[PDF] Top 20 Efficient Nuclear Export of Herpes Simplex Virus 1 Transcripts Requires both RNA Binding by ICP27 and ICP27 Interaction with TAP/NXF1
Has 10000 "Efficient Nuclear Export of Herpes Simplex Virus 1 Transcripts Requires both RNA Binding by ICP27 and ICP27 Interaction with TAP/NXF1" found on our website. Below are the top 20 most common "Efficient Nuclear Export of Herpes Simplex Virus 1 Transcripts Requires both RNA Binding by ICP27 and ICP27 Interaction with TAP/NXF1".
Efficient Nuclear Export of Herpes Simplex Virus 1 Transcripts Requires both RNA Binding by ICP27 and ICP27 Interaction with TAP/NXF1
... The export of mRNA from the nucleus to the cytoplasm for translation requires the deposition of multiple proteins on the mRNA that can direct the ribonucleoprotein (RNP) complex to the ... See full document
9
CK2 Protein Kinase Is Stimulated and Redistributed by Functional Herpes Simplex Virus ICP27 Protein
... a herpes simplex virus type 1 (HSV-1) phospho- protein of 63 kDa which is essential for viral replication and expression of certain early and late viral genes (reviewed in reference 35) ... See full document
11
The Interaction of the Cellular Export Adaptor Protein Aly/REF with ICP27 Contributes to the Efficiency of Herpes Simplex Virus 1 mRNA Export
... Viral transcripts are exported less efficiently during WRL-A ...the export of HSV-1 transcripts during WRL-A infection compared to KOS infection, nuclear and cyto- plasmic fractions of ... See full document
8
ICP27 Phosphorylation Site Mutants Are Defective in Herpes Simplex Virus 1 Replication and Gene Expression
... Herpes simplex virus 1 (HSV-1) ICP27 is a multifunctional regulatory protein that interacts with a number of proteins and that binds RNA ...of ICP27 are regulated ... See full document
12
Three Arginine Residues within the RGG Box Are Crucial for ICP27 Binding to Herpes Simplex Virus 1 GC-Rich Sequences and for Efficient Viral RNA Export
... of ICP27 are required for binding HSV-1 glycoprotein C ...for ICP27 binding in a yeast three-hybrid screen (5), bound the N-terminal portion of ICP27 from amino acids 1 to ... See full document
10
ICP27 Interacts with the RNA Export Factor Aly/REF To Direct Herpes Simplex Virus Type 1 Intronless mRNAs to the TAP Export Pathway
... which export pathway, CRM1 or TAP, is uti- lized predominantly by ICP27 in HSV-1-infected mammalian cells, we investigated the interaction of ICP27 with the export factors ... See full document
13
ICP27 Phosphorylation Site Mutants Display Altered Functional Interactions with Cellular Export Factors Aly/REF and TAP/NXF1 but Are Able To Bind Herpes Simplex Virus 1 RNA
... Herpes simplex virus 1 (HSV-1) protein ICP27 is a multifunctional regulatory protein that is phosphory- ...of ICP27 that are phosphorylated are serine residues 16 and 18, ... See full document
11
Head to Tail Intramolecular Interaction of Herpes Simplex Virus Type 1 Regulatory Protein ICP27 Is Important for Its Interaction with Cellular mRNA Export Receptor TAP/NXF1
... of ICP27, encompassing the leucine-rich region, the nuclear localization signal, the RGG box RNA binding domain and binding sites for TAP/NXF1 (3), Hsc70 (5), RNA ... See full document
9
ICP27 Recruits Aly/REF but Not TAP/NXF1 to Herpes Simplex Virus Type 1 Transcription Sites although TAP/NXF1 Is Required for ICP27 Export
... the export of mRNA from the nucleus to the cytoplasm (5, 20, ...that ICP27 is exported to the cytoplasm via ...dominant-negative TAP/ NXF1 mutant that was unable to interact with the NPC con- ... See full document
13
The Cellular RNA Export Receptor TAP/NXF1 Is Required for ICP27-Mediated Export of Herpes Simplex Virus 1 RNA, but the TREX Complex Adaptor Protein Aly/REF Appears To Be Dispensable
... cellular export proteins, Aly/REF and TAP/ ...that ICP27 traffics to the cytoplasm between 5 and 6 h after infection, as we found previously in fixed stained cells (6, 7); that ICP27 interacts ... See full document
12
Herpes simplex virus type 1 protein IE63 affects the nuclear export of virus intron-containing transcripts.
... affecting virus transcription, RNA processing, and DNA rep- ...influenza virus infection, the snRNP and associated factors become more punctate in dis- tribution, and Fortes et ...influenza ... See full document
11
Control of VP16 Translation by the Herpes Simplex Virus Type 1 Immediate-Early Protein ICP27
... of ICP27 on the translation of VP16 mRNA, we examined the distribution of the VP16 transcript on polyri- bosomes in HSV-infected ...gradients. RNA was isolated from 20 equal fractions collected from the top ... See full document
12
Arginine Methylation of the ICP27 RGG Box Regulates the Functional Interactions of ICP27 with SRPK1 and Aly/REF during Herpes Simplex Virus 1 Infection
... functional interaction between ICP27 and SRPK1 by using immunofluorescence ...strong nuclear fluores- cence of GFP-SRPK1 was visualized in KOS-infected cells at 8 h ...the ICP27 RGG box ... See full document
6
Herpes Simplex Virus ICP27 Increases Translation of a Subset of Viral Late mRNAs
... (2). RNA samples were resolved in a 1% denaturing agarose (SeaKem) gel containing formaldehyde in 3[N-morpholino]propanesulfonic ...GAPDH RNA levels to correct for recovery, because GAPDH levels at 6 ... See full document
8
Herpes Simplex Virus Proteins ICP27 and UL47 Associate with Polyadenylate-Binding Protein and Control Its Subcellular Distribution
... (Invitrogen): 1, 5⬘-CTAGCACCATGGATTA CAAGGATGACGACGATAAGA; and 2, 5⬘-AGCTCCTTATCGTCGTCATC ...The ICP27 open reading frame (ORF) was PCR- amplified from pM27, kindly provided by ... See full document
10
Phenotypic Suppression of a Herpes Simplex Virus 1 ICP27 Mutation by Enhanced Transcription of the Mutant Gene
... investigated ICP27 mRNA ...2-fold-more ICP27 mRNA than dLeu did, although both viruses expressed more mRNA than the WT did ...the virus stocks shown were plated on Vero cells, and the cultures ... See full document
6
Structure of the C-Terminal Domain of the Multifunctional ICP27 Protein from Herpes Simplex Virus 1
... of ICP27-CTD appear to be largely aliphatic, interacting with their hydrophobic face onto the core ...neighboring ICP27-CTD ...in ICP27 function ...express ICP27 and its homologs with ... See full document
12
Herpes Simplex Virus Type 1 Immediate-Early Protein ICP27 Is Required for Efficient Incorporation of ICP0 and ICP4 into Virions
... In both cases, analysis of VP5 showed that the WT and d3-4 virion samples were approximately equally loaded on the ...as both proteins were readily detected in the infected-cell lysates (lanes 2 and ...5A, ... See full document
10
Export of Adenoviral Late mRNA from the Nucleus Requires the Nxf1/Tap Export Receptor
... the Nxf1 export receptor is responsible for the export of viral late mRNAs raises the obvious question of which components of this export pathway are exploited or targeted by viral gene ... See full document
10
Role of Herpes Simplex Virus ICP27 in the Degradation of mRNA by Virion Host Shutoff RNase
... either ICP27 or ...with ICP27 in the absence of other viral ...of ICP27 cleavage products in the total cell lysates ...observed ICP27 cleavage ... See full document
9
Related subjects