[PDF] Top 20 Genomics of lithium action and response
Has 10000 "Genomics of lithium action and response" found on our website. Below are the top 20 most common "Genomics of lithium action and response".
Genomics of lithium action and response
... extended lithium use [39]. A correlation with lithium response has not been tested (although perhaps inferable from long-term use) but would be an indication that cell proliferation/cell size are ... See full document
6
Functional genomics and proteomics of the cellular osmotic stress response in `non model' organisms
... (Ariadne Genomics, ...stress response signal transduction network (Fiol et ...stress response, indicating that these biological processes are targeted during osmotic stress in tilapia gills (Kültz, ... See full document
10
Insights into genomics of salt stress response in rice
... functional genomics of rice. Functional genomics aids in understanding the molecular and physiological basis to improve the salinity tolerance for sustainable rice ...functional genomics that ... See full document
15
Genomics, microRNA, epigenetics, and proteomics for future diagnosis, treatment and monitoring response in upper GI cancers
... the response and/or prognosis (individualized therapy), (3) who might not benefit from a particular toxic treatment regimen, and (4) who could be identified early on and thereby be spared the morbidity associated ... See full document
16
Functional Genomics and Biochemical Characterization of Uranium Biooxidation and Stress Response in Extremely Thermoacidophilic Metallosphaera Species.
... stress response when subjected to “U(VI) shock”, suggesting that it has developed novel mechanisms, active and passive, to resist the deleterious effect of this heavy ...stress response role of ... See full document
211
A systematic analysis of genomics-based modeling approaches for prediction of drug response to cytotoxic chemotherapies
... using a cutoff of p < 0.05 to determine as set of differen- tially expressed probes (DEGs) using the statistics pack- age in scipy 0.17.0. We compare this to a standard method of isolating probes with distinct ... See full document
18
Genomics of response to immune checkpoint therapies for cancer: implications for precision medicine
... The MHC-I complex aids in the presentation of cancer neoantigens to CD8+ cells, and variability among the genes encoding it, including B2M and the HLA-I genes ( HLA-A , HLA-B , and HLA-C ), has been demonstrated to ... See full document
18
Expression and comparative genomics of two serum response factor genes in zebrafish
... We initially designed the following primers to a suspected zebrafish srf ortholog: ctggatctaacgccgcactctcg (forward) and tgagtcctgattcgttgtgtgcga (reverse) and sequence analysis of the PCR product confirmed high-level ... See full document
8
The genomics of desmoplastic small round cell tumor reveals the deregulation of genes related to DNA damage response, epithelial–mesenchymal transition, and immune response
... Results: A total of 137 unique somatic mutations were identified: 133 mutated genes were case-specific, and 2 were mutated in two cases but in different positions. Among the 135 mutated genes, 27% were related to two ... See full document
14
Systematic discovery of drug action mechanisms by an integrated chemical genomics approach: identification of functional disparities between azacytidine and decitabine
... chemical genomics approach, which indeed suggested functional disparities between AZA and DAC, because similar compounds and genes associated with AZA or DAC greatly differed, and AZA and DAC showed little ... See full document
16
The genomics of micronutrient requirements
... in response not only to nutrients but also to drugs (Guyatt et ...in response to changing environmental exposures rather than trying to reduce this complexity to artificial levels that may be less ... See full document
10
Genomics in Personalized Medicine
... patients’ response to drugs. [1,3] Genomics is transforming medical practice by individualizing medical treatment through the provision of patient genetic ... See full document
5
Inhibition by lithium of the hydroosmotic action of vasopressin in the isolated perfused cortical collecting tubule of the rabbit
... incubated at 25 degrees C with Li in the lumen for 3 h, the hydroosmotic response to 2.5 microU X ml-1 AVP (Lp = 6.88 +/- 1.54 nl X cm-2 X s-1 X atm-1) was significantly lower than that in the control tubules ... See full document
9
A fully integrated new paradigm for lithium’s mode of action – lithium utilizes latent cellular fail-safe mechanisms
... This may suggest that nicotinic acid and/or nicotinamide (the actions of which differ in detail), and perhaps adenine and ribose, might also have some potential valproate-like mood-stabilizing action. The ... See full document
28
Patterns of response to aripiprazole, lithium, haloperidol, and placebo across factor scores of mania
... Traditionally, lithium was the major treatment used to ameliorate symptoms of mania by reducing excitatory neurotransmitters (dopamine and glutamate) and is also known for preventing re- currence of manic and ... See full document
9
FIRST RESPONSE ACTION REPORT CARD: PEACE CORPS IMPLEMENTATION
... First Response Action applauds Peace Corps’ progress in a few key ...First Response Action also appreciates the agency’s cooperation in providing updates on its implementation ... See full document
6
Channel Waveguides in Lithium Niobate and Lithium Tantalate
... and lithium niobate channels. Numerical simulations were performed using BeamPROP (part of the RSoft Photonics CAD Suite) which is based on a finite difference beam propagation method assuming 10 nm step sizes in ... See full document
15
Leptin action in the forebrain regulates the hindbrain response to satiety signals
... lean controls was not evident. Perhaps more importantly, Wild- man et al. (41) used a relatively high dose of CCK, and our data suggest that differences between genotypes in the satiety response are minimized at ... See full document
9
The Dynamic Response of a Cylindrical Tube under the Action of a Moving Pressure
... In this study, the dynamic behaviour o f vari ous cylindrical tubes under the action o f a moving pressure is investigated. The pressure front is as sumed to be moving with constant velocity, parallel to the ... See full document
11
Lithium. Generic name = lithium carbonate (tablets and capsules), or lithium citrate (liquid)
... Common side effects of lithium include nausea, loss of appetite, and mild diarrhea. These side effects will usually go away after the first few weeks as your body adjusts to the medication. Dizziness and hand ... See full document
7
Related subjects