[PDF] Top 20 Comparison of commercial kits for detection of cryptococcal antigen

... Therefore, we compared the sensitivities and specificities of five commercially available kits for detecting cryptococcal antigen four latex agglutination test kits-Calas [Meridian Diagn[r] ... See full document

... A new enzyme immunoassay EIA, PREMIER Cryptococcal Antigen, was compared with latex agglutination LA for the detection and quantitation of circulating capsular polysaccharide antigen fro[r] ... See full document

... Two commercial primer kits and detection systems, the Roche AMPLICOR MYCOBACTERIUM test and the Digene primer-probe kit with the SHARP Signal System, were compared to in-house PCR as well as standard ... See full document

... two commercial kits evaluated in this study has a problem with sensitivity or specificity, the early prototype ELISAs for detection of antigens of specific HuNV subgroups ...the kits are re- ... See full document

... and commercial enzyme-linked immunosorbent assays (ELISAs) are often relied upon for a final ...the detection of nonstruc- tural 1 (NS1) antigen and IgM and IgG antibodies, and the major ... See full document

... The range of sensitivity in this study was lower than those stated in the manufacturer’s manuals. The sensitivity differences noted could accrue to different immuno chromatographic flow characteristics, antigen ... See full document

... In this study, we evaluated the performance of the Global rapid test strip for the detection of anti-HCV antibody (IgG) using the 3 rd generation ELISA kit (DIA.PRO, Italy) as gold standard. The sensitivity of the ... See full document

... the antigen used also affects the quality of the kit ...natural antigen is higher than that using ...kD antigen. Its sensitivity using this single antigen was simi- lar to those using several ... See full document

... base of the National Centre for Biotechnology Informa- tion. The oligonucleotides used for the Brucella specific target were IS711_S TTGTCGATGCTATCGGCCTAC, IS711_R GGCAATGAAGGCCCTTAAGT, IS711_FL ... See full document

... improved antigen composition and the introduction of more sophisticated systems, the accuracy of serological testing has significantly increased over the last 2 decades, and accuracy improvement by combining more ... See full document

... There is sufficient genus-reactive antigen exposed on the surfaces of the EBs to allow some cross-reactions in the MIF test. In addition to the major genus-specific LPS, the Chla- mydia major outer membrane ... See full document

... lowering detection thresholds; how- ever, in doing so, the probability of false positives ...WB antigen concentration, band selection, etc. Where the kits provided by the manufacturer had separate ... See full document

... available kits for L. pneumophila antigen detection in urine samples [1, ...the antigen in samples was in low concentration (simulated samples) it could be detected only after 45 ...urinary ... See full document

... methods. Detection of Plas- modium parasites on Giemsa-stained thick and thin blood smears by microscopic examination has been the gold standard for malaria diagnosis for over a cen- tury, allowing both the ... See full document

... In the study described here, three DFA stains Vet-IF, IMAGEN, Chlamydia Direct-IF, six ELISAs Clearview, Surecell, Pathfinder, Chlamydiazyme, IDEIA, Chlamydia-EIA, and cell culture were [r] ... See full document

... test kits offer a standardized pro- cedure, a common source of supply, and ease of ...in comparison with a highly sensitive and specific test such as the PRN test, particularly if these products are to be ... See full document

... Numerous researchers on glycobiology of P. falciparum have reported contradictory find- ings of the occurrence of glycoproteins on the Plasmodium surface proteins, especially MSP1 and merozoite surface protein 2 (MSP2). ... See full document

... of Cryptococcal meningitis were tested for positive India ink, Cryptococcal Antigen Latex Agglutination test, followed by fungal culture and Urease Biochemical ...of Cryptococcal meningitis ... See full document

... Agar, agarose, bisacrylamide were purchased from Himedia laboratories Ltd. Mumbai, India. Sodium alginate and acrylamide were from Loba Chemie, Mumbai, India. CaCl 2 (fused) was purchased from Ranbaxy Laboratories Ltd. ... See full document

... for cryptococcal antigenemia was recently intro- duced into selected laboratories in South Africa as part of the National Strategic Plan on HIV, STIs, and ... See full document