IgG1 Fc
Citrullination facilitates cross-reactivity of rheumatoid factor with non-IgG1 Fc epitopes in rheumatoid arthritis
... Rheumatoid factor (RF) and anti-citrullinated protein antibodies (ACPAs) are the two most prevalent autoantibodies in rheumatoid arthritis (RA), and are thought to have distinct autoantigen targets. Whilst RF targets the ...
7
Surface displaying of swine IgG1 Fc enhances baculovirus-vectored vaccine efficacy by facilitating viral complement escape and mammalian cell transduction
... swine IgG1 Fc resulted in an increase in complement escape by the classical pathway (Additional file ...most Fc-fusion drugs and recombinant cells displaying IgG1 Fc demonstrated ...
11
Fusion Protein Comprising Factor H Domains 6 and 7 and Human IgG1 Fc as an Antibacterial Immunotherapeutic
... human IgG1 Fc (FH6,7/HuFc) and tested its activity as an immunotherapeutic against Neisseria meningi- tidis, which binds FH through domains 6 and ...
8
Computational Design of Antiangiogenic Peptibody by Fusing Human IgG1 Fc Fragment and HRH Peptide: Structural Modeling, Energetic Analysis, and Dynamics Simulation of Its Binding Potency to VEGF Receptor
... Peptibodies represent a new class of biological therapeutics with combination of peptide activity and antibody-like properties. Previously, we discovered a novel peptide HRH that exhibited a dose-dependent ...
8
A recombinant human IgG1 Fc multimer designed to mimic the active fraction of IVIG in autoimmunity
... ordered Fc-multimers and binds to Fc receptor–expressing immune cells from differ- ent ...human IgG1 Fc, which contains hinge CH2 and CH3 domains (Figure ...human Fc homodimer control, ...
20
Pro-inflammatory pattern of IgG1 Fc glycosylation in multiple sclerosis cerebrospinal fluid
... CSF IgG1 glycosylation correlates with intrathecal signs of inflammation within the MS ...group. IgG1 glycosylation in CSF, normalized to serum, is plotted against the CSF cell count (a) and intrathecal IgG ...
14
An HIV Envelope gp120-Fc Fusion Protein Elicits Effector Antibody Responses in Rhesus Macaques
... adding Fc to gp120 in terms of altering the quantity or quality of the resulting antibody ...adding Fc segments to any of the high-performing envelope glycopro- tein immunogens may improve their capacity to ...
11
Engineering the fragment crystallizable (Fc) region of human IgG1 multimers and monomers to fine tune interactions with sialic acid dependent receptors
... and Fc-fusion proteins are actively being explored as biomimetic replacements for IVIG therapy, which is deployed to manage many diseases and conditions but is expensive and not always ...The Fc region of ...
15
Fc-Glycosylation in Human IgG1 and IgG3 Is Similar for Both Total and Anti-Red-Blood Cell Anti-K Antibodies
... with IgG1 and IgG3 being the most abundant subclasses directed against protein anti- ...to IgG1-Fc-receptor (Fc γ R)IIIa/b and thereby directly affects downstream effector functions and ...
11
Receptor Usage and Cell Entry of Porcine Epidemic Diarrhea Coronavirus
... human IgG1 Fc ...human IgG1 Fc tag) and porcine APN (pAPN) or human APN (hAPN) (with a C-terminal His 6 tag) using a procedure as previously described ...
5
Heterogeneity in Rhesus Macaque Complement Factor H Binding to Meningococcal Factor H Binding Protein (FHbp) Informs Selection of Primates To Assess Immunogenicity of FHbp-Based Vaccines
... human IgG1 Fc (FH 6,7/Fc) or FH domains 18, 19, and 20 (FH 18 –20/Fc) inhibited binding of macaque FH to ...IgG2a Fc had been replaced by human IgG1 Fc ...
7
Overcome the Impairment of NK Cells for Icon and Antibody Immunotherapy of Cancer
... VII/IgG1 Fc immunoconjugate, which, to our best knowledge, was the first therapeutic agent for dual targeting of both the tumor cells and tumor angiogenic endothelial cells) for cancer ...
8
MicroRNA expression profiles in human CD3+ T cells following stimulation with anti human CD3 antibodies
... Abbreviations FvFc: single chain Fv fragment fused to a human IgG1 Fc; mAb: monoclonal antibody; miRNAs: microRNAs; PBMC: peripheral blood mononuclear cells; qPCR: quantitative PCR; TCR:[r] ...
8
Cell Surface Heparan Sulfate Is a Receptor for Human Herpesvirus 8 and Interacts with Envelope Glycoprotein K8.1
... the Fc part from human IgG1 (GenBank accession ...the IgG1 Fc part ...and Fc-Xh1r (GATCCTCGAGATTTACCCGGAGACAGGGAG) and ligated via BamHI and XhoI restriction sites into the ...
11
Insertion of N Terminal Hinge Glycosylation Enhances Interactions of the Fc Region of Human IgG1 Monomers to Glycan Dependent Receptors and Blocks Hemagglutination by the Influenza Virus
... the Fc of IgG is critically important, the receptor binding and functional properties of the Fc are lost after deglycosylation or removal of the unique Asn 297 N-X-(T/S) ...sialylated Fc has ...
24
AAV-expressed eCD4-Ig provides durable protection from multiple SHIV challenges
... human IgG1 Fc domain (e), one bearing rhesus CD4 domains 1 and 2 with the I39N mutation, again fused to the human IgG1 Fc domain (f), or the antibody NIH45-46 fused to the rhesus IgG2 constant ...
31
Conserved Fc gamma R- glycan discriminates between fucosylated and afucosylated IgG in humans and mice
... the Fc-N297 glycan is important for the affinity of human IgG to hFcγRIIIa and that this is conserved for the a ffi nity of mouse IgG to mFc γ ...the IgG1-Fc galactosylation on a ffi nity for hFc γ RIIIa: ...
7
Production in yeast of pseudotype virus-like particles harboring functionally active antibody fragments neutralizing the cytolytic activity of vaginolysin
... scFv- Fc proteins neutralizing the cytolytic activity of vaginolysin (VLY), the main virulence factor of Gardnerella ...human IgG1 Fc domain. Four different variants of anti-VLY scFv-Fc fusion ...
13
Hierarchical and Redundant Roles of Activating FcγRs in Protection against Influenza Disease by M2e-Specific IgG1 and IgG2a Antibodies
... individual Fc ␥ Rs by graded concentrations of MAb 37 and MAb 65 bound to PR8 virus-infected MDCK ...Control IgG1 and IgG2a monoclonal antibodies did not activate any of the Fc ␥ R- s in this assay ...
13
Utilization of Immunoglobulin G Fc Receptors by Human Immunodeficiency Virus Type 1: a Specific Role for Antibodies against the Membrane-Proximal External Region of gp41
... of Fc ␥ Rs in determining the fate of human immunode- ficiency virus type 1 (HIV-1) immune complexes, cDNAs for the four major human Fc ␥ receptors (Fc ␥ RI, Fc ␥ RIIa, Fc ␥ RIIb, and ...
14