical details analyzed the MR and CT appearance and conspicuous- ness of IVH and coexisting SAH. The presence of IVH was noted, and the predominant signal quality ...

8

Towards the creation of a Gesture Library

Towards the creation of a Gesture Library

... In what concerns the recognition methods, one example technique that is being widely used is the Pattern Matching, trying to find parts of the gesture that have[r] ...

8

Show all 7076 documents...

Related subjects