[PDF] Top 20 Ceruloplasmin gene expression in the murine central nervous system
Has 10000 "Ceruloplasmin gene expression in the murine central nervous system" found on our website. Below are the top 20 most common "Ceruloplasmin gene expression in the murine central nervous system".
Ceruloplasmin gene expression in the murine central nervous system
... human ceruloplasmin oxidase activity in the plasma, making it reasonable to speculate that such changes in the brain, in association with other environ- mental or genetic factors, may contribute to neurodegenera- ... See full document
10
Invasion of the Central Nervous System by Cryptococcus neoformans Requires a Secreted Fungal Metalloprotease
... the central nervous system (CNS), predominantly in pa- tients with a compromised immune ...the gene encoding Mpr1 (mpr1 ⌬ ) failed to breach the endothelium in an in vitro model of the human ... See full document
13
Expression from a betageo gene trap in the Slain1 gene locus is predominantly associated with the developing nervous system
... geo expression during organogenesis in Slain1- βββββ geo ...developing nervous system, as well as the lung, gut and metanephros (see insert) Abbreviations: bc, buccal cavity; cc, central ... See full document
7
STAT1 Signaling in Astrocytes Is Essential for Control of Infection in the Central Nervous System
... Transcriptional profiling of astrocyte responses to IFN-␥ and type I interferons. Stimulation with IFN- ␥ is known to in- duce a broad transcriptional program in different cell types (49, 50). However, the IFN- ␥ ... See full document
15
Resolution of central nervous system astrocytic and endothelial sources of CCL2 gene expression during evolving neuroinflammation
... CCL2 expression in some endothelial cell types [13,14], and might further contribute to ambiguity of BMEC-derived CCL2 during neuroinflammatory ...CCL2 gene expression in neuroinflammation thus re- ... See full document
6
Expression of the potent vasoconstrictor endothelin in the human central nervous system
... evidence of endothelin gene transcription in a variety of functional regions of the brain. In situ hybridization confirmed the widespread pattern of endothelin transcription and indicated that the highest density ... See full document
8
Development of axon pathways in the zebrafish central nervous system
... homeobox gene), indicating that they may share a common early regulatory program (Korzh et ...shh expression in either the floor plate or the notochord is required for specification of secondary motor neu- ... See full document
11
Central nervous system gene expression changes in a transgenic mouse model for bovine spongiform encephalopathy
... Some of the genes involved in immune and inflammatory pathways identified in the present study are complement activation factors (C1qa, C1qb, C1qg, C3, C4, C3ar1), che- motactic molecules (CXCL13, Lgals3, C3ar1), ... See full document
14
Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system
... Emc, CAACTTTAACCATTTTGCTGATTCT; en, TGGGCAACCTTG- TATTTCGCTTCAT; ephrinA-b, ACAAAGGCATGGTGATATACG- CATT; Fgf8/17/18, TACTCGCAATGCATTAAATCCGAAT; FoxB, AGTCTCGTCCTGGTCGTGGCATTTT; Gli, CGCGTTCTCCATG- TAAAATCTACGA; ... See full document
9
Expression of microRNAs in cerebrospinal fluid of dogs with central nervous system disease
... samples were included in subsequent analyses. Analy- sis of variance (ANOVA) was used to determine if the expression of each miRNA differed among dogs with and without CNS structural disease and then among the ... See full document
6
Investigation of ADAMTS 9 expression in models of central nervous system inflammation
... Adamts9 expression was observed in the SHSY-5Y neuroblastoma cell line with any of the pro- or anti inflammatory cytokines or TGF-pi and ...mRNA expression (Keating et al, ...control gene that at ... See full document
251
Altered Central Nervous System Gene Expression Caused by Congenitally Acquired Persistent Infection with Lymphocytic Choriomeningitis Virus
... the central nervous system (CNS) in the absence of inflammation and tissue ...host’s gene expression ...host gene expression in the ...CNS gene expression ... See full document
11
Toxoplasma gondii Infections Alter GABAergic Synapses and Signaling in the Central Nervous System
... GAD67 interacts with an unknown synaptic-vesicle-associated factor (28). Currently, we do not know which of these two mech- anisms is affected by Toxoplasma. Type II ME49 Toxoplasma in- fection of cultured hippocampal ... See full document
9
Expression of an Otx gene in the adult rudiment and the developing central nervous system in the vestibula larva of the sea urchin Holopneustes purpurescens
... Otx gene in the vestibula larva of ...Otx expression in other species. The early expression of the Otx gene throughout the ectoderm of the newly hatched larva is similar to the ... See full document
6
Characterization of Hypoxia induced gene 1: expression during rat Central Nervous System maturation and evidence of antisense RNA expression
... for murine and human ...with murine and human sequences, respectively), particularly in the central region of the protein, suggesting the presence of functional ... See full document
6
Platelet derived growth factor B gene expression in the Xenopus laevis developing central nervous system
... embryonic gene expression pattern of pdgf-b, so far unknown in early vertebrate ...model system we performed qRT-PCR and whole mount in situ ...developing central nervous system, ... See full document
6
Central nervous system Toll like receptor expression in response to Theiler's murine encephalomyelitis virus induced demyelination disease in resistant and susceptible mouse strains
... VP1 expression, a significant difference was found between SJL/J and C57BL/6 mice ...VP1 expression differences between TMEV and vehicle groups of SJL/J (Bonferroni t-test, p < ...VP1 expression ... See full document
9
Expression of the vascular permeability factor/vascular endothelial growth factor gene in central nervous system neoplasms
... Expression of the vascular permeability factor/vascular endothelial growth factor (VEGPF) gene was investigated in human central nervous system (CNS) neoplasms and normal brain. ... See full document
8
Murine retrovirus-induced spongiform encephalopathy: disease expression is dependent on postnatal development of the central nervous system.
... To accomplish this, we have inoculated the highly neurovirulent chimeric virus FrCasE or the marginally neurovirulent parent virus 15-1 during the midgestational development of the mouse[r] ... See full document
10
Original Article Clinicopathological study of gene rearrangement and microRNA expression of primary central nervous system diffuse large B-cell lymphomas
... PCNSL morbidity has increased signifi- cantly in recent years. Its incidence among other primary brain tumors is reported to have increased from 0.8- 1.5% to 6.6% [3]. More than 95% of CSNLs can be DLBCL. Early diagnosis ... See full document
8
Related subjects