Uncoupling protein 2 (UCP2)
Original Article Effect of epigallocatechin gallate on uncoupling protein 2 in acute liver injury
... are: UCP2 (forward) 5’-GCAGTTCTACACCAAGGGCT-3’, UC- P2 (reverse) 5’-GGAAGCGGACCTTTACCACA-3’; IL6 (forward) 5’-CACTTCACAAGTCGGAGGCT-3’, IL6 (reverse) 5’-TCTGACAGTGCATCATCGCT-3’; IL18 (forward) ...
6
Superoxide mediated activation of uncoupling protein 2 causes pancreatic β cell dysfunction
... unknown. Uncoupling protein 2 (UCP2), by virtue of its mitochondrial proton leak activity and con- sequent negative effect on ATP production, impairs glucose-stimulated insulin ...activates ...
13
The Deletion Polymorphism in Exon 8 of Uncoupling Protein 2 is Associated with Severe Obesity in a Saudi Arabian Case-Control Study
... carrier Uncoupling protein 2 (UCP2) is a member of the mitochondrial anion carrier protein subfamily, (which also includes UCP1, 3, 4, and ...5). Uncoupling proteins function to ...
5
Uncoupling protein 2 regulates myocardial apoptosis via the diabetogenic action of streptozotocin
... of uncoupling protein 2 (UCP2) in the myocardial apoptosis of diabetic melli- tus （ DM ） ...on UCP2 knock-out mice (UCP2KO) and wild-type mice (WT), which were reared for 7 and 28 days ...
5
Increased uncoupling protein 2 and 3 mRNA expression during fasting in obese and lean humans
... Uncoupling protein-2 and -3 (UCP2 and UCP3) are mito- chondrial proteins that show high sequence homology with the brown adipocyte–specific ...by uncoupling respiration from ATP ...
7
Uncoupling protein 2 polymorphisms as risk factors for NTDs
... women. Uncoupling Protein 2 (UCP2) is an attractive candidate to screen for NTD risk because of its possible role in obesity as well as energy metabolism, type-2 diabetes, and the ...
10
Circulating levels of mitochondrial uncoupling protein 2, but not prohibitin, are lower in humans with type 2 diabetes and correlate with brachial artery flow-mediated dilation
... The plasma glucose was run by Wisconsin Diagnostics Laboratory using a hexokinase assay. Sandwich ELISA (Enzyme linked immunosorbent assay) kits were used to determine the quantitative levels of PHB (LS-F6361, LifeSpan ...
11
Inhibition of uncoupling protein 2 with genipin exacerbates palmitate-induced hepatic steatosis
... The UCP2 protein expression has been linked to the occurrence of nonalcoholic fatty liver disease ...of UCP2 in normal hepatocyte is very low but can be significantly upregulated under the obese ...
6
Both ischemic preconditioning and ghrelin administration protect hippocampus from ischemia/reperfusion and upregulate uncoupling protein-2
... of UCP2 and UCP3, in white adipose tissue [38] and liver [39], and GH increases UCP2 mRNA in adipose tissue and skeletal muscle ...of UCP2 mRNA in the hippocampus in a global I/R ...
14
Acetoacetate reduces growth and ATP concentration in cancer cell lines which over-express uncoupling protein 2
... Cells grown in 12 well plates for 96 h were dissociated with 0.5 ml Trypsin:EDTA solution, re-suspended in equal volume of DMEM containing 10% FBS, washed twice in one ml PBS, followed by centrifugation at 2800 rpm for 3 ...
11
Uncoupling protein 2 G(-866)A polymorphism: a new gene polymorphism associated with C-reactive protein in type 2 diabetic patients C-reactive protein in type 2 diabetic patients
... X 2 goodness-of-fit test was used to assess deviation from Hardy-Weinberg equilibrium of the genotypic frequency by calculating expected fre- quencies of ...X 2 square ...of UCP2, gender, age, ...
5
Uncoupling protein 2 gene polymorphisms are associated with obesity
... observed UCP2 gene single nucleotide polymorphisms (SNPs) G(−866)A in the promoter region (rs659366) and Ala55Val (a C to T substitution) in exon 4 (rs660339) have been associated with obesity and T2DM to a ...
10
Anti-obesity efficacy of nanoemulsion oleoresin capsicum in obese rats fed a high-fat diet
... binding protein (SREBP)-1c, and fatty acid-binding protein 2 (aP2), were analyzed in white adipose tissue ...and uncoupling protein-2 (UCP2), involved in β -oxidation and ...
10
Antagonistic effect of TNF-alpha and insulin on uncoupling protein 2 (UCP-2) expression and vascular damage
... have uncoupling activity and decreased ROS production in macrophages and skeletal muscle, respectively ...type 2 diabetes mellitus (T2DM). In this regard, several UCP-2 gene polymorphisms were linked ...
10
The Role of Mitochondrial Uncoupling Protein 3 in T Cell Function
... Nancy-520 was warmed to RT. For genotyping experiments and reverse transcription (RT)-PCR experiments, 1.5 or 2.5 % (w/v) agarose gels were prepared by boiling 1.5 or 2.5 grams (g), respectively, of agarose in 100 mL of ...
379
Effect of co-exposure to nickel and particulate matter on insulin resistance and mitochondrial dysfunction in a mouse model
... a Collison nebulizer [BGI, Waltham, MA]) at a nominal concentration of 440 ng/m 3 , which was approximately 9- fold greater than that seen in New York City in the win- ter [16]. The exposures lasted for 6 hours/day, one ...
12
A quest for the origin of mammal uncoupling proteins
... mammals, uncoupling protein 1 (UCP1) is responsible for non- shivering thermogenesis in brown adipose tissue ...The protein is inserted with six ???-helical transmembrane domains into the inner mito- ...
10
Insights into brown adipose tissue evolution and function from non model organisms
... and protein was investigated, demonstrating that no protein is translated in pigs (Hou et ...alternative uncoupling protein (Lin et ...an uncoupling artefact (Cadenas et ...
9
Ontogeny and thermogenic role for sternal fat in female sheep
... PPARγ NM_181024.2 GACCCGATGGTTGCAGATTA TGAGGGAGTTGGAAGGCTCT 145 PRDM16 XM_003583245.1 TGGCAGCTGGCTCAAGTACA CGGAACGTGGGCTCCTCATC 198 PRLR NM_174155.3 CTCCACCCACCATGACTGAT CAGCGAATCTGCACAAGGTA 169 RIP140 XM_002684642.2 ...
49
Reptilian uncoupling protein: functionality and expression in sub zero temperatures
... Low temperatures followed by re-warming are probably one of the most commonly found ROS-generating stress in nature. Ectotherms survive these thanks to the contribution of cellular adaptive mechanisms that include, ...
7