Profilin-1
Original Article Silencing profilin-1 confers protection from oxLDL injury in human vascular endothelial cells
... 21]. Profilin-1, an actin binding protein with low molecular weight, exists widely in various tissues and plays an important role in ECs injuries process by regu- lating the polymerization and ...
9
Original Article Profilin-1 mediates microvascular endothelial dysfunction in diabetic retinopathy through HIF-1α-dependent pathway
... type 1 and type 2 diabetes, including primary hypertonicity, subsequent apoptosis, and angiogenesis, ...and profilin-1, etc) are in persistent exploration day after day [4, ...
9
The role of profilin-1 in endothelial cell injury induced by advanced glycation end products (AGEs)
... of profilin-1 in cultured endothelial cells, resulting in cytoskeletal structural remodelling ...of profilin-1 up-regulated the expression of ICAM-1, increased endothelial cell ...
11
In vivo MR and Fluorescence Dual-modality Imaging of Atherosclerosis Characteristics in Mice Using Profilin-1 Targeted Magnetic Nanoparticles
... of profilin-1 protein may exert protective roles from pathological conditions ...that profilin-1 was mainly expressed in vascu- lar smooth muscle cells of atherosclerotic ...and ...
15
The effect of piperlongumine on endothelial and lung adenocarcinoma cells with regulated expression of profilin-1
... with 1% bovine serum albumin (Sigma-Aldrich; 30 minutes, ...(1:100, 1 hour, RT, ThermoFisher), rabbit anti- β -catenin (1:100, 1 hour, RT, Sigma-Aldrich), and mouse ...
18
Guttiferone K suppresses cell motility and metastasis of hepatocellular carcinoma by restoring aberrantly reduced profilin 1
... Hepatocellular carcinoma (HCC) is an aggressive malignancy and the 5-year survival rate of advanced HCC is < 10%. Guttiferone K (GUTK) isolated from the Garcinia genus inhibited HCC cells migration and invasion in ...
14
Profilin 1 is required for peripheral nervous system myelination
... Myelination allows rapid saltatory propagation of action potentials along the axon and is an essential prerequisite for the normal functioning of the nervous system. During peripheral nervous system (PNS) development, ...
9
Role and regulation of Abelson tyrosine kinase in Crk-associated substrate/profilin-1 interaction and airway smooth muscle contraction
... Background: Airway smooth muscle contraction is critical for maintenance of appropriate airway tone, and has been implicated in asthma pathogenesis. Smooth muscle contraction requires an “ engine ” (myosin activation) ...
12
Original Article DSTYK knockout affects the architecture of F-actin cytoskeleton in mouse renal proximal convoluted tubules
... proteins, Profilin 2 is of particular interest because Profilins are small actin binding pro- teins which play an important role in F-actin polymerization and regulate the structure of F-actin [16, ...whether ...
15
Proteomics identification of radiation-induced changes of membrane proteins in the rat model of arteriovenous malformation in pursuit of targets for brain AVM molecular therapy
... the profilin family, at high concentrations; it increases the ADP-to-ATP exchange on G-actin, and prevents the polymerization of actin, whereas at low concentrations it enhances it [13, ...14]. ...
8
A Role for GEA1 and GEA2 in the Organization of the Actin Cytoskeleton in Saccharomyces cerevisiae
... The kanamycin gene and the flanking sequences of the ARF3 Strains, media, and transformations: Yeast strains used in gene were amplified using the EHZ100 (arf3⌬) strain DNA this study are listed in Table 1. Cells ...
12
Molecular cloning and expression analysis of profilin in red swamp crayfish Procambarus clarkia
... Real-time RT-qPCR was employed to quantitate changes in mRNA levels for the pc-profilin gene in a range of tissues. DNA-free total RNA from ovary, hemocyte, gill, lymphoid organ, intestine, hepatopancreas and ...
7
Differential Activity of Ras1 during Patterning of the Drosophila Dorsoventral Axis
... SCHUPBACII, 1992 The torpedo (DER) receptor tyrosine kinase is required at multiple times during Drosophila embryogenesis. AYERS, 1992 chickadee encodes a profilin requ[r] ...
13
Suppression of the Profilin-Deficient Phenotype by the RHO2 Signaling Pathway in Saccharomyces cerevisiae
... GTAGTCAAGTTCTTTTTGTGTTTACGCATAGGCCACTAG residues. In addition to the suppression of the profilin- TGGATCTG. The resulting PCR product, containing the kan deficient phenotype, the MID2 gene was selected as a gene ...
14
Members of the Arabidopsis Actin Gene Family Are Widely Dispersed in the Genome
... Plant genomes are subjected to a variety of DNA turnover mechanisms that are thought to result in rapid expansion and presumable contraction of gene copy number. The evolutionary history of the 10 actin genes in ...
13
Root hair formation: F-actin-dependent tip growth is initiated by local assembly of profilin-supported F-actin meshworks accumulated within expansin-enriched bulges
... myosins, profilin, expansin, and calreticulin primary antibodies were stained with FITC-conjugated anti-rabbit IgGs raised in goat (Sigma-Aldrich Chemie) diluted 1:100 in PBS for 60 min at room ...diluted ...
16
Lee, Soo Sim (2000): Functional studies of selected actin binding proteins by point mutations and GFP fusions. Dissertation, LMU München: Fakultät für Biologie
... The in vivo studies were made in collaboration with Timo Zimmermann (Zoological Institute, LMU, Munich). Confocal microscopy investigations of the severin-GFP fusion protein revealed transient accumulation of severin in ...
152
Dolce, Luca (2005): A DNA-Microarray screening: δ-Catenin, a new mediator of Eph-ephrin signaling. Dissertation, LMU München: Fakultät für Biologie
... Well-known effectors that can be activated by both Rac and Cdc42 belong to the p21- activated kinase (PAK) family of serine/threonine kinases. PAK proteins have been ascribed roles in regulating actin cytoskeleton ...
186
Profilin is an effector for Daam1 in non canonical Wnt signaling and is required for vertebrate gastrulation
... Characterizing the requirement for Profilin1 in cytoskeletal changes, we showed that Profilin1 and Daam1 are localized to actin stress fibers in response to Wnt stimulation in NIH3T3 cells (Fig. 2C,D). To our knowledge, ...
13
Control of oligodendroglial cell number by the miR 17 92 cluster
... regulating their proliferation. The effects of the miR-17-92 knockdown in oligodendrocytes are strikingly similar to the phenotype observed after the conditional loss of Dicer using a Cnp- Cre line (Fig. 1). Dicer ...
6