Recombinant protein-based ELISA
A Thymidine Kinase recombinant protein based ELISA for detecting antibodies to Duck Plague Virus
... Yongping Wen †1 , Anchun Cheng* †1,2,3 , Mingshu Wang* †1,2 , Han Ge †1 , Chanjuan Shen †1 , Sitong Liu 1 , Jun Xiang 1 , Renyong Jia 2 , Dekang Zhu 2 , Xiaoyue Chen 1,3 , Bei Lian 1 , Hua Chang 1 and Yi Zhou 2 Abstract ...
9
ELISA based on a recombinant Paragonimus heterotremus protein for serodiagnosis of human paragonimiasis in Thailand
... this recombinant antigen is quite high, which was evaluated against 32 different diseases as indicated ...the ELISA was not able to discriminate be- tween species-specific ...expressed recombinant P. ...
10
Development of a Recombinant Based ELISA using Specific Antibodies to F Protein in HCV Chronically Infected Patients-A Seroprevalence Study
... Core protein is located in amino acids 11-45, and the shared part of F and Core is the first 10 amino acids, indicates the absence of cross- reactivity between core and F antigenic ...
6
Distinction of subtype specific antibodies against European porcine influenza viruses by indirect ELISA based on recombinant hemagglutinin protein fragment 1
... The recombinant mono-biotinylated HA1 pro- teins presented here as diagnostic antigens in indirect ELISAs provided an interesting alternative in this respect to HI ...
12
Characterization of Sarcoptes scabiei cofilin gene and assessment of recombinant cofilin protein as an antigen in indirect ELISA for diagnosis
... Yu Zheng 1 † , Ran He 1 † , Manli He 1 , Xiaobin Gu 1 , Tao Wang 1 , Weimin Lai 1 , Xuerong Peng 2 and Guangyou Yang 1* Abstract Background: Scabies impairs the health of humans and animals and causes heavy economic ...
7
A recombinant antigen based enzyme linked immunosorbent assay (ELISA) for lungworm detection in seals
... confirmed ELISA results, which revealed solely two out of 27 lungworm-positive serum samples as antibody- ...the ELISA-negative serum samples of northern elephant seals – regardless if posi- tive during ...
8
Determination of exposure to Fasciola hepatica in horses from Uruguay using a recombinant based ELISA
... 5 Faculty of Veterinary Medicine, Technical University of Lisbon, Lisbon, Portugal ABSTRACT: The risk of exposure to Fasciola hepatica in horses from Uruguay was evaluated using ELISA and a recombinant ...
6
USEFULNESS OF RECOMBINANT RHDV ANTIGEN AND VLPs BASED HYPERIMMUNE SERA IN ELISA FOR RHD DIAGNOSIS
... against recombinant VP60 (VLPs) were produced in rabbits and guinea ...of recombinant purified viral protein VP60 (fractions number 6 and 7 were used - Table 1), mixed with Freund’s complete ...
6
Development and evaluation of a recombinant antigen, monoclonal antibody-based competitive ELISA for heartwater serodiagnosis
... cELISA and IFA procedures. An established heartwater- serodiagnostic IFA procedure 5,12 was conducted with a small number of reference and field-origin sera. End point titers of these sera were determined using fixed ...
6
Original Article Development of an indirect ELISA using recombinant ompH protein for serological detection of Riemerella anatipestifer infection in ducks
... membrane protein H (OmpH) of RA, expressed in ...indirect ELISA assay for serological detection of RA ...OmpH protein based ELISA as- say (OmpH-ELISA) was twice higher than that ...
8
An ELISA for antibodies to infectious bronchitis virus based on nucleocapsid protein produced in Escherichia coli
... a recombinant protein. An indirect ELISA assay (N-ELISA) for antibody detection was established using the purified recombinant nucleocapsid ...commercial ELISA kit. It indicated ...
9
Development of porcine rotavirus vp6 protein based ELISA for differentiation of this virus and other viruses
... of recombinant plasmids bearing VP6 gene and its bacterial expression To construct expression plasmids bearing the VP6 gene, forward primer: 5'- CCCCGGATCCATGCAAAATTACG GA(VP6F) and reverse primer (VP6R) 5'- ...
8
Application of recombinant severe fever with thrombocytopenia syndrome virus nucleocapsid protein for the detection of SFTSV specific human IgG and IgM antibodies by indirect ELISA
... rSFTSV-N protein based indirect IgG and IgM ELISA systems presented here eliminate the use of infec- tious virus in the antigen production, which requires high level of microbiological security ...
7
Evaluation of Hepatitis C Virus Glycoprotein E2 for Vaccine Design: an Endoplasmic Reticulum-Retained Recombinant Protein Is Superior to Secreted Recombinant Protein and DNA-Based Vaccine Candidates
... and I-E2 715 bind substantially better to CD81 than do S-E2 661 and S-E2 715 . It was found previously that S-E2 661 binds well to CD81 (18). However, the same authors recently reviewed this finding and reported that ...
8
Mapping the Prion Protein Using Recombinant Antibodies
... the recombinant antibodies by using both peptide-based ELISA studies and PrP fragment libraries displayed on fila- mentous ...to ELISA plates to deter- mine the reactivity of each ...addition, ...
6
Combined use of ELISA and Western blot with recombinant N protein is a powerful tool for the immunodiagnosis of avian infectious bronchitis
... After this period, the secondary antibody horseradish peroxidase (HRP) - rabbit anti-chicken IgY peroxidase conjugate (Sigma) diluted 1:10,000 in PBS-T was added and plates were once more incubated at 37 °C for 1.5 h. ...
8
OxiSelect Protein Carbonyl ELISA Kit
... of protein oxidative modification. The most common products of protein oxidation in biological samples are the protein carbonyl derivatives of Pro, Arg, Lys, and ...
9
An ELISA based high throughput protein truncation test for inherited breast cancer
... Clinical validation of a genomic DNA-based HTS-PTT on BRCA1/2 using a 100-member training sample set To evaluate the HTS-PTT for BRCA mutation analy- sis on clinical samples, we designed primer pairs to fully ...
9
Recombinant Protein Purification Handbook
... enable recombinant proteins to be purified by affinity chromatography, which is designed to capture the tagged recombinant protein based on biorecognition of the ...different ...
306
Recombinant Protein and Synthetic Peptide Based Immunoblot Test for Diagnosis of Neurocysticercosis
... that recombinant proteins can replace the native LLGP antigens in the diagnosis of NCC with compa- rable sensitivity and specificity when used in an immunoblot assay ...the recombinant EITB assay was ...
6