functional redundancy
Thermal discharge-created increasing temperatures alter the bacterioplankton composition and functional redundancy
... Elevated seawater temperature has altered the coupling between coastal primary production and heterotrophic bacterioplankton respiration. This shift, in turn, could influence the feedback of ocean ecosystem to climate ...
10
Limited Functional Redundancy and Oscillation of Cyclins in Multinucleated Ashbya gossypii Fungal Cells
... Unlike Agclb5/6 ⌬ mutants, Agclb3/4 ⌬ cells formed mature mycelia with normal nuclear density; however, the nuclear cycle appears to be delayed prior to spindle assembly and spore formation was completely abolished, ...
14
Fitness Assays Reveal Incomplete Functional Redundancy of the HoxA1 and HoxB1 Paralogs of Mice
... ABSTRACT Gene targeting techniques have led to the phenotypic characterization of numerous genes; however, many genes show minimal to no phenotypic consequences when disrupted, despite many having highly conserved ...
17
Tax4Fun2: prediction of habitat-specific functional profiles and functional redundancy based on 16S rRNA gene sequences
... normalized functional profiles of those references identified in the 16S rRNA search is ...normalized functional profile in the AM is multiplied by the summarized OTU ...the functional profiles of ...
12
Functional Redundancy in HIV-1 Viral Particle Assembly
... It should be noted that other groups have also examined the RNA content of the ⌬NC mutant particles. Ott et al. observed a 2-fold reduction of total RNA in the absence of NC (compared to ⱖ10-fold in our study) (27). ...
6
Functional redundancy of PIN proteins is accompanied by auxin dependent cross regulation of PIN expression
... (Friml and Palme, 2002). Despite the proposed uniform function of PIN proteins in auxin transport, genetic analysis implicates different PINs in various, seemingly unrelated, developmental processes (Friml, 2003). In ...
11
The stage dependent roles of Ldb1 and functional redundancy with Ldb2 in mammalian retinogenesis
... The Lim domain-binding proteins are key co-factor proteins that assemble with LIM domains of the LMO/LIM-HD family to form functional complexes that regulate cell proliferation and differentiation. Using ...
11
Overexpressed HDAC8 in cervical cancer cells shows functional redundancy of tubulin deacetylation with HDAC6
... why this functional redundancy between HDAC6 and HDAC8. So, we first analysed the expression of HDAC6 and HDAC8 in normal and cancerous cervical tissue sam- ples in The Human Protein Atlas database and ...
16
Functional redundancy among Nanos proteins and a distinct role of Nanos2 during male germ cell development
... The finding that Nanos2 rescues the function of Nanos3 in early- stage mouse embryos indicates that functional redundancy exists between these two proteins. However, we speculated as to whether this was ...
7
Functional Redundancy of Variant and Canonical Histone H3 Lysine 9 Modification in Drosophila
... Several studies from multiple species have investigated the developmental functions of H3.3 and H3. In mice, single mutation of either H3.3A or H3.3B results in reduced viability and compromised fertility (Couldrey et ...
16
Functional redundancy of frizzled 3 and frizzled 6 in planar cell polarity control of mouse hair follicles
... The orientation of mouse hair follicles is controlled by the planar cell polarity (PCP) pathway. Mutations in PCP genes result in two categories of hair mis-orientation phenotype: randomly oriented and vertically ...
11
Functional Redundancy of DICER Cofactors TARBP2 and PRKRA During Murine Embryogenesis Does Not Involve miRNA Biogenesis
... Because Dicer mutants die by E7.5 (Figure 1A), while Tarbp2 2/2 mutants die perinatally, and Prkra mutants are viable but have reduced body size and ear deformities, we asked whether there might be functional ...
10
Contrasting soil pH effects on fungal and bacterial growth suggest functional redundancy in carbon mineralization
... In conclusion, this study showed that neutral or slightly al- kaline conditions favored bacterial growth. Conversely, an acid pH favored fungal growth. This resulted in an increase in the relative importance of fungi by ...
8
Functional Redundancy Within roX1, a Noncoding RNA Involved in Dosage Compensation in Drosophila melanogaster
... redundant functional domains may be interspersed TCC for transgenic probe, AAATGAACACAGCCAAAGCAAG along the length of roX1 and that the structure of the and CCGAAAGCACATATTCCCAAC for genomic probe) and subcloned ...
12
Streptococcus pyogenes Superantigens: Studies Into Host Specificity and Functional Redundancy
... MGAS5005, was able to cause efficient nasopharyngeal infection in FVB mice [188]; however, since MGAS8232 was unable to cause a nasopharyngeal infection in these mice, and both strains[r] ...
125
Functional redundancy of Rab27 proteins and the pathogenesis of Griscelli syndrome
... Griscelli syndrome (GS) patients and the corresponding mouse model ashen exhibit defects mainly in two types of lysosome-related organelles, melanosomes in melanocytes and lytic granules in CTLs. This disease is caused ...
12
Quantification of over-speed risk in wind turbine fleets
... The life management of wind farms is growing in importance as more turbines are installed. Operators are likely to have fleets comprising many turbine types with different safety systems. By analysing the reliability of ...
8
Habitat degradation increases functional originality in highly diverse coral reef fish assemblages
... of functional redundancy in ecosystems (Rosenfeld 2002, Loreau ...discrete functional trait values represents, at best, a coarse categorical approximation of organisms’ ecological role based on ...
19
Developmental functions of the dynamic DNA methylome and hydroxymethylome in the mouse and zebrafish: similarities and differences
... Translation-blocking morpholinos that target maternal and zygotic mRNA show that depletion of maternal and zygotic Uhrf1 protein causes pre-gastrulation lethality, suggesting an essential role for maternal Uhrf1 protein ...
15
A novel role for Lyl1 in primitive erythropoiesis
... the functional redundancy of Scl and Lyl1 in erythropoiesis, we targeted Scl in erythropoiesis using the erythroid-specific erythropoietin receptor Cre-recombinase ( EpoRCre ) transgenic line (Heinrich et ...
9