The primers sequences used for amplification
Amplification of human papillomavirus DNA sequences by using conserved primers
... Use of primers derived from sequences shared by different virus types for PCR amplification of papillomavirus DNA se- quences could be of value for the identification of viral.. sequence[r] ...
6
AutoPrime: selecting primers for expressed sequences
... Background: Primers designed for expressed sequences should be specific for the mRNA sequence of a gene but not yield a product from its genomic ...such primers for RT-PCR experiments by combining ...
8
Impact of Enzymes and Primers on the PCR Amplification of Some Goatfishes
... Polymerase Chain Reaction (PCR) has become a fundamental technique in many genetic applications. Chemical inhibitors reduce the effectiveness of PCR amplification of target genes from genomic DNA (gDNA) of many ...
6
Blocking primers to enhance PCR amplification of rare sequences in mixed samples – a case study on prey DNA in Antarctic krill stomachs
... from amplification by the addition of a modified predator-specific blocking ...modified primers were tested out; one annealing inhibiting primer overlapping with the 3' end of one of the universal ...
11
Blocking primers to enhance PCR amplification of rare sequences in mixed samples – a case study on prey DNA in Antarctic krill stomachs
... from amplification by the addition of a modified predator-specific blocking ...modified primers were tested out; one annealing inhibiting primer overlapping with the 3' end of one of the universal ...
11
Determining optimal amplification parameters and assessing specificity of developed primers
... optimal amplification parameters and assess specificity of developed ...of sequences has been performed, and optimal locations for primers have been searched for the use of the PrimerQuest ...
7
Universal Primers Used for Detection of Bacterial Meningitis
... Department of Pathobiology, School of Public Health, Tehran University of Medical Sciences, Tehran, IR Iran ARTICLE INFO ABSTRACT Article type: Original Article Background: Acute bacterial meningitis is among serious ...
6
PCR Based Genotyping of Mycobacterium tuberculosis with New GC Rich Repeated Sequences and IS6110 Inverted Repeats Used as Primers
... designed primers Mtb1 (5 ⴕ -CCG-GCG-GGG-CCG-GCG-G) and Mtb2 (5 ⴕ -CGG-CGG-CAA-CGG-CGG-C) targeting frequently repeated 16-bp sequences in combination with primers sited at the inverted repeats ...
6
The Effect of Mismatch Primers on the Efficiency of Amplification in Quantitative Polymerase Chain Reactions
... The amplification curves (Figure 11) showed some reactions barely amplifying and others amplifying ...were used for comparing the templates and the primers ...the amplification curve left the ...
75
Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primers
... multiple sequences, it can be much more reliable when target amplifications are within one genotype or within a certain ...occasions, sequences of one genotype or a given group should be used and ...
7
Pcr amplification by two different primers for early diagnosis of schistosoma mansoni infected snails
... of primers for conventional PCR were used and compare between them and shedding, crushing) in attempt to apply this technique in the field for early infection as a trial for better control and prevention of ...
6
Development of a Computer Algorithm for Generation of Primers for Nucleic Acid Sequence Based Amplification (NASBA)
... 11 Biopython is an extensive Python based bioinformatics package that works to incorporate many useful tools in a single repository. One such useful tool is BLAST (Basic local alignment search tool), an algorithm for ...
39
Tab1e 1 Sequences of primers for target genes of amplified fragment. Gene Primer Sequences 5-3 CGTTCGACAAGGGTGACTAT TCGATTGCCACCAAAAGTGC
... Human Epidermal Melanocyte (PIG1) cells were exposed to UVB at doses ranging from 50 to 90mJ/cm 2 to measure melanin content with the NaOH method.. The tyrosinase activity of Human[r] ...
14
Rapid and Simple Amplification of Genomic DNA Sequences Flanking Transposon
... rapid amplification of regions of unknown sequence flanking specified segments of ...since primers should be synthesized from known sequences, the inverse PCR approach is not amenable to proceeding ...
5
Detonators, Igniters, Primers, And Other Initiating Devices Used For Nonmilitary And Military Purposes
... “- In the development of some items in the past, prior to the use of electrical fuzes for PIBD (point initiated base detonated) fuzes, an explosive component known as an auxiliary detonator was used. This ...
22
Abstract: Primers are used to reliably initiate a secondary explosive in a wide range of industrial and
... Abstract: Primers are used to reliably initiate a secondary explosive in a wide range of industrial and defence ...non-toxic primers are discussed in view of these ...
25
Classroom Amplification Technology has been used effectively to
... Infrared classroom amplification systems may be installed or portable. They contain similar system components and operate in much the same manner. The teacher wears a lightweight wireless microphone that trans- ...
10
Detection of Mycobacterium tuberculosis by PCR amplification with pan Mycobacterium primers and hybridization to an M tuberculosis specific probe
... quality-controlled amplification and detection reagents to ensure optimal performance and incorporates dUTP and uracil-N-glycosylase to effectively control false-pos- itive results from carryover ...in ...
6
Detection and Identification of Mycobacteria by Amplification of the Internal Transcribed Spacer Regions with Genus and Species Specific PCR Primers
... ITS sequences of 33 species of mycobacteria were analyzed in a multialignment ...panmycobacterial primers and seven pairs of mycobacterial species-specific primers were ...the primers were ...
7
Supporting Information. Allele-Specific Isothermal Amplification Method Using Unmodified Self-Stabilizing Competitive Primers
... Equations used for thermodynamic calculations of primers. The stability of the primers at the corresponding temperature (63 °C = 336.15 K) was calculated by the Gibbs free energy (∆G°) equation ...
16