Forkhead transcription factor 3
Wilms’ tumor susceptibility: possible involvement of FOXP3 and CXCL12 genes
... (forkhead transcription factor 3) was initially described as a marker for regulatory T cells; however, its expression in several types of tumor cells has already been described and may have ...
8
A Forkhead Transcription Factor Is Important for True Hyphal as well as Yeast Morphogenesis in Candida albicans
... Microarray analysis. Microarray experiments were performed by using mod- ified protocols from J. DeRisi (http://www.microarrays.org/protocols.html). For detailed protocols see the supplementary material at ...
12
The forkhead transcription factor Foxo1 (Fkhr) confers insulin sensitivity onto glucose 6 phosphatase expression
... in all three constructs: 5 ′ - ACT GGT ACC GCC ATG TAC CCA TAC GAT GTT CCG GAT TAC GCT GCC GAG GCG CCC CAG GTG GTG G -3 ′ . Two different antisense primers were used: 5′- TTG CCC CAC GCG TTG CGG CGC GAC GAG C ...
10
Uterine receptivity and implantation: The regulation and action of insulin-like growth factor binding protein-1 (IGFBP-1), HOXA10 and forkhead transcription factor-1 (FOXO-1) in the baboon endometrium
... Uterine receptivity and implantation in the baboon can be categorized into three distinct phases. Phase I is regu- lated by estrogen and progesterone and is evident between days 8 and 10 post-ovulation (PO) of the normal ...
6
Regulation of Lysosomal Function by the DAF-16 Forkhead Transcription Factor Couples Reproduction to Aging in Caenorhabditis elegans
... day 3 of adult life (day 1 standardized as 24 hr post-L4 molt at 20°), then ceases at around days 5–6 due to the de- pletion of the sperm repository (Kimble and Crittenden 2005) (Figure ...
19
Forkhead Box Transcription Factor Regulation and Lipid Accumulation by Hepatitis C Virus
... with forkhead box transcription factors in which we evaluated their role in metabolic gene regulation during HCV ...regulating forkhead box transcription ...after 3 days for expression ...
9
Distal renal tubular acidosis in mice that lack the forkhead transcription factor Foxi1
... with water and acid-base handling, at least in a controlled labora- tory environment. We propose that these epithelial precursor cells under normal circumstances constitute a transient cell population characterized by ...
12
The Forkhead Transcription Factor Fkh2 Regulates the Cell Division Cycle of Schizosaccharomyces pombe
... cdc10-C4 mutant grown at either the permissive or the non- permissive temperature (Fig. 5). We also examined the expres- FIG. 2. Fkh2 is involved in several cell cycle-dependent processes. (A) Cells of mid-log-phase ...
11
Forkhead box transcription factor 1: role in the pathogenesis of diabetic cardiomyopathy
... Hyperglycemia-induced oxidative stress promotes post translational modifications of FOXO1 and its nuclear translocation, accounting for its enhanced transcrip- tional activity, thereby its participation in the ...
12
The forkhead transcription factor Foxo1 links insulin signaling to Pdx1 regulation of pancreatic β cell growth
... forkhead binding site (15). We carried out cotransfections in βTC-3 cells at 70–80% confluence with Pdx1/lucifer- ase reporter gene (pGL3-PDX1-PH2) and control pCMV5 vector or pCMV5-Foxa2, pCMV5–ADA-Foxo1, ...
10
Forkhead box transcription factor 1 expression in gastric cancer: FOXM1 is a poor prognostic factor and mediates resistance to docetaxel
... response to docetaxel, the human malignant gastric cell lines SGC-7901, AGS, and MKN-28, which has different expression levels of FOXM1, were treated with 0.02 mg/L of docetaxel for 72 hs. MTT assay was performed to test ...
13
Mosaic analysis of insulin receptor function
... exon 3 (5′- CTGTTCGGAACCTGATGA -3′) and exon 5 (5′- GTGATACCAGAGGATAGGAG ...binding transcription factor 1 (Srebf1), glycogen synthase (Gys1), glycogen phosphorylase (Pygl), ...
12
Plant sterols, marine-derived omega-3 fatty acids and other functional ingredients: a new frontier for treating hyperlipidemia
... of transcription factors that are associated with triglyceride beta oxidation including hepatic forkhead transcription factor (Foxa2), peroxisome proliferator-activated receptor (PPAR)-g ...
7
The LXXLL motif of murine forkhead transcription factor FoxO1 mediates Sirt1 dependent transcriptional activity
... The forkhead transcription factor FoxO1 has been identified as a negative regulator of insulin/IGF-1 ...which 3 Akt phosphorylation sites (T24, S253, and S316) and 2 leucine residues in the ...
12
The Fox/Forkhead transcription factor family of the hemichordate Saccoglossus kowalevskii
... Additional file 7: Figure S1. Phylogenetic analysis of the FoxAB family. S. kowalevskii FoxAB groups together with previously found members of this new Fox gene family supporting the idea that this new family is a ...
26
Ocular forkhead transcription factors: seeing eye to eye
... FoxM1 is expressed in eye fields of X. laevis embryos from neurulation through tailbud stage, and also evident in CMZ (Pohl et al., 2005). Additionally, FoxM1 is not expressed in the most peripheral region of the CMZ ...
9
The transcription factor X-box binding protein-1 in neurodegenerative diseases
... transcription factor 6; BACE1: β APP Cleaving Enzyme 1; BiP: Binding immunoglobulin protein; ERAD: Endoplasmic Reticulum Associated protein Degradation; FoxO1: Forkhead box O1; HD: Huntington ’ s ...
8
Activin induction of the ovine follicle-stimulating hormone beta-subunit is mediated by Smad4 and a forkhead box transcription factor
... activin-mediated transcription of ...a transcription factor other than Smad2 and 3, which can both be activated by activin and ...important transcription factor to two families, ...
150
Integrin engagement regulates monocyte differentiation through the forkhead transcription factor Foxp1
... nuclear factor-3/forkhead domain family of winged- helix transcription factors ...its forkhead homology, this protein was assigned a puta- tive forkhead designation as ...novel ...
12
Interaction of hookworm 14 3 3 with the forkhead transcription factor DAF 16 requires intact Akt phosphorylation sites
... The phylogenetic relationship between Ac-FTT-2 and selected 14-3-3 protein family members. A. Alignment of Ac-FTT-2 with C. elegans 14-3-3 proteins. Shading indicates residues that are ...
13