Herpesvirus 1
Equine Herpesvirus 1 Utilizes a Novel Herpesvirus Entry Receptor
... Equine herpesvirus 1 (EHV-1), a member of the Alphaher- pesvirus subfamily, is the causative agent of respiratory distress, abortion, and neurological disease in horses ...type 1 and 2 ...
5
Psittacid Herpesvirus 1 and Infectious Laryngotracheitis Virus: Comparative Genome Sequence Analysis of Two Avian Alphaherpesviruses
... Psittacid herpesvirus 1 (PsHV-1) is the causative agent of Pacheco’s disease, an acute, highly contagious, and potentially lethal respiratory herpesvirus infection in psittacine birds, while ...
10
Characterization of bovine herpesvirus 1 UL49 homolog gene and product: bovine herpesvirus 1 UL49 homolog is dispensable for virus growth.
... The sequence of the bovine herpesvirus 1 (BHV-1) gene that is homologous to the herpes simplex virus UL49 gene was determined. The BHV-1 UL49 homolog open reading frame consists of 774 bp and ...
5
Antigenic and protein sequence homology between VP13/14, a herpes simplex virus type 1 tegument protein, and gp10, a glycoprotein of equine herpesvirus 1 and 4.
... Sequence analysis of a Agtll insert of equine herpesvirus 1 gplO identified an open reading frame in equine herpesvirus 4 with which it showed strong homology; this open reading frame al[r] ...
7
Potential of Equine Herpesvirus 1 as a Vector for Immunization
... Equine herpesvirus 1 (EHV-1), an alphaherpesvirus, causes infections in ...type 1 (HSV- 1), have been identified. The herpesvirus glycoproteins in- volved in attachment, receptor ...
10
Anguillid Herpesvirus 1 Transcriptome
... We used deep sequencing of poly(A) RNA to characterize the transcriptome of an economically important eel virus, anguillid herpesvirus 1 (AngHV1), at a stage during the lytic life cycle when infectious ...
12
A Retrospective Review of Mucocutaneous Infections by Human Herpesvirus 1 and 2 in an Urban Population in Malaysia
... A Retrospective Review of Mucocutaneous Infections by Human Herpesvirus 1 and 2 in an Urban Population in Malaysia A Retrospective Review of Mucocutaneous Infections by Human Herpesvirus 1 and 2 in an[.] ...
8
Primary structure of the alcelaphine herpesvirus 1 genome.
... Malignant catarrhal fever (MCF) is a usually fatal disease in various ruminants. It occurs in two distinct epizootological forms: (i) wildebeest-associated MCF (WA-MCF), which is widespread in southern and eastern ...
9
The Genome of Salmonid Herpesvirus 1
... These findings may be interpreted in two ways. First, CCV and mammalian herpesviruses arose independently and have convergently acquired similar virion morphologies. Second, they evolved from an ancestral ...
9
Identification of non essential loci within the Meleagrid herpesvirus 1 genome
... It is noteworthy that the transposition mutants reported here are cumulative gene deletion mutants of MeHV-1, as pMeHV1-C18 lacks seven coding regions compared to the parental virus [20]. This genetic background ...
12
Characterization of envelope proteins of alcelaphine herpesvirus 1.
... Reelectrophoresis in 9% acrylamide under reducing conditions of proteins immunoprecipitated from [35S]methionine-labeled cells infected with AHV-1 by antibody 12B5 and electrophoresed un[r] ...
9
Sequencing and analysis of rflp variations in bulgarian caprine herpesvirus 1 isolates and differentiation from bovine herpesvirus 1 in goats
... and molecular weight of (90.1±1.8) × 10 6 D (Engels et al., . The genes are divided into three categories: encoding proteins connected to the viral replication, structural proteins and a heterologous set of optional ...
9
Synthesis and processing of bovine herpesvirus 1 glycoproteins.
... These results demonstrated that i GVP 16, pGVP 6, pGVP lla, and nonreduced pGVP 6 have N-linked oligosaccharides of the high-mannose type; ii GVP 6 and GVP Ila lack the high-mannose-type[r] ...
10
Ostreid herpesvirus 1 infection in Pacific oysters (Crassostrea gigas) New Zealand : a thesis presented in partial fulfilment of the requirements for the degree of Master of Veterinary Studies at Massey University, Palmerston North, New Zealand
... Oyster herpesvirus-like infection has been reported in different bivalve mollusc hosts, including other ostreid species, clams and scallops; for example the flat oyster in New Zealand, Tiostrea chilensis (Hine, ...
140
Genomic termini of equine herpesvirus 1.
... B Relevant restriction enzyme sites used for generating plasmid clones and the maps of i the left UL terminus plasmid clone T108, ii the right TR terminus plasmid clone S110, iii the UL/[r] ...
8
Bovine Herpesvirus 1 UL3.5 Interacts with Bovine Herpesvirus 1 α-Transinducing Factor
... To clone the ␣BTIF gene, primers CGGGATCCGTTGTCTTTGGGATGA GCGGGCGCA and CCGAATTCTAGAAGTCCAGCAGCTGGTTGAGGC (viral sequences underlined) were used to amplify the complete ␣BTIF ORF by PCR with Pfu polymerase. Since the two ...
9
A neurotropic herpesvirus infecting the gastropod, abalone, shares ancestry with oyster herpesvirus and a herpesvirus associated with the amphioxus genome
... to herpesvirus proteins, most notably those of Ostreid her- pesvirus 1 (oyster herpesvirus 1, OsHV-1), a virus infect- ing bivalve mollusc ...abalone herpesvirus or ...
9
Equine herpesvirus infections in yearlings in South-East Queensland.
... Equid herpesvirus 1 (EHV-1) and Equid herpesvirus 4 (EHV-4) by real- time PCR targeting the glycoprotein B ...equid herpesvirus with the formation of ...
18
Alphaherpesviruses and Chemokines: Pas de Deux Not Yet Brought to Perfection
... (Table 1). The human pathogens herpes simplex virus type 1 (HSV-1), HSV-2, and varicella-zoster virus (VZV) are the causative agents of cold sores, genital ulcerous disease, and chickenpox/ shingles, ...
8
Pangaea and the Out-of-Africa Model of Varicella-Zoster Virus Evolution and Phylogeography
... virus 1; HSV-2, herpes simplex virus 2; SA-8, simian agent 8; HVB, herpesvirus B; BHV-1, bovine herpesvirus 1; BHV-5, bovine herpesvirus 5; PRV, pseudorabies virus; EHV-1, ...
8