[PDF] Top 20 Comparison of commercial kits for detection of cryptococcal antigen
Has 10000 "Comparison of commercial kits for detection of cryptococcal antigen" found on our website. Below are the top 20 most common "Comparison of commercial kits for detection of cryptococcal antigen".
Comparison of commercial kits for detection of cryptococcal antigen
... Therefore, we compared the sensitivities and specificities of five commercially available kits for detecting cryptococcal antigen four latex agglutination test kits-Calas [Meridian Diagn[r] ... See full document
5
Comparison of the PREMIER cryptococcal antigen enzyme immunoassay and the latex agglutination assay for detection of cryptococcal antigens
... A new enzyme immunoassay EIA, PREMIER Cryptococcal Antigen, was compared with latex agglutination LA for the detection and quantitation of circulating capsular polysaccharide antigen fro[r] ... See full document
5
Comparison of the Roche AMPLICOR MYCOBACTERIUM assay and Digene SHARP Signal System with in house PCR and culture for detection of Mycobacterium tuberculosis in respiratory specimens
... Two commercial primer kits and detection systems, the Roche AMPLICOR MYCOBACTERIUM test and the Digene primer-probe kit with the SHARP Signal System, were compared to in-house PCR as well as standard ... See full document
5
Evaluation and Comparison of Two Commercial Enzyme Linked Immunosorbent Assay Kits for Detection of Antigenically Diverse Human Noroviruses in Stool Samples
... two commercial kits evaluated in this study has a problem with sensitivity or specificity, the early prototype ELISAs for detection of antigens of specific HuNV subgroups ...the kits are re- ... See full document
9
Comparison of Seven Commercial Antigen and Antibody Enzyme-Linked Immunosorbent Assays for Detection of Acute Dengue Infection
... and commercial enzyme-linked immunosorbent assays (ELISAs) are often relied upon for a final ...the detection of nonstruc- tural 1 (NS1) antigen and IgM and IgG antibodies, and the major ... See full document
7
Evaluation of Two Commonly Used Commercial Immunochromatographic and ELISA Screening Kits for the Detection of Anti-HCV Antibodies among Patients in North Central Nigeria
... The range of sensitivity in this study was lower than those stated in the manufacturer’s manuals. The sensitivity differences noted could accrue to different immuno chromatographic flow characteristics, antigen ... See full document
9
Comparison of Two Commercial Screening Kits for Detection of Anti-HCV Antibody among Adult Patients in Osogbo, Nigeria
... In this study, we evaluated the performance of the Global rapid test strip for the detection of anti-HCV antibody (IgG) using the 3 rd generation ELISA kit (DIA.PRO, Italy) as gold standard. The sensitivity of the ... See full document
6
Diagnostic performance and problem analysis of commercial tuberculosis antibody detection kits in China
... the antigen used also affects the quality of the kit ...natural antigen is higher than that using ...kD antigen. Its sensitivity using this single antigen was simi- lar to those using several ... See full document
9
Comparison of commercial DNA preparation kits for the detection of Brucellae in tissue using quantitative real time PCR
... base of the National Centre for Biotechnology Informa- tion. The oligonucleotides used for the Brucella specific target were IS711_S TTGTCGATGCTATCGGCCTAC, IS711_R GGCAATGAAGGCCCTTAAGT, IS711_FL ... See full document
5
Serological Diagnostics of Lyme Borreliosis: Comparison of Universal and Borrelia Species Specific Tests Based on Whole Cell and Recombinant Antigens
... improved antigen composition and the introduction of more sophisticated systems, the accuracy of serological testing has significantly increased over the last 2 decades, and accuracy improvement by combining more ... See full document
9
Comparison of Two Commercial Microimmunofluorescence Kits and an Enzyme Immunoassay Kit for Detection of Serum Immunoglobulin G Antibodies to Chlamydia pneumoniae
... There is sufficient genus-reactive antigen exposed on the surfaces of the EBs to allow some cross-reactions in the MIF test. In addition to the major genus-specific LPS, the Chla- mydia major outer membrane ... See full document
5
Commercial test kits for detection of Lyme borreliosis: a meta-analysis of test accuracy
... lowering detection thresholds; how- ever, in doing so, the probability of false positives ...WB antigen concentration, band selection, etc. Where the kits provided by the manufacturer had separate ... See full document
14
Key words
... available kits for L. pneumophila antigen detection in urine samples [1, ...the antigen in samples was in low concentration (simulated samples) it could be detected only after 45 ...urinary ... See full document
5
Risk of transfusion transmitted malaria: evaluation of commercial ELISA kits for the detection of anti Plasmodium antibodies in candidate blood donors
... methods. Detection of Plas- modium parasites on Giemsa-stained thick and thin blood smears by microscopic examination has been the gold standard for malaria diagnosis for over a cen- tury, allowing both the ... See full document
9
Comparison of nine antigen detection kits for diagnosis of urogenital infections due to Chlamydia psittaci in koalas
... In the study described here, three DFA stains Vet-IF, IMAGEN, Chlamydia Direct-IF, six ELISAs Clearview, Surecell, Pathfinder, Chlamydiazyme, IDEIA, Chlamydia-EIA, and cell culture were [r] ... See full document
6
Comparison of commercial enzyme immunoassay kits with plaque reduction neutralization test for detection of measles virus antibody
... test kits offer a standardized pro- cedure, a common source of supply, and ease of ...in comparison with a highly sensitive and specific test such as the PRN test, particularly if these products are to be ... See full document
5
Characterization of Glycoproteins of Native 19kDa C-Terminal Merozoite Sur-face Protein-1 from Native Antigen of Plasmodium falciparum
... Numerous researchers on glycobiology of P. falciparum have reported contradictory find- ings of the occurrence of glycoproteins on the Plasmodium surface proteins, especially MSP1 and merozoite surface protein 2 (MSP2). ... See full document
10
Clinical pattern and antifungal susceptibility of cryptococcus neoformans from cryptococcal meningitis patients in northern india
... of Cryptococcal meningitis were tested for positive India ink, Cryptococcal Antigen Latex Agglutination test, followed by fungal culture and Urease Biochemical ...of Cryptococcal meningitis ... See full document
8
Comparison and suitability of gel matrix for entrapping higher content of enzymes for commercial applications
... Agar, agarose, bisacrylamide were purchased from Himedia laboratories Ltd. Mumbai, India. Sodium alginate and acrylamide were from Loba Chemie, Mumbai, India. CaCl 2 (fused) was purchased from Ranbaxy Laboratories Ltd. ... See full document
6
Diagnosis of Cryptococcosis and Prevention of Cryptococcal Meningitis Using a Novel Point-of-Care Lateral Flow Assay
... for cryptococcal antigenemia was recently intro- duced into selected laboratories in South Africa as part of the National Strategic Plan on HIV, STIs, and ... See full document
5
Related subjects