[PDF] Top 20 Detection of Simian Immunodeficiency Virus Gag-Specific CD8+ T Lymphocytes in Semen of Chronically Infected Rhesus Monkeys by Cell Staining with a Tetrameric Major Histocompatibility Complex Class I-Peptide Complex
Has 10000 "Detection of Simian Immunodeficiency Virus Gag-Specific CD8+ T Lymphocytes in Semen of Chronically Infected Rhesus Monkeys by Cell Staining with a Tetrameric Major Histocompatibility Complex Class I-Peptide Complex" found on our website. Below are the top 20 most common "Detection of Simian Immunodeficiency Virus Gag-Specific CD8+ T Lymphocytes in Semen of Chronically Infected Rhesus Monkeys by Cell Staining with a Tetrameric Major Histocompatibility Complex Class I-Peptide Complex".
Detection of Simian Immunodeficiency Virus Gag-Specific CD8+ T Lymphocytes in Semen of Chronically Infected Rhesus Monkeys by Cell Staining with a Tetrameric Major Histocompatibility Complex Class I-Peptide Complex
... AIDS virus-specific CTL responses in these models has been facili- tated by the definition of CTL epitopes and their restricting major histocompatibility complex (MHC) class ... See full document
5
Comparative Analysis of Cytotoxic T Lymphocytes in Lymph Nodes and Peripheral Blood of Simian Immunodeficiency Virus-Infected Rhesus Monkeys
... human immunodeficiency virus type 1 (HIV-1)-specific cytotoxic T lymphocytes (CTL) have been confined to the evaluation of these effector cells in the peripheral ...effector cell ... See full document
7
Definition of human immunodeficiency virus type 1 gp120 and gp41 cytotoxic T-lymphocyte epitopes and their restricting major histocompatibility complex class I alleles in simian-human immunodeficiency virus-infected rhesus monkeys.
... chimeric simian-human immunodeficiency virus (SHIV)-infected macaques as a model for assessing novel human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein (Env)-based ... See full document
6
Mauritian Cynomolgus Macaques Share Two Exceptionally Common Major Histocompatibility Complex Class I Alleles That Restrict Simian Immunodeficiency Virus-Specific CD8+ T Cells
... SIV-specific CD8 T-cell re- sponses in ...-A*29 CD8 ⫹ T-cell epitopes by scanning the SIV proteome for variation in chronically infected MCM (data not shown) ... See full document
9
Association of Major Histocompatibility Complex Class I Haplotypes with Disease Progression after Simian Immunodeficiency Virus Challenge in Burmese Rhesus Macaques
... antigen-specific CD8 ⴙ T-cell responses. SIV antigen- specific CD8 ⫹ T-cell responses were measured by the flow-cytometric analysis of gamma interferon (IFN- ␥ ) ... See full document
10
High Viremia Is Associated with High Levels of In Vivo Major Histocompatibility Complex Class I Downregulation in Rhesus Macaques Infected with Simian Immunodeficiency Virus SIVmac239
... cytometric detection of SIV-infected lymph node cells ex vivo and evaluation of cell surface marker ...and CD8 ⫹ T cells were gated on lymphocytes by using forward and side ... See full document
5
Pol-Specific CD8+ T Cells Recognize Simian Immunodeficiency Virus-Infected Cells Prior to Nef-Mediated Major Histocompatibility Complex Class I Downregulation
... Indian rhesus macaques using Ficoll-Paque PLUS (Amersham Biosciences, Uppsala, Sweden) density ...⫹ T cells were isolated using CD4 mi- crobeads and LS columns purchased from Miltenyi Biotec and used ... See full document
10
A Commonly Recognized Simian Immunodeficiency Virus Nef Epitope Presented to Cytotoxic T Lymphocytes of Indian-Origin Rhesus Monkeys by the Prevalent Major Histocompatibility Complex Class I Allele Mamu-A*02
... in infected monkeys does not ap- pear to be as high as those that are specific for p11C when assessed by tetramer staining (data not ...the peptide Elispot experiment shown in Fig. 8 ... See full document
8
Diverse Peptide Presentation of Rhesus Macaque Major Histocompatibility Complex Class I Mamu-A*02 Revealed by Two Peptide Complex Structures and Insights into Immune Escape of Simian Immunodeficiency Virus
... in rhesus macaques (10, 16, 78). The MHC class I (MHC I) molecules of rhesus macaques have been thoroughly se- quenced genetically, indicating their close relationship with ... See full document
12
Use of Major Histocompatibility Complex Class I/Peptide/β2M Tetramers To Quantitate CD8+ Cytotoxic T Lymphocytes Specific for Dominant and Nondominant Viral Epitopes in Simian-Human Immunodeficiency Virus-Infected Rhesus Monkeys
... viral peptide to elicit CTL is likely to be influenced by a number of factors: (i) the peptide-MHC class I affinity and rate of peptide disso- ciation, (ii) the amount of viral ... See full document
7
Human Immunodeficiency Virus Type 1 Envelope Epitope-Specific CD4+ T Lymphocytes in Simian/Human Immunodeficiency Virus-Infected and Vaccinated Rhesus Monkeys Detected Using a Peptide-Major Histocompatibility Complex Class II Tetramer
... the tetrameric Mamu-DR*W201–p46 complex, Mamu-DR*W201 covalently bound to HIV Env p46 peptide was expressed in a Drosophila melanogaster cell protein expres- sion ...bound peptide ... See full document
6
Local replication of simian immunodeficiency virus in the breast milk compartment of chronically infected, lactating rhesus monkeys
... (5’ - CCCTACCAAGTCATCATCTTC - 3’) (GenBank D01065). Total SIV copy numbers measured by quanti- tative RT-PCR [15] ranged from 6.9 × 10 3 to 1.5 × 10 6 copies/ml (3.3 × 10 3 to 2.2 × 10 5 total copies measured) in breast ... See full document
5
Elicitation of Simian Immunodeficiency Virus-Specific Cytotoxic T Lymphocytes in Mucosal Compartments of Rhesus Monkeys by Systemic Vaccination
... cosal T lymphocytes in nonhuman primates and humans can be attributed at least in part to the difficulties associated with accessing these cell populations for ...intestinal T-cell ... See full document
7
Analysis of Pigtail Macaque Major Histocompatibility Complex Class I Molecules Presenting Immunodominant Simian Immunodeficiency Virus Epitopes
... detect rhesus macaque (Weinfurter et ...MHC class I cDNA spanning exons two and three (encoding the peptide-binding regions) were amplified from pigtail macaque cDNA, using the 5 ⬘ RSCA and 3 ... See full document
12
ALVAC-SIV-gag-pol-env-Based Vaccination and Macaque Major Histocompatibility Complex Class I (A*01) Delay Simian Immunodeficiency Virus SIVmac-Induced Immunodeficiency
... in virus load during primary infection (P ⴝ ...the virus load was not significantly lower in Mamu- A*01-positive macaques following intravenous challenge with either SIV mac251 (561) or SIV SME660 ... See full document
11
The Role of CD8+ T Cells and Major Histocompatibility Complex Class I Expression in the Central Nervous System of Mice Infected with Neurovirulent Sindbis Virus
... and CD8-KO mice were expected to show comparable defects in MHC class I-restricted T-cell- dependent immune ...not CD8␣, decreased mortality from NSV ...choriomeningitis ... See full document
9
Selective Downregulation of Rhesus Macaque and Sooty Mangabey Major Histocompatibility Complex Class I Molecules by Nef Alleles of Simian Immunodeficiency Virus and Human Immunodeficiency Virus Type 2
... of major histocompatibility complex (MHC) class I molecules by Nef is thought to be an important immune evasion mechanism of human immunodeficiency virus type 1 ...MHC ... See full document
8
Gag p27-Specific B- and T-Cell Responses in Simian Immunodeficiency Virus SIVagm-Infected African Green Monkeys
... Simian immunodeficiency virus (SIV) infection in African green monkeys (AGM) is nonpathogenic, even though it is characterized by plasma viral load (PVL) levels similar to those found during ... See full document
8
Zika Virus Escapes NK Cell Detection by Upregulating Major Histocompatibility Complex Class I Molecules
... MHC class I upregulation in Zika virus-infected cells is mediated via the RIGI-IRF3 ...influenza virus infection (32, 51). Because we observed CEACAM1 FIG 2 MHC class I ... See full document
11
Impairment of Gag-Specific CD8+ T-Cell Function in Mucosal and Systemic Compartments of Simian Immunodeficiency Virus mac251- and Simian-Human Immunodeficiency Virus KU2-Infected Macaques
... of T cells secreting IFN- ␥ can be ...to Gag 181 because it was the predominant response in all ...equivalent Gag 181-specific ELI- SPOT responses in the blood, spleen, and mesenteric lymph ... See full document
13
Related subjects