• No results found

Fc receptor

An abnormality of the gene that encodes neutrophil Fc receptor III in a patient with systemic lupus erythematosus

An abnormality of the gene that encodes neutrophil Fc receptor III in a patient with systemic lupus erythematosus

... of Fc receptor III was limited to the patient's neutrophils (her natural killer cells reacted normally with anti-Fc receptor III antibodies), and was associated with abnormal recognition and ...

7

The Human Cytomegalovirus Fc Receptor gp68 Binds the Fc CH2-CH3 Interface of Immunoglobulin G

The Human Cytomegalovirus Fc Receptor gp68 Binds the Fc CH2-CH3 Interface of Immunoglobulin G

... (3), respectively, using primer pairs 5⬘-GTCTAGGGATCCATGCAGACCTACA GCACCCC-3⬘ and 5⬘-GCTTAAGAATTCCTACTGTAAATCCCCGTCCACC G-3⬘ and 5⬘-GACTTAGATCTACATGTGTTCCGTACTGGCG-3⬘ and 5⬘-GGAA GAATTCTACCACTGCTTGAAGTAGGGCACCG-3⬘, ...

10

Platelet Fc Receptor: INCREASED EXPRESSION IN MYELOPROLIFERATIVE DISEASE

Platelet Fc Receptor: INCREASED EXPRESSION IN MYELOPROLIFERATIVE DISEASE

... platelet Fc receptor, a membrane receptor for immune complexes or aggregated immunoglobulin (Ig)G, was compared in normal and myeloproliferative ...

9

Resistance of Fc receptor  deficient mice to fatal glomerulonephritis

Resistance of Fc receptor deficient mice to fatal glomerulonephritis

... of Fc receptors in the induction of nephro- toxic GN by establishing and analyzing mice deficient in the Fc receptor g chain (FcR g ...words: Fc receptor • knockout mouse • ...

11

Characterization of Antibody Bipolar Bridging Mediated by the Human Cytomegalovirus Fc Receptor gp68

Characterization of Antibody Bipolar Bridging Mediated by the Human Cytomegalovirus Fc Receptor gp68

... viral Fc receptors (Fc ␥ Rs) that bind host IgG to evade immune responses mediated by host Fc ␥ Rs ...Viral Fc ␥ Rs can participate in anti- body bipolar bridging (ABB), whereby an antibody ...

6

Neutralized Adenovirus-Immune Complexes Can Mediate Effective Gene Transfer via an Fc Receptor-Dependent Infection Pathway

Neutralized Adenovirus-Immune Complexes Can Mediate Effective Gene Transfer via an Fc Receptor-Dependent Infection Pathway

... the Fc receptor underscored the likelihood that endocytosis rather than phagocytosis was suffi- cient to internalize the small Ad-immune complexes formed by this ...

11

Complex Formation Facilitates Endocytosis of the Varicella-Zoster Virus gE:gI Fc Receptor

Complex Formation Facilitates Endocytosis of the Varicella-Zoster Virus gE:gI Fc Receptor

... LDL receptor and the FcgRII, has increased in- terest in defining whether it retains related trafficking ...the Fc portion of human (or rabbit) IgG with a distinctive punctate pattern on the cell surface; ...

10

Neonatal Fc receptor for IgG regulates mucosal immune responses to luminal bacteria

Neonatal Fc receptor for IgG regulates mucosal immune responses to luminal bacteria

... neonatal Fc receptor for IgG (FcRn) plays a major role in regulating host IgG levels and transporting IgG and associated antigens across polarized epithelial ...

11

The neonatal Fc receptor is not required for mucosal infection by mouse mammary tumor virus.

The neonatal Fc receptor is not required for mucosal infection by mouse mammary tumor virus.

... The receptor that mediates uptake and transport of MMTV across the intestinal barrier has not yet been ...neonatal Fc receptor (nFcR), which is expressed by enterocytes during the first two weeks of ...

5

Expression of neonatal Fc receptor in the eye

Expression of neonatal Fc receptor in the eye

... P URPOSE . The neonatal Fc receptor (FcRn) plays a critical role in the homeostasis and degradation of immunoglobulin G (IgG). It mediates the transport of IgG across epithelial cell barriers and recycles ...

10

Interaction of Poliovirus with Its Receptor Affords a High Level of Infectivity to the Virion in Poliovirus Infections Mediated by the Fc Receptor

Interaction of Poliovirus with Its Receptor Affords a High Level of Infectivity to the Virion in Poliovirus Infections Mediated by the Fc Receptor

... and Fc region of mouse ...and Fc region of mouse IgG2a was prepared from hybridoma cells expressing mouse IgG2a by RT-PCR, using the sense primer 59GCTCCGGATCCGGAGCCCAGAGGGCCCACAAT39 and the antisense ...

9

Neonatal Fc receptor antagonist efgartigimod safely and sustainably reduces IgGs in humans

Neonatal Fc receptor antagonist efgartigimod safely and sustainably reduces IgGs in humans

... Efgartigimod administration did not result in significant changes in IgA, IgD, IgE, and IgM levels. This was expected, since the endogenous levels of these Igs are not dependent on FcRn- mediated recycling. Therefore, ...

16

An Fc receptor for human immunoglobulin G is located within the tegument of human cytomegalovirus.

An Fc receptor for human immunoglobulin G is located within the tegument of human cytomegalovirus.

... While the interaction between purified HCMV virions and human IgG was being studied by immunogold electron microscopy, it was noted that IgG purified from sera that assayed as seronegati[r] ...

5

Characterization of polymorphic forms of Fc receptor III on human neutrophils

Characterization of polymorphic forms of Fc receptor III on human neutrophils

... Although MAb 3G8 appeared to recognize the 33-kD band noted after N-glycanase digestion of the single 33-kD band structural type lane 13, faint 33-kD bands also appeared after incubating[r] ...

7

Identification and expression of a murine cytomegalovirus early gene coding for an Fc receptor.

Identification and expression of a murine cytomegalovirus early gene coding for an Fc receptor.

... Identification of the murine cytomegalovirus glycoprotein B gene and its expression by recombinant vaccinia virus.. Protein structure and intracellular stability.[r] ...

9

Genetic diversity in human Fc receptor II for immunoglobulin G: Fc gamma receptor IIA ligand-binding polymorphism.

Genetic diversity in human Fc receptor II for immunoglobulin G: Fc gamma receptor IIA ligand-binding polymorphism.

... Studies of platelet activation by murine antiplatelet monoclonal antibodies via the platelet Fc-yRIIA receptor reveal three distinct patterns of behavior most likely corre-.. sponding to[r] ...

5

Antibody response to Haemophilus somnus Fc receptor

Antibody response to Haemophilus somnus Fc receptor

... To characterize the bovine immune response to an Haemophilus somnus antigen known to be recognized by convalescent-phase serum, we studied isotypic antibody titers to the 270-kilodalton [r] ...

7

Determination of the neighboring molecule to the FC receptor  on human macrophages

Determination of the neighboring molecule to the FC receptor on human macrophages

... 30 SECTION IV DISCUSSION With reagents gave cross-linked is that there are approach the FcR the FcR It may tetramers the and so membrane molecule As and may lose its mentioned process in[r] ...

53

Antibody Recognition of Cell Surface-Associated NS1 Triggers Fc-γ Receptor-Mediated Phagocytosis and Clearance of West Nile Virus-Infected Cells

Antibody Recognition of Cell Surface-Associated NS1 Triggers Fc-γ Receptor-Mediated Phagocytosis and Clearance of West Nile Virus-Infected Cells

... activating Fc- ␥ receptors were essential for 10NS1 protection, we speculated that natural killer (NK) cells might control infection by detecting and lysing NS1-expressing WNV-infected cells through ...

5

Neutrophils Interact with Adenovirus Vectors via Fc Receptors and Complement Receptor 1

Neutrophils Interact with Adenovirus Vectors via Fc Receptors and Complement Receptor 1

... of Fc receptors, including Fc ␥ RIIA and Fc ␥ RIIIB. Fc ␥ RIIIB is a specific neutrophil- inhibitory Fc receptor that lacks the prototypical immunore- ceptor tyrosine-based ...

10

Show all 10000 documents...

Related subjects