• No results found

[PDF] Top 20 Identification of GB virus C variants by phylogenetic analysis of 5'-untranslated and coding region sequences.

Has 10000 "Identification of GB virus C variants by phylogenetic analysis of 5'-untranslated and coding region sequences." found on our website. Below are the top 20 most common "Identification of GB virus C variants by phylogenetic analysis of 5'-untranslated and coding region sequences.".

Identification of GB virus C variants by phylogenetic analysis of 5'-untranslated and coding region sequences.

Identification of GB virus C variants by phylogenetic analysis of 5'-untranslated and coding region sequences.

... Phylogenetic analysis of 44 GB virus C (GBV-C) 5 * -untranslated region (5 * -UTR) sequences from 37 individuals suggested the presence of ... See full document

8

Existence of Distinct GB Virus C/Hepatitis G Virus Variants with Different Tropism

Existence of Distinct GB Virus C/Hepatitis G Virus Variants with Different Tropism

... of GB virus C/hepatitis G virus (GBV-C/HGV) variants with different tropism, we have analyzed the heterogeneity and quasispecies composition of GBV-C/HGV isolated from in ... See full document

7

Evolution of naturally occurring 5'non coding region variants of Hepatitis C virus in human populations of the South American region

Evolution of naturally occurring 5'non coding region variants of Hepatitis C virus in human populations of the South American region

... tree analysis of the 5'NCR from HCV strains isolated in South America revealed that genotype 1 is the most predominant in that region, in agreement with pre- vious results ...the phylogenetic ... See full document

12

The 5′ Untranslated Region of the Capsid Protein 2 Gene of Mink Enteritis Virus Is Essential for Its Expression

The 5′ Untranslated Region of the Capsid Protein 2 Gene of Mink Enteritis Virus Is Essential for Its Expression

... blot analysis showed that VP1 protein but not VP2 protein was highly expressed, which indicated an inhibition of VP2 expression in the eukaryotic expression system ...(qPCR) analysis of the mRNAs showed ... See full document

20

Identification of a Pegivirus (GB Virus-Like Virus) That Infects Horses

Identification of a Pegivirus (GB Virus-Like Virus) That Infects Horses

... viral sequences highly divergent from all known pegivi- ...more sequences of the novel ...PCRs, 5= random amplification of cDNA ends (RACE), and 3= poly(A/G/U) tailing (6, ...new virus ... See full document

6

Hepatitis C Virus Genotyping: Interrogation of the 5′ Untranslated Region Cannot Accurately Distinguish Genotypes 1a and 1b

Hepatitis C Virus Genotyping: Interrogation of the 5′ Untranslated Region Cannot Accurately Distinguish Genotypes 1a and 1b

... of phylogenetic information has been derived from sequence analysis of the NS-5 gene of HCV (10, 16, ...NS-5b region for several years and have devised an algorithm of sequence analysis ... See full document

8

Role of the 5′-Proximal Stem-Loop Structure of the 5′ Untranslated Region in Replication and Translation of Hepatitis C Virus RNA

Role of the 5′-Proximal Stem-Loop Structure of the 5′ Untranslated Region in Replication and Translation of Hepatitis C Virus RNA

... Mutagenesis analysis of the 5⬘-proximal stem-loop RNA element. (A) Sequences and structures of wild-type and mutant 5⬘- proximal stem-loop RNA ...the 5⬘-proximal stem- loop RNA element ... See full document

7

Comparative analysis of hepatitis C virus phylogenies from coding and non coding regions: the 5' untranslated region (UTR) fails to classify subtypes

Comparative analysis of hepatitis C virus phylogenies from coding and non coding regions: the 5' untranslated region (UTR) fails to classify subtypes

... Okamoto region of NS5B resembles trees from the whole genome and the polyprotein, except for rear- rangements in the ordering of deeply rooted branches ...from sequences that include pro- tein-coding ... See full document

9

Prevalence of GB Virus C/Hepatitis G Virus Infection among Various Populations in Surabaya, Indonesia, and Identification of Novel Groups of Sequence Variants

Prevalence of GB Virus C/Hepatitis G Virus Infection among Various Populations in Surabaya, Indonesia, and Identification of Novel Groups of Sequence Variants

... of GB virus C/hepatitis G virus (GBV-C/HGV) infection among various populations in Surabaya, ...NS3 region of the viral genome, was ...B virus surface antigen and ... See full document

7

Comparative performance evaluation of hepatitis C virus genotyping based on the 5' untranslated region versus partial sequencing of the NS5B region of brazilian patients with chronic hepatitis C

Comparative performance evaluation of hepatitis C virus genotyping based on the 5' untranslated region versus partial sequencing of the NS5B region of brazilian patients with chronic hepatitis C

... Hepatitis C virus genotyping assays are usually based on the sequence analysis of an amplified segment of the genome, which is commonly the 5untranslated ...Currently, 5’UTR ... See full document

5

GB Virus C/Hepatitis G Virus Groups and Subgroups: Classification by a Restriction Fragment Length Polymorphism Method Based on Phylogenetic Analysis of the 5′ Untranslated Region

GB Virus C/Hepatitis G Virus Groups and Subgroups: Classification by a Restriction Fragment Length Polymorphism Method Based on Phylogenetic Analysis of the 5′ Untranslated Region

... Sequence analysis of the most 59-terminal region shows a certain degree of heterogeneity among different ...44 sequences from around the world, Muerhoff et ...such analysis was extended to a ... See full document

8

Use of Sequence Analysis of the NS5B Region for Routine Genotyping of Hepatitis C Virus with Reference to C/E1 and 5′ Untranslated Region Sequences

Use of Sequence Analysis of the NS5B Region for Routine Genotyping of Hepatitis C Virus with Reference to C/E1 and 5′ Untranslated Region Sequences

... seven variants belonging to a novel subtype were recognized upon sequencing of ...an analysis of partial core ...seven variants belonged to genotype 3i as proposed, the complete core gene sequence ... See full document

11

Phylogenetic Analysis of Polyomavirus BK Sequences

Phylogenetic Analysis of Polyomavirus BK Sequences

... the phylogenetic diversity of BKV and have established the existence of clades not pre- viously recognized in the ...Expanded phylogenetic analyses with these additional BKV sequences will provide a ... See full document

12

Design of 5′ Untranslated Sequences in Retroviral Vectors Developed for Medical Use

Design of 5′ Untranslated Sequences in Retroviral Vectors Developed for Medical Use

... 59 untranslated sequences may prevent translational silencing of eukaryotic genes ...IRES sequences or internal promoters for translational control of the trans- ... See full document

7

Characterization of Hepatitis G Virus (GB-C Virus) Particles: Evidence for a Nucleocapsid and Expression of Sequences Upstream of the E1 Protein

Characterization of Hepatitis G Virus (GB-C Virus) Particles: Evidence for a Nucleocapsid and Expression of Sequences Upstream of the E1 Protein

... nontranslated region were used for HCV PCR (22, ...translated region (14): outer sense, AAGCCCCAGAAACCGACGCC; anti- sense, TGAAGGGCGACGTGGACCGT; and inner sense, CGGCCAAAAGG TGGTGGATG; antisense, ... See full document

7

Genetic Analysis of Sequences in the 3′ Nontranslated Region of Hepatitis C Virus That Are Important for RNA Replication

Genetic Analysis of Sequences in the 3′ Nontranslated Region of Hepatitis C Virus That Are Important for RNA Replication

... viruses, sequences at the 3⬘ end of the genome were shown to play crucial roles in RNA ...of GB virus B, a virus that is very closely related to HCV, also has a tripartite structure com- posed ... See full document

13

The Pseudoknot Region of the 5′ Untranslated Region Is a Determinant of Viral Tropism and Virulence of Foot-and-Mouth Disease Virus

The Pseudoknot Region of the 5′ Untranslated Region Is a Determinant of Viral Tropism and Virulence of Foot-and-Mouth Disease Virus

... PK region significantly contributed to the altered virulence of the virus in ...rescued virus with the deletion showed pathogenicity in swine but not in ...the virus, and viremia disappeared ... See full document

17

Analysis of Hepatitis C Virus Intrahost Diversity across the Coding Region by Ultradeep Pyrosequencing

Analysis of Hepatitis C Virus Intrahost Diversity across the Coding Region by Ultradeep Pyrosequencing

... system, variants potentially resistant to novel DAAs are constantly arising and may emerge quickly as the dominant species during antiviral treatment, even if initially pres- ent at a low frequency (3, ...NS3/4A ... See full document

9

A 5' proximal Stem loop Structure of 5' Untranslated Region of Porcine Reproductive and Respiratory Syndrome Virus Genome Is Key for Virus Replication

A 5' proximal Stem loop Structure of 5' Untranslated Region of Porcine Reproductive and Respiratory Syndrome Virus Genome Is Key for Virus Replication

... SL2 sequences after D5 deletions and part of the upstream N-SL1 ...the 5 ’ proximal sequences of N-SL1 interacted with 3 ’ - end sequences of N-SL5 to form a tertiary alternative N-SL1’, which ... See full document

15

GB Virus Type C: a Beneficial Infection?

GB Virus Type C: a Beneficial Infection?

... Because GBV-C was not found to be pathogenic, research interest in the virus waned significantly in the late 1990s. How- ever, studies of the pathogenesis of GBV-C in HIV-infected patients yielded ... See full document

5

Show all 10000 documents...