Giardia sub-assemblages and genotypes by locus
Determination of Giardia duodenalis assemblages and multi locus genotypes in patients with sporadic giardiasis from England
... two assemblages may differ in their distribution amongst people of different ages and in the illness they ...with sub-assemblage AII. Molecular analysis at both the single-locus and ...
10
Spatial structure of two-locus genotypes under isolation by distance.
... As dispersal is increased from low to moderate, the correlations for short distances generally increase, as do the X-intercepts (SOKAL et al. structural features and hig[r] ...
11
COMPETITION AMONG GENOTYPES IN TRIBOLIUM CASTANEUM AT VARYING DENSITIES AND GENE FREQUENCIES (THE BLACK LOCUS)
... The heterozygotes in mixed culture are never lower in survivorship than they are in pure culture and at gene frequency 0.25qb we note marked facili- tation of heterozygote emergence[r] ...
17
Epidemiological distribution of genotypes of Giardia duodenalis in humans in Spain
... At the gdh locus, seven subtypes were observed among 66 assemblage B samples (Table 3 and Additional file 1: Table S1). Compared with the reference EF507671, 1–11 SNPs were detected at 19 positions, with three ...
10
Giardia genotypes in pigs in Western Australia: Prevalence and association with diarrhea
... 18S locus but was genetically distinct at the more variable gdh locus (Langkjaer et ...another locus to confirm the identification of assemblage ...
15
The epidemiology of infections with Giardia species and genotypes in well cared for dogs and cats in Germany
... multilocus genotypes (MLGs) is confusing and at times contradictory or in- complete ...β-giardin locus and subtype A2 at the GDH. The sub- types detected in the present study suggest that the ...
14
Phylogenetic Analysis of Giardia lamblia Human Genotypes in Fars Province, Southern Iran
... of Giardia has revealed six Giardia species: ...major genotypes or assemblages ...of Giardia (4, ...within assemblages of G. lamblia from different hosts. The gdh locus ...
12
Development of a quantitative PCR (qPCR) for Giardia and analysis of the prevalence, cyst shedding and genotypes of Giardia present in sheep across four states in Australia
... (tpi) locus as previously described (Geurden et ...beta-giardin locus using primers BGexF: 5’- CCCGACGACCTCACCCGCAGT – 3’ and BGRev: 5’- GCTCGGCCTTCTCGCGGTCG - 3 for the primary reaction with a predicted ...
28
Genotypes and public health potential of Enterocytozoon bieneusi and Giardia duodenalis in crab eating macaques
... Conclusions: Data from this study indicate a common occurrence of zoonotic genotypes of E. bieneusi and assem- blage B of G. duodenalis in farmed crab-eating macaques in Hainan, China. Keywords: Enterocytozoon ...
11
Genotypes of Cryptosporidium spp , Enterocytozoon bieneusi and Giardia duodenalis in dogs and cats in Shanghai, China
... Additional multi-locus typing was conducted based on the concatenated sequences of the gdh, bg, and tpi loci. For assemblage A-positive specimens, multi-locus typing was impossible because none of the ...
9
Lower FEV<sub>1</sub> in non-COPD, nonasthmatic subjects: association with smoking, annual decline in FEV<sub>1</sub>, total IgE levels, and <em>TSLP</em> genotypes
... susceptibility locus to asthma and to lower lung function in non-COPD, nonasthmatic healthy subjects, which may support the contention that genetic determinants of lung function influence susceptibility to ...
9
Prevalence of Giardia Assemblages Among Equines in Jordan
... Acute Giardia infection is 50 characterized by diarrhea in both humans and animals, while chronic infection in 51 children and young animals are reportedly associated with failure to thrive, 52 wasting and ...
30
Giardia intestinalis assemblages among Egyptian symptomatic/asymptomatic cases in Cairo
... Abstract Giardia intestinalis is frequent enteric protozoa, affecting humans ...different assemblages call A & ...the Giardia genotypes isolated from the stool of symptomatic and asymptomatic ...
10
A study of the prevalence and genotypes of Giardia duodenalis infecting kennelled dogs
... of Giardia cysts in clin- ically normal animals may reflect sub-clinical infection but is significant given the capacity of these animals to transmit the infection to other dogs and to contaminate a shared ...
5
Secondary loss of a cis spliced intron during the divergence of Giardia intestinalis assemblages
... intestinalis assemblages A1, A2, B, and E, one of the two introns identified in this study has highly likely been lost after the divergence of the ...intron-free locus in P15 genome, we propose that the ...
5
Concordance of Giardia duodenalis assemblages determined by different PCR methodologies in three observational studies in Cuba
... correct assemblages. In each sub-study, following DNA isolation by the phenol/chloroform/isoamyl alcohol extraction method, PCR targeting the triose phosphate isomerase (tpi) gene was used for molecular ...
5
Giardia duodenalis assemblages and Entamoeba species infecting non human primates in an Italian zoological garden: zoonotic potential and management traits
... of Giardia only in ...mixed Giardia assemblage ...B, sub-assemblage BIV, in contrast to other studies where isolates from NHP were identified as BIII, BIII-like and/or BIV-like at either the gdh or ...
8
Assemblages of Giardia duodenalis Isolates from Dogs by Amplification and Restriction of tpi and β Giardin Genes and Sequencing of SSU rDNA Gene
... ABSTRACT Giardia duodenalis exhibits seven assemblages (A-G) that are distributed in different ...B assemblages are commonly found in humans and several mammals, while C and D assemblages are ...
6
Assessment of Giardia and Cryptosporidium Assemblages/ Species and Their Viability in Potable Tap Water in Beni-Suef, Egypt Using Nested PCR/RFLP and Staining
... Both Giardia and Cryptosporidium are the most common waterborne and foodborne parasites all over the world ...and genotypes (3, ...for Giardia and Cryptosporidium, ...
11
Investigation of Giardia intestinalis Genotypes among the Food Handlers of Qazvin, Iran
... In this study, there was no significant corre- lation between the different genotypes of G. lamblia (AII and BIII) and gastrointestinal signs and symptoms however those infected with giardia and showing ...
8