miR-182
CircRNA hsa_circRNA_0001776 inhibits proliferation and promotes apoptosis in endometrial cancer via downregulating LRIG2 by sponging miR-182
... of miR-182 in EC, we screened the potential target gene of miR-182 via ...and miR-182 mimics compared with the control group, while the luciferase activity had no signifi- cant ...
13
Hypoxia-inducible MiR-182 promotes angiogenesis by targeting RASA1 in hepatocellular carcinoma
... that miR-182 promoted angiogenesis in HCC by applying ...of miR-182 in HCC progression, we discovered that RASA1 was the direct target of miR-182 by the following evidence: ...
9
Original Article Expression of miR-182 and Foxo3a in patients with bladder cancer correlate with prognosis
... of miR-182 was related to the TNM stage and depth of the ...of miR-182 was signifi- cantly lower than that of those with higher miR- 182 expression (P = ...of ...
11
Original Article miR-182 promotes cell proliferation and invasion by inhibiting APC in melanoma
... that miR-7-5p inhibits melanoma cell migration in melanoma by directly regulating IRS-2 expres- sion ...of miR-7-5p is downregulated in metastatic melanoma cell ...of miR-7-5p could significantly ...
9
<p>Long Noncoding RNA SNHG16 Sponges miR-182-5p And miR-128-3p To Promote Retinoblastoma Cell Migration And Invasion By Targeting LASP1</p>
... or miR-128-3p inhibited cell migration and invasion of retinoblastoma ...that miR-182-5p and miR-128-3p interacted and regulated SNHG16 ...studies, miR-182-5p was reported to ...
10
Original Article Down-regulation of miR-182 and miR-183 acts as potential predictor biomarkers in progression, metastasis, and poor prognosis of non-small cell lung cancer
... of miR-182 and miR-183 and its potential relevance to clinicopathological features and patient ...of miR-182 and miR-183 expression with clinicopathological features and ...
6
Clinical value of miR 182 5p in lung squamous cell carcinoma: a study combining data from TCGA, GEO, and RT qPCR validation
... of miR- 182-5p in LUSC from PubMed, Wiley Online Library, EBSCO, Cochrane Central Register of Controlled Trials, Web of Science, Google Scholar, Ovid, EMBASE, and LILACS, until 5 October 2017, and the ...
16
P< 0.001). Univariate and multivariate survival analyses further showed that miR-182 expression was
... of miR- 182 for CRC patients, we also analyzed the association between miR-182 expression and survival duration using Kaplan-Meier analysis with the log-rank ...of miR-182 was ...
6
TGF β induces miR 182 to sustain NF κB activation in glioma subsets
... of miR-182 in gliomas. Furthermore, TGF-β/Smad induced miR-182 ...increasing miR-182 expres- sion and further reducing CYLD ...
17
Review Article Effect of miR-182 targeting MTSS1 on the proliferation and metastasis of esophageal cancer
... CAGAAAAATCAAAAGACTAGCGGCCGCTAGTTT3’. Amplified MTSS1-3’UTR was inserted into the downstream of coding region of pmirGLO firefly luciferase vector to construct pmirGLO-MTSS1. pmirGLO-MTSS1 and pmirGLO were transfect- ed ...
7
miR-182-5p promotes hepatocellular carcinoma progression by repressing FOXO3a
... 5]. miR-182-5p, a member of the miR-183/96/182 cluster, emerged as a high- priority miRNA in HCC and has been proven to be related to various ...of miR-182-5p is complicated ...
12
Elevated circulating miR-182 acts as a diagnostic biomarker for early colorectal cancer
... of miR-182 and ...of miR-182 and miR- ...the miR-182 and miR-20a calculated in the training phase were independently assessed in additional 150 subjects (50 CRC ...
9
Original Article miR-182 induces cervical cancer cell apoptosis through inhibiting the expression of DNMT3a
... that miR-182 has a capability to inhibit the expression of DNMT3a, and ulti- mately to mediate the apoptosis of cervical cancer ...to miR-182-induced apoptosis, demonstrating a plausible ...
9
Original Article CAT104 silence behaves as a tumor suppressor in human leukemia cells by down regulating miR-182 expression
... of miR-182 on leukemia ...downregulating miR-182 expression. miR-182 plays an onco- genic role in AML by upregulating ZEB1 expres- sionvia which miR-182 silence ...
12
miR-182 promotes tumor growth and increases chemoresistance of human anaplastic thyroid cancer by targeting tripartite motif 8
... of miR-182 in human ATC ...of miR-182 in ...that miR-182 induced cellular growth by repressing TRIM8 ...overexpressed miR-182 contrib- uted to the chemoresistance ...
8
Mechanisms of brain wiring by axonal miRNAs: miR-181 and miR-182
... 70 was preserved in these animals. This suggests that these defects may be linked to altered molecular programs specifically in these projecting neurons, although impaired cue expression within the axonal environment ...
247
Original Article Tissue microRNA-182 expression level and its potential prognostic value for papillary thyroid carcinoma
... higher miR-182 levels in papillary thyroid carcinoma (PTC) than matched normal ...of miR-182 have not been investigated in PTC until ...between miR-182 expression and the ...
6
Original Article MicroRNA-182-5p inhibits inflammation in LPS-treated RAW264.7 cells by mediating the TLR4/NF-κB signaling pathway
... For miR-182-5p analysis, RNA was extracted from lung tissues using the miRNeasy mini kit (Qiagen, West Sussex, UK) according to the manufacturer’s ...primers: miR-182-5p, forward 5’-TT- ...
10
Original Article microRNA-182-5p alleviates spinal cord injury by inhibiting inflammation and apoptosis through modulating the TLR4/NF-κB pathway
... miRNAs, miR-182-5p was one of the most downregulated and has also been reported to play different roles in inflam- matory ...example, miR-182-5p ameliorated liver ischemia-reperfusion injury ...
11
MiR 183/ 96/ 182 cluster is up regulated in most breast cancers and increases cell proliferation and migration
... The MiR-183/-96/-182 cluster is a conserved polycis- tronic miRNA cluster that is highly expressed in several tumor ...governing MiR-183/-96/-182 expression in breast cancer are still ...that ...
17