Distribution and biogeography
Phylogenetic distribution, biogeography and the effects of land management upon bacterial non-specific Acid phosphatase Gene diversity and abundance
... biogeographical distribution of NSAPs and the effects of land management upon their abundance is critical to development of mechanistic models of dynamic biological processes regarding P cycling in the ...the ...
15
A critique of traditional approaches to seaweed distribution in light of the development of vicariance biogeography
... When sister group relationships within a particular taxon are reflected by geological history, this is considered support for the vicariance model.. When different groups of o[r] ...
10
The dispersal versus vicariance debate in biogeography
... in biogeography is that it leads to poorly formulated and usually untestable ...this distribution through long distance dispersal, although it is not possible to say when and how' (Goldblatt, 1978: ...
6
Phylogeny and biogeography of Spathelioideae (Rutaceae)
... Harrisonia consists of three to four species which have a wide distribution ranging from West- ern and central tropical Africa to Eastern Africa, and from South East Asia to New Guinea and tropical Australia. It ...
170
Biogeography for Watermarking Medical Images
... values. Biogeography based genetic algorithm[7] mimics the process of natural ...In biogeography algorithm deals with the distribution of species in a particular location called ...
5
Historical Biogeography: Evolution in Time and Space
... widespread distribution prior to the first vi- cariance event (Humphries and Parenti ...congruent distribution patterns across multiple lineages like vicariance, and which therefore might be inferred ...
14
Microbial biogeography of a university campus
... There were 16 OTUs that dominated door handle mi- crobial communities, associated with >1 % of total reads each, together representing 42.4 % of all reads (Fig. 2a). All 16 of these dominant OTUs corresponded to ...
12
Bechteler, Julia Maria Theresa (2018): Phylogeny, biogeography, classification, and amber fossils of the liverwort families Lejeuneaceae and Radulaceae. Dissertation, LMU München: Fakultät für Biologie
... 5 The evolutionary history of organisms is of fundamental relevance to understanding biodiversity and can provide arguments for conservation, for example, by providing age estimates, revealing narrow geographic ranges ...
134
Genomic variation and biogeography of Antarctic haloarchaea
... Population-level genomic variation, genomic islands, and cell surface variation that mediates defence against viral infection have been described for a number of global hypersaline environments that support the growth of ...
16
A biogeography of the mesopelagic community
... global distribution of mesopelagic fish was made in 1980 (Gjøsaeter & Kawaguchi, 1980), estimating a value of 945 Million tonnes (Mt), calculated by summing up biomass estimates (density multiplied by surface ...
199
The biogeography of melioidosis
... The stability and fragmentation of B. pseudomallei populations around Balimo is at least partially impacted by anthropogenic influences. Previously, the introduction of B. pseudomallei into non- endemic regions has been ...
203
Systematics and biogeography of the Styphelieae (Epacridoideae, Ericaceae)
... Relaxed clock molecular dating MCMC analyses were executed in BEAST v.1.6.2. (Drummond and Rambaut, 2007). Evolutionary models applied to each partition are shown in Table 2.1. Estimation of all model parameters was ...
181
Index Terms: GSA, BBO, GSA-BBO HYBRIDIZATION ALGORITHM,HSI,SIV I INTRODUCTION GSA(Gravitational Search Algorithm)
... and Biogeography Based ...the Biogeography, the study of the geographical distribution of biological species, it can be used to derive algorithms for ...
13
Species distribution and cerrado conservation
... species distribution and not can be used directly in conservation and biogeography ...geographic distribution for large areas where species distributions are uncertain due to inaccessibility and high ...
11
Phlogeny and Biogeography of the Prayer Plant Family
... trnL-F IGStrnFf ATTTGAACTGGTGACACGAG see Taberlet et a!. Prince) Taberlet et a!.. Statistics for maximum parsimony analyses of relationships in Marantaceae using data fro[r] ...
16
Biogeography Based Steganography for Color Images
... Abstract:- Steganography is an art that involves communication of secret data in an appropriate carrier, e.g., image, audio, video or TCP/IP header file. Steganography’s goal is to hide the existence of embedded data so ...
6
Environmental effects on spatial biogeography of microbial communities and examination of trophic impacts through analysis of gut microbiome in fish
... the biogeography of microbial communities is to focus on the geographical (spatial isolation) effect on the diversity and composition of microbial ...microbial biogeography whether the concepts of community ...
118
Systematics and biogeography of the New Zealand endemic genus Zorion Pascoe 1867 (Coleoptera: Cerambycidae: Cerambycinae), with descriptions of six new species : a thesis presented in partial fulfilment of the requirements for the degree of Masters of Science in Zoology at Massey university
... Systematics and biogeography of the New Zealand endemic genus Zorion Pascoe 1867 Coleoptera: Cerambycidae: Cerambycinae, with descriptions of.. six new species.[r] ...
139
Gondwanan Origin of Major Monocot Groups Inferred from Dispersal-Vicariance Analysis
... Historical biogeography of major monocot groups was investigated by biogeographical analysis of a dated phylogeny including 79 of the 81 monocot families using the An[r] ...
7
Systematics and biogeography of the New Zealand endemic genus Zorion Pascoe 1867 (Coleoptera: Cerambycidae: Cerambycinae), with descriptions of six new species : a thesis presented in partial fulfilment of the requirements for the degree of Masters of Science in Zoology at Massey university
... Systematics and biogeography of the New Zealand endemic genus Zorion Pascoe 1867 Coleoptera: Cerambycidae: Cerambycinae, with descriptions of.. six new species.[r] ...
16