Sequences and phylogenetic analysis
Sequences and Phylogenetic Analysis of Envelope (E) Gene of Iranian Infectious Bronchitis Virus Isolates in Iran
... Joining phylogenetic trees were generated using the Molecular Evolutionary Genetics Analysis (MEGA) software ...trees. Sequences used for comparison or phylogenetic analysis in this ...
8
Saprolegniaceae identified on amphibian eggs throughout the Pacific Northwest,USA, by internal transcribed spacer sequences and phylogenetic analysis
... 68 sequences as Saprolegniaceae and 43 sequences as true fungi from at least nine ...Our phylogenetic analysis of the Saprolegniaceae included isolates within the genera Saprolegnia, Achlya ...
10
Phylogenetic Analysis of 16S rDNA Sequences of Pediococcus acidilactici TISTR 2309:
... Three phylogenetic trees derived from the Maximum Likelihood, Neighbor-Joining and Maximum Pasimony methods, were compared in order to find the relationship of the strains constructed by each ...from ...
8
leBIBIQBPP: a set of databases and a webtool for automatic phylogenetic analysis of prokaryotic sequences
... the phylogenetic analysis of the most closely related sequences in the reference database around a query sequence, using a approximate Maximum Likeli- hood (ML) ...the phylogenetic position of ...
13
PHYLOGENETIC ANALYSIS OF 16SrDNA AND 18SrDNA SEQUENCES OF BACTERIA AND FUNGI FROM KERATITIS PATIENTS
... and Phylogenetic analysis of 16SrDNA and 18SrDNA sequences of bacteria and fungi from infectious eye sample of keratitis ...These sequences were identified using BLASTn (Basic Local Alignment ...
10
Identification of GB virus C variants by phylogenetic analysis of 5'-untranslated and coding region sequences.
... 1997 Phylogenetic analysis of 44 GB virus C (GBV-C) 5 * -untranslated region (5 * -UTR) sequences from 37 individuals suggested the presence of GBV-C genotypes ...our analysis to include 5 * ...
8
Use of tuf Sequences for Genus Specific PCR Detection and Phylogenetic Analysis of 28 Streptococcal Species
... group. Phylogenetic analysis of multiple strains of the same strep- tococcal species revealed that the level of intraspecies tuf se- quence variations depends on the streptococcal ...tuf sequences ...
10
A phylogenetic analysis of Apostasioideae (Orchidaceae) based on ITS, trn L-F and mat K sequences
... molecular phylogenetic analysis has been conducted on the nuclear ITS region and the two plastid DNA regions trnL-F intron and ...family-wide phylogenetic analysis of matK sequences ...
11
Improved strategy for phylogenetic analysis of classical swine fever virus based on full-length E2 encoding sequences
... for phylogenetic analysis, namely fragments of the 5´NTR as well as partial E2 and NS5B encoding regions ...fragment sequences became the world-wide accepted standard for characterization of CSFV ...
15
Use of Phylogenetic Analysis of Hepatitis C Virus (HCV) Hypervariable Region 1 Sequences To Trace an Outbreak of HCV in an Autodialysis Unit
... patients. Phylogenetic analysis of the nucle- otide sequences obtained was carried out in order to investigate any possible epidemiological linkages among ...nucleotide sequences of the HVR1 ...
5
Phylogenetic Analysis of Polyomavirus BK Sequences
... a phylogenetic whole-genome approach to examine the pattern of diversity and evolutionary relationships between 45 BKV strains isolated from multiple clinical ...This analysis supports the classification of ...
12
Phylogenetic Analysis of the Zingiberales Based on \u3cem\u3erbc\u3c/em\u3eL Sequences
... This document was originally published by Biodiversity Heritage Library in Annals of the Missouri Botanical Garden.. Copyright restrictions may apply.[r] ...
12
The evolution of Araliaceae : a phylogenetic analysis based on ITS sequences of nuclear ribosomal DNA
... simony analysis (weighting transversions over tran- sitions ...this analysis is very similar to that in which gaps were treated as new charac- ters, differing only in the relative position of the ...
24
Phylogenetic Analysis of Channa Species of Manipur Based on Mitochondrial Cytochrome b Gene Sequences
... gene analysis: The mitochondrial cytb gene was amplified using the primer CytBF AAAAAGCTTCCATCCAACATCTCAGCATGATGAAA CytBR AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA The PCR amplifications were performed in 50-μl reaction ...
8
Phylogenetic analysis based on mitochondrial DNA sequences of wild rats, and the relationship with Seoul virus infection in Hubei, China
... Among these animals, 37 were SEOV-positive. The reconstruction of the phylogenetic relationship (based on the complete D-loop and cyt-b sequences) allowed the rats to be categorized into two lineages, R. ...
10
Phylogenetic analysis of isolated biofuel yeasts based on 5.8S-ITS rDNA and D1/D2 26S rDNA sequences
... RFLP analysis of the ...RFLP analysis of ...sequence analysis of ...addition, phylogenetic analysis indicated that both BM4 and P41 shared a cluster with ...
7
Single Nucleotide Polymorphism Identification and Phylogenetic Analysis of Pan Troglodytes Using Mitochondrial DNA Coding Region Sequences
... necessary phylogenetic resolution to discern the evolutionary history of the chimpanzee entire mtDNA genome; and (2) to identify informative single nucleotide polymorphisms (SNPs) outside the control region that ...
40
Phylogenetic Analysis and PCR Restriction Fragment Length Polymorphism Identification of Campylobacter Species Based on Partial groEL Gene Sequences
... AluI PCR-RFLP analysis was found to give species-specific discrimination. In contrast to an earlier report of a study that used a limited number of C. coli, C. jejuni, and C. fetus subsp. intestinalis strains ...
9
PHYLOGENETIC ANALYSIS
... PHYLIP is a command-line program and does not have a point-and-click inter- face, as programs like PAUP do. The documentation is well written and very com- prehensive, and the interface is straightforward. A program ...
36
Analysis of correlated mutations, stalk motifs, and phylogenetic relationship of the 2009 influenza A virus neuraminidase sequences
... the phylogenetic tree of a small number of NA sequences was constructed before ...NA sequences being deposited at the NCBI web site regularly, it is constructive to perform phylogenetic ...
9