Primer sequences used for HPV 16 sequencing:
Automated degenerate PCR primer design for high throughput sequencing improves efficiency of viral sequencing
... degenerate primer design pipeline is to maximize the success rate of selected primer pairs, given a set of sequences that are assumed to represent the target ...predict primer pairs that have ...
9
PARSES: A Pipeline for Analysis of RNA-Sequencing Exogenous Sequences
... widely used techniques to interrogate the transcriptome of an organism since the advent of next generation sequencing technologies ...exogenous sequences that may shed light on other factors ...
79
Comparison of the Abbott RealTime High Risk Human Papillomavirus (HPV), Roche Cobas HPV, and Hybrid Capture 2 Assays to Direct Sequencing and Genotyping of HPV DNA
... positive. Sequencing and ...three HPV detection assays, their HPV genotypes were identified using PCR and ...were used for PCR: forward, TTT GTT ACT GTT GTR GAT ACY AC, and reverse, GAA AAA ...
7
Metagenomic sequencing with spiked primer enrichment for viral diagnostics and genomic surveillance.
... next-generation sequencing (mNGS) is a promis- ing candidate approach for broad-spectrum pathogen identification in clinical samples, as nearly all potential pathogens (viruses, bac- teria, fungi and parasites) ...
15
Primer Pairs for Rice (Oryza sativa L.) Bisulfite Sequencing Studies
... generation sequencing (NGS) technologies do not require the use of target specifi c primer pairs to identify and study DNA cytosine methylation, validation studies of NGS uses selective primer ...te ...
8
DisV HPV16, versatile and powerful software to detect HPV in RNA sequencing data
... Cell culture and RNA extraction The head and neck cancer cell line SCC47 was kindly provided by Prof. Henning Willers (Harvard University). The cervical cancer cell line SIHA was maintained in our laboratory. Cells were ...
7
16S rRNA gene sequencing of mock microbial populations-impact of DNA extraction method, primer choice and sequencing platform
... gene primer choice and sequencing platform on results, we next aimed to determine the effects of DNA extraction procedures on the sequencing results ...platform used, rather than on the choice ...
14
Oncogenic Human Papillomavirus (HPV) Type Distribution and HPV Type 16 E6 Variants in Two Spanish Population Groups with Different Levels of HPV Infection Risk
... been used to determine specific HPV ...direct sequencing. In order to compare type-specific HPV prevalence in different geographical areas, it is necessary to bear in mind the molecular ...
7
Interrupted coding sequences in Mycobacterium smegmatis: authentic mutations or sequencing errors?
... often used as a model organism for studies of ...the sequences of some proteins have been incorrectly predicted due to sequencing ...whereas sequencing errors generate false knowledge and ...
9
Post Hoc Analysis of the PATRICIA Randomized Trial of the Efficacy of Human Papillomavirus Type 16 (HPV-16)/HPV-18 AS04-Adjuvanted Vaccine against Incident and Persistent Infection with Nonvaccine Oncogenic HPV Types Using an Alternative Multiplex Type-Specific PCR Assay for HPV DNA
... DNA sequences of different HPV types detected by the SPF 10 PCR primer ...baseline HPV or cytological status, while women in the ATP-E had to be HPV DNA negative for the corresponding ...
10
Human Papillomavirus Type 16 (HPV-16) Genomes Integrated in Head and Neck Cancers and in HPV-16-Immortalized Human Keratinocyte Clones Express Chimeric Virus-Cell mRNAs Similar to Those Found in Cervical Cancers
... of HPV-16 genomes in HPV-associated HNC tumors to those in HPV-immortalized keratinocyte clones by restriction enzyme analysis and mRNA ...unintegrated HPV-16 plasmid ge- nomes, ...
10
Multiple ASF/SF2 Sites in the Human Papillomavirus Type 16 (HPV-16) E4-Coding Region Promote Splicing to the Most Commonly Used 3′-Splice Site on the HPV-16 Genome
... spliced HPV-16 mRNA ...major HPV-16 3 ⴕ-splice site SA3358 is dependent on ...is used by the most abundantly expressed HPV-16 mRNAs, including those encoding E6 and ...
12
Human Papillomavirus 16 (HPV-16), HPV-18, and HPV-31 E6 Override the Normal Phosphoregulation of E6AP Enzymatic Activity
... Since changes in the subcellular distribution of many phosphorylated proteins are controlled by members of the 14-3-3 family (25), which have also been shown to be important partners of the high-risk HPV E6 ...
12
Chimeric Human Papillomavirus Type 16 (HPV-16) L1 Particles Presenting the Common Neutralizing Epitope for the L2 Minor Capsid Protein of HPV-6 and HPV-16
... using HPV type 16 (HPV-16) L1 subunits to display a well-characterized HPV-16 L2 epitope (LVEETSFIDAGAP), which is a common-neutralizing epitope for HPV types 6 and ...
8
PDZRN3/LNX3 Is a Novel Target of Human Papillomavirus Type 16 (HPV-16) and HPV-18 E6
... (indicating HPV-18 E6 knockdown [21]), strong nu- clear PDZRN3 staining is also ...of HPV-18 E6 in HeLa cells decreases levels of phosphorylated ...of HPV-18 ...expressing HPV-18 ...
6
Evaluation of HPV-16 and HPV-18 Genotyping for the Triage of Women With High-Risk HPV+ Cytology- Negative Results
... incorporating HPV-16/HPV-18 genotyping when managing women 30 years or older undergoing routine cervical cancer screening and found to be HR-HPV+ with NILM ...strategy, HPV- ...
9
PDZ Domain-Containing Protein NHERF-2 Is a Novel Target of Human Papillomavirus 16 (HPV-16) and HPV-18
... treatment, cells were harvested and the levels of NHERF-2 protein were analyzed by 213.. Western blotting.[r] ...
46
Analysis of HPV-16 Late Gene Expression
... of HPV gene expression HPV gene expression is regulated at the transcriptional level by the use of the two major promoters activated at different stages of cell differentiation (Lambert et ...in HPV ...
263
Table SI. Reverse transcription-quantitative PCR primer sequences. Primer sequence (5'-3')
... PCR primer sequences. Gene Primer sequence (5'-3') GNA12-FP AAGTCCACGTTCCTCAAGC GNA12-RP CCAAGGAATGCCAAGCTTATC BST2-FP TGATCTCATCAGTTCTGAGCGGGT BST2-RP AGACCTGCTCCAGAGGCCCTTCTC THPO-FP ...
10
More men than women make mucosal IgA antibodies to Human papillomavirus type 16 (HPV 16) and HPV 18: a study of oral HPV and oral HPV antibodies in a normal healthy population
... oral HPV IgA in adult men compared with ...to HPV have been reported. The prevalence of HPV serum antibodies is apparently consistently lower in men than in ...
10