• No results found

ERG additional scenario and sensitivity analysis

2015 EMEA RMBS Scenario And Sensitivity Analysis

2015 EMEA RMBS Scenario And Sensitivity Analysis

... A similar logic applies to assumptions regarding the loss severity on the underlying mortgage loans. Below, we analyze the effect on the ratings of a hypothetical European RMBS transaction if our base-case expected ...

14

Sensitivity Analysis for a Scenario-Based Reliability Prediction Model

Sensitivity Analysis for a Scenario-Based Reliability Prediction Model

... a scenario specifica- tion to model (1) the probability of component failure, and (2) sce- nario transition ...extended scenario spec- ...a sensitivity analysis that supports reasoning about ...

5

Sensitivity analysis of scenario models for operational risk Advanced Measurement Approach

Sensitivity analysis of scenario models for operational risk Advanced Measurement Approach

... Linkage between MF and WS probability may not be clear to the experts during scenario exercise. For rare events with low average arrival rate, experts ’ opinion about WS may not relate to a high quantile of ...

15

Scenario Weights for Importance Measurement (SWIM) – an R package for sensitivity analysis

Scenario Weights for Importance Measurement (SWIM) – an R package for sensitivity analysis

... flexible sensitivity analysis framework, based primarily on results and tools developed by Pesenti et ...returning scenario weights, which encode the required stress and allow monitoring the impact ...

26

Assessing spatial uncertainties of land allocation using the scenario approach and sensitivity analysis

Assessing spatial uncertainties of land allocation using the scenario approach and sensitivity analysis

... The Dyna-CLUE model uses results of the LEITAP sensitivity analysis for estimating the high resolution spatial consequences of the estimated uncertainties. The Dyna-CLUE model applies a downscaling ...

16

RESEARCH. Japanese Structured Finance Scenario And Sensitivity Analysis: The Effects Of Major Macroeconomic Factors.

RESEARCH. Japanese Structured Finance Scenario And Sensitivity Analysis: The Effects Of Major Macroeconomic Factors.

... case scenario, the worst drop for global SF appears to be smaller than the drop for the 'AAA' rating category because the average global SF rating of 'BBB' is much closer to default than a 'AAA' rating in terms of ...

21

Analysis of Path loss exponent and shadowing on beam antenna calculating diversity and sensitivity for case scenario

Analysis of Path loss exponent and shadowing on beam antenna calculating diversity and sensitivity for case scenario

... indoor scenario and 4 files for the outdoor scenario for ...indoor scenario refers to a customizable conference room and bedroom in which we can remove furniture and electronic equipment; hence, the ...

9

Solution Sensitivity-Based Scenario Reduction for Stochastic Unit Commitment

Solution Sensitivity-Based Scenario Reduction for Stochastic Unit Commitment

... of scenario reduction. A general approach based on stability analysis and probability metrics is represented by [3, 4], and has been widely used in power system ...

38

Simulation-based Sensitivity Analysis of Future Climate Scenario Impact on Residential Weatherization Initiatives in the US Midwest

Simulation-based Sensitivity Analysis of Future Climate Scenario Impact on Residential Weatherization Initiatives in the US Midwest

... Simulation-based Sensitivity Analysis of Future Climate Scenario Impact on Residential Weatherization Initiatives in the US Midwest Abstract The existing building stock in countries across the world ...

10

Simulation-based Sensitivity Analysis of Future Climate Scenario Impact on Residential Weatherization Initiatives in the US Midwest

Simulation-based Sensitivity Analysis of Future Climate Scenario Impact on Residential Weatherization Initiatives in the US Midwest

... Using umi, our model simulates the energy consumption of built environment across a street section and thus accounts for factors such as floor area ratio, built density, and other urban morphology parameters that affect ...

8

Operational Risk - Scenario Analysis

Operational Risk - Scenario Analysis

... The motivation for banks to move from a less advanced to a more advanced technique is the increased risk sensitivity and in general lower expected capital requirement. Once a bank chooses to move to a more ...

35

Predictive significance of TMRPSS2-ERG fusion in prostate cancer: a meta-analysis

Predictive significance of TMRPSS2-ERG fusion in prostate cancer: a meta-analysis

... The primary characteristics of the 76 included stud- ies were summarized in Additional file 1: Table S1 in the order of the published year and authors’ sur- name. The publication period of these studies ranged ...

12

ERG deregulation induces IGF-1R expression in prostate cancer cells and affects sensitivity to anti-IGF-1R agents

ERG deregulation induces IGF-1R expression in prostate cancer cells and affects sensitivity to anti-IGF-1R agents

... DISCUSSION The T2E fusion gene constitutes a critical event in development of PCa [2, 28], but other genetic alterations, such as loss of PTEN and PI3K pathway activation, are also required to induce malignant ...

12

Controllership Functions: an analysis in the Brazilian scenario

Controllership Functions: an analysis in the Brazilian scenario

... Weber (2011) described the close connections among the levels of various tasks in relation to the contents and to the process, indicating that the development stages are not only a reflex of alternatives, or even a set ...

17

Combining Internal Data with Scenario Analysis

Combining Internal Data with Scenario Analysis

... 2.4. Sensitivity Analysis Working with this method, is generally simple since conjugate prior is involved, yet one of the main questions is how to ensure that experts opinion are consistent, relevant, and ...

15

Using Crop Management Scenario Simulations to Evaluate the Sensitivity of the Ohio Phosphorus Risk Index

Using Crop Management Scenario Simulations to Evaluate the Sensitivity of the Ohio Phosphorus Risk Index

... of sensitivity analysis may appear to be in- consistent, they are actually providing different pieces of ...third analysis, focusing on potential in- fluence of each input on the range of final P ...

19

TMPRSS2-ERG controls luminal epithelial lineage and antiandrogen sensitivity in PTEN

TMPRSS2-ERG controls luminal epithelial lineage and antiandrogen sensitivity in PTEN

... Human, ERG GAPDH ACAGTCCATGCCATCACTGCC GCCTGCTTCACCACCTTCTTG Human, ERG CCND1 AGCCGGGAAATCAACGAAGT CATAAAGAGGCTCGCCCACT Human, ERG CDK1 AGAACGGAGCGAACAGTAGC CAATCGGGTAGCCCGTAGAC Human, ERG ...

23

ERG (07) 56rev2. ERG COMMON POSITION ON VoIP

ERG (07) 56rev2. ERG COMMON POSITION ON VoIP

... phase. Bill & Keep and CPNP differ with regard to their relevance to the termination monopoly problem. IRG/ERG do not consider traffic symmetry a strict requirement for the applicability of Bill & Keep. ...

37

Sensitivity Analysis

Sensitivity Analysis

... Thus, as exemplified by the case of GMO, a risk analysis is performed to demonstrate the safety of a new technology after the technology has been introduced. According to Langdon Winner (1986, p. 138-163) citizens ...

80

ERG Common Statement for VoIP regulatory approaches ERG (05) 12

ERG Common Statement for VoIP regulatory approaches ERG (05) 12

... The ERG believes that if European citizens are to realise the full benefits of these innovations it is essential that European citizens are empowered to make informed choices about services and should be given the ...

25

Show all 10000 documents...

Related subjects