Retroviral vector
Identification of Host Proteins Associated with Retroviral Vector Particles by Proteomic Analysis of Highly Purified Vector Preparations
... tissue-specific retroviral vectors for in vivo applications may find it convenient to prevent the incorporation of these proteins into the ...virions. Vector particles with such broad adhesion properties ...
11
Human Beta Interferon Scaffold Attachment Region Inhibits De Novo Methylation and Confers Long-Term, Copy Number-Dependent Expression to a Retroviral Vector
... SAR-containing retroviral vector expression levels were positively correlated with the proviral copy numbers (P < ...control vector-infected ...control vector showed evidence of partial or ...
8
Development of a retroviral vector for inducible expression of transforming growth factor beta 1.
... By utilizing this system, the cDNA for human transforming growth factor 01 TGF-I1 was inserted into a retroviral vector under the control of an internal mouse metallothionein promoter an[r] ...
5
Characterization of a bicistronic retroviral vector composed of the swine vesicular disease virus internal ribosome entry site.
... These data therefore suggested that insertion of the SVDV IRES in the bicistronic retroviral vector did not affect the cap-dependent translation of the first cistron; the internal initia[r] ...
7
Serial bone marrow transplantation reveals in vivo expression of the pCLPG retroviral vector
... ond retroviral vector, pLPCp53(223) (kindly provided by Andrei Gudkov, Lerner Research Institute, Cleveland, OH) which encodes the human p53 mutant P223L as well as the puromycin resistance ...
10
Direct injection of a recombinant retroviral vector induces human immunodeficiency virus-specific immune responses in mice and nonhuman primates.
... A nonreplicating recombinant retroviral vector, encoding the human immunodeficiency virus type 1 HIV-1 IIIB envelope and rev proteins, has been developed and examined for stimulation of [r] ...
9
A method to estimate the efficiency of gene expression from an integrated retroviral vector
... can lead to an overestimate of the proportion of cells har- bouring provirus as detected by direct PCR, especially at early time points after transduction when using vectors produced by the calcium BBS transfection ...
10
Retroviral vector gene expression in F9 embryonal carcinoma cells.
... As internal regulatory sequences are placed into retroviral vectors of increasing relative strength in F9 EC cells, the expression of the vector becomes less dependent upon its integrati[r] ...
6
Targeted and highly efficient gene transfer into CD4+ cells by a recombinant human immunodeficiency virus retroviral vector
... amphotropic murine recombinant retrovirus. Vector preparations were devoid of replication competent, infectious HIV. Gene transfer was dependent on CD4 expression, as shown by expression of the CD4 gene in HeLa ...
6
Tissue-Specific Transcriptional Targeting of a Replication-Competent Retroviral Vector
... replication-competent retroviral (RCR) vectors based on murine leukemia virus ...RCR vector replication to tumor cells are ...RCR vector replication by replacing various lengths of the MLV ...
9
Cationic Liposomes Enhance the Rate of Transduction by a Recombinant Retroviral Vector In Vitro and In Vivo
... (MLV-A) vector was also dependent on virus concentration rather than virion-cell multiplicity ...of retroviral particles in the medium imposes a significant limitation for infection of adherent NIH 3T3 ...
9
Instability of retroviral vectors with HIV-1-specific RT aptamers due to cryptic splice sites in the U6 promoter
... of retroviral vectors play a role in gene expression and ...gamma-retroviral vector expressing GFP and containing the U6-aptamer cassettes in the reverse ...the vector during shuttle packaging ...
14
High efficiency myogenic conversion of human fibroblasts by adenoviral vector mediated MyoD gene transfer An alternative strategy for ex vivo gene therapy of primary myopathies
... adenoviral vector expressing MyoD under the control of a viral promoter can induce massive myogenic conversion of human and murine primary fibroblasts in culture, with an overall efficiency largely exceeding ...a ...
11
Adaptation of Chimeric Retroviruses In Vitro and In Vivo: Isolation of Avian Retroviral Vectors with Extended Host Range
... recombinant retroviral vector RCASBP(Eco) was prepared as ...the retroviral vector RCASBP(A) (55), using primers RSV-ECOF1 (GA GTGGGAAAAAGGATGGAACG) and RSV-ECORIE (AGTGGACCCGGG ...the ...
11
Genetic rearrangements occurring during a single cycle of murine leukemia virus vector replication: characterization and implications.
... parental vector pro- ...with vector plasmid pMSTK2 and selection in medium containing G418, (ii) harvesting vector virus from the G418- ...1. Retroviral vector MSTK2 and the infection ...
10
The Zinc Finger Antiviral Protein Directly Binds to Specific Viral mRNAs through the CCCH Zinc Finger Motifs
... MLV vector, we cloned the 5 ⬘ -LTR and 3 ⬘ -LTR of the MLV-Luc retroviral vector into the pGL3-Luc reporter, which is nearly insensitive to ZAP ...
7
Analysis of the functional and host range-determining regions of the murine ectropic and amphotropic retrovirus envelope proteins.
... To determine the tropism of the chimeric envelope-containing retroviral vector particles, culture medium was used to transduce infect the murine NIH 3T3 cell line permissive for ecotropi[r] ...
10
Vascular Gene Transfer of the Human Inducible Nitric Oxide Synthase: Characterization of Activity and Effects on Myointimal Hyperplasia
... Materials and Methods: A retroviral vector containing the human iNOS cDNA (DFGiNOS) was used to transfer the iNOS gene into vascular cells and isolated blood vessels to answer the follow[r] ...
15
Isolation of new oncogenic forms of the murine c-fms gene.
... virus-derived retroviral vector containing the murine c-fms cDNA was pseudotyped with Friend murine leukemia virus and inoculated into newborn DBA/2 ...parental retroviral vector to internal ...
8
Arylsulfatase B activities and glycosaminoglycan levels in retrovirally transduced mucopolysaccharidosis type VI cells Prospects for gene therapy
... fibroblasts. Retroviral transduction of human, cat and rat MPS VI skin fibroblasts was carried out using standard methods ...ASB/MFG retroviral vector, cells were grown to z 30% confluency and viral ...
7