Human Monocyte/Macrophages
Uptake of cholesterol rich remnant lipoproteins by human monocyte derived macrophages is mediated by low density lipoprotein receptors
... human monocyte-macrophages. Immunoblots of monocyte-macrophage extracts with these antibodies revealed a single protein in human macrophages with an apparent molecular weight ...
10
Epstein-Barr Virus Infection Induces Indoleamine 2,3-Dioxygenase Expression in Human Monocyte-Derived Macrophages through p38/Mitogen-Activated Protein Kinase and NF-κB Pathways: Impairment in T Cell Functions
... tumor-infiltrated macrophages, but its infection effects on macrophage immune functions are poorly ...some macrophages in the tumor stroma of nasopharyngeal car- cinoma (NPC) tissue expressed the ...
12
Lipoprotein lipase secretion by human monocyte derived macrophages
... Human monocyte-derived macrophages in culture produced lipoprotein ...Since macrophages are prominent components of atherosclerotic lesions in man, their ability to synthesize and secrete ...
5
Cytokine response to lipoprotein lipid loading in human monocyte-derived macrophages
... of human atherosclerotic plaques, usually considered to be correlated to uptake of and inflammatory response to oxidized low density lipoproteins ...primary human macrophages either loaded with ...
8
Profiling post-translational modifications of histones in human monocyte-derived macrophages
... primary human cells. Although human trans- formed cell lines reflect mechanisms operative in pri- mary human cells, substantial effort is required to prove experimentally the degree of histone code ...
13
Nogo B is associated with cytoskeletal structures in human monocyte derived macrophages
... knockout macrophages show less actin expression and cell spreading than wildtype ...knockout macrophages observed by Yu et al [20] might also be explained by an impaired function of ...
8
Substance P augments tumor necrosis factor release in human monocyte-derived macrophages.
... SP stimulates human peripheral blood monocytes to produce inflammatory cytokines, such as inter- leukin-1 (IL-1), interleukin-6 (IL-6), and tumor necrosis factor (TNF), which are importa[r] ...
5
The reactivity of desmosterol and other shellfish and xanthomatosis associated sterols in the macrophage sterol esterification reaction
... to human monocyte- derived macrophages, ACAT was stimulated 29- and 4-fold compared with control and cholesterol-treated cells, ...treated human macrophages was 10-fold greater than in ...
10
HIV relies on neddylation for ubiquitin ligase mediated functions
... Vpx-mediated depletion of SAMHD1 showed a clear reliance on neddylation in primary human monocyte- derived macrophages, in differentiated THP1 cells and in HEK293T cells. Interestingly however, ...
12
Localization of HIV 1 Vpr to the nuclear envelope: Impact on Vpr functions and virus replication in macrophages
... Results: In order to define the functional role of Vpr localization at the NE, we have characterized a set of single-point Vpr mutants, and selected two new mutants with substitutions within the first α-helix of the ...
15
A novel hybrid aspirin-NO-releasing compound inhibits TNFalpha release from LPS-activated human monocytes and macrophages
... from human monocyte- derived macrophages and ...monocytes, macrophages and neutrophils fol- lowing their stimulation by bacterial ...LPS-activated human mono- cyte-derived ...
10
Role of the basic domain of human immunodeficiency virus type 1 matrix in macrophage infection.
... Lentiviruses, including HIV-1, are able to infect nondividing cells, while oncoretroviruses require that the host cell pass through mitosis for a productive infection to become estab- lished (3, 23, 29, 38, 42). The ...
6
Gene expression profiling of macrophages: implications for an immunosuppressive effect of dissolucytotic gold ions
... the human THP-1 cell line which shares many properties with human monocyte-derived macrophages [32] but does not resemble monocytes-macrophages isolated from human ...
8
Enhancement of macrophage candidacidal activity by interferon gamma Increased phagocytosis, killing, and calcium signal mediated by a decreased number of mannose receptors
... of human monocyte-derived macrophages to ingest and kill both opsonized and unopsonized Candida albicans and to release superoxide anion upon stimulation with ...ingestion; macrophages that ...
7
Human-induced pluripotent stem cell-derived macrophages and their immunological function in response to tuberculosis infection
... a human monocyte cell ...of macrophages, such as round, oval, fusiform and irregular ...from human monocyte cell line in response to BCG ...
14
Toll-like receptor-4 mediates cigarette smoke-induced cytokine production by human macrophages
... primary human cells by CS medium, an exploratory study was per- formed measuring several inflammatory cytokines which are also known to be involved in ...a human monocyte-derived macrophage culture ...
11
GPR101 mediates the pro resolving actions of RvD5n 3 DPA in arthritis and infections
... on human macrophages. (A) Human monocyte–derived macrophages were incubated with either an siRNA against GPR101 or a control sequence (CT siRNA) for 96 hours, and GPR101 expression was ...
16
Opsonization of malaria infected erythrocytes activates the inflammasome and enhances inflammatory cytokine secretion by human macrophages
... isolated human erythrocytes were not ingested by MDM but were efficiently ingested when opsonized with rabbit anti-human erythrocyte antibody, which served as the positive ...
13
Augmentation of virus secretion by the human immunodeficiency virus type 1 Vpu protein is cell type independent and occurs in cultured human primary macrophages and lymphocytes.
... HIV-1-positive human serum and a polyclonal rabbit serum specific for HIV-1 gp160/gp120 proteins, preadsorbed to protein G-Sepharose, as described elsewhere (48, 63, ...
13
6090.pdf
... differentiated macrophages were transfected with mir-181a mimic (5'AACAUUCA ACGCUGUCGGUGAGU) or inhibitor (5' AACAUUCAACGCUGUCGGUGAGU) (Qiagen) using HiPerfect reagent (Qiagen) according to manufacturer’s ...
40