Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Formation of Polyomavirus-Like Particles with Different VP1
Molecules That Bind the Urokinase Plasminogen
Activator Receptor
Young C. Shin† and William R. Folk*
Department of Biochemistry, University of Missouri-Columbia, Columbia, Missouri 65211
Received 9 June 2003/Accepted 6 August 2003
Icosahedral virus-like particles formed by the self-assembly of polyomavirus capsid proteins (Py-VLPs) can
serve as useful nanostructures for delivering nucleic acids, proteins, and pharmaceuticals into animal cells and
tissues. Four predominant surface-exposed loops in the VP1 structure offer potential sites to display sequences
that might contribute new targeting specificities. Introduction into each of these loops of sequences derived
from the amino-terminal fragment of urokinase plasminogen activator (uPA) or a related phage display
peptide reduced the solubility of VP1 molecules when expressed in insect cells, and insertions into the EF loop
reduced VP1 solubility least. Coexpression in insect cells of the uPA-VP1 molecules and VP1 containing a
FLAG epitope in the HI loop permitted the formation of heterotypic Py-VLPs containing uPA-VP1 and
FLAG-VP1. These heterotypic VLPs bound to uPAR on the surfaces of animal cells. Heterotypic Py-VLPs
containing ligands for multiple cell surface receptors should be useful for targeting specific cells and tissues.
The polyomavirus virion is composed of 72 pentameric
sub-units arranged in an icosahedral lattice with an approximate
diameter of 50 nm (51). Polyomavirus virus-like particles
(Py-VLPs) of essentially the same dimensions and shape are
formed by the self-assembly of the major capsid protein VP1
(55, 56). The structural framework for VP1 is an antiparallel

-sheet with jelly roll topology from which emanate four loops
(58–60). The BC, DE, and HI loops closely interact and are
located at the outward-facing end of the

-sheet; the EF loop,
originating from the inward-facing end, is located on a side of
the

-sheet (59, 60). A shallow groove formed between the
BC1 and HI loops binds oligosaccharides terminating in
␣
-2,3-linked sialic acid, expressed on many animal cells (8, 18, 58,
60); the EF loop, together with the DE loop, contains motifs
for integrin binding, which is important for cell susceptibility at
a postattachment level (6). Among different strains of
poly-omavirus, the four VP1 surface-exposed loops exhibit
se-quence variability (3, 17, 36, 39, 53) and the HI loop has been
used predominantly as a site for insertion so as to display on
the surface of Py-VLPs the
Escherichia coli
dihydrofolate
re-ductase (DHFR) (22), protein Z (21), a WW domain peptide
(57), and a polyanionic adapter sequence (62).
The urokinase plasminogen activator receptor (uPAR) is a
glycosylphosphatidylinositol-linked protein expressed on the
apical surfaces of endothelial cells (46) and certain epithelial
cells (26) and leukocytes (48) to promote proteolysis (13), cell
adhesion (7, 66), migration (5, 15), and chemotaxis (9, 14, 27,
28, 42, 52). uPAR is expressed by many cancer cells, where it
is correlated with metastasis and poor prognosis (10, 29–32, 43,
63), and is a potential target for drug and gene therapy. Also,
uPAR is expressed on the apical surface of human airway
epithelia and might be used to target delivery of DNAs to
correct the genetic defect in individuals with cystic fibrosis
(12). Sequences binding with high affinity to uPAR occur in the
amino-terminal domain of urokinase plasminogen activator (2,
47), and uPA-unrelated sequences with high affinity to uPAR
also have been identified (24).
In this study, peptide sequences that bind to uPAR were
introduced into each of the four exposed loops. VP1 proteins
with insertions in the EF loop were most frequently expressed
in insect cells in a soluble form; the same insertions in the
other loops caused VP1 to be expressed in an insoluble form.
The efficiency of self-assembly of Py-VLPs containing the
uPA-VP1 molecules was enhanced by coexpression with soluble
VP1 molecules modified in the HI loop by the FLAG epitope.
The heterotypic Py-VLPs composed of both types of VP1
bound specifically to uPAR on the surface of U-937 cells.
Heterotypic Py-VLPs containing ligands for different receptors
should expand the utility of Py-VLPs as gene delivery agents
(4, 16).
MATERIALS AND METHODS
Modification of polyomavirus VP1 genes.The VP1 gene of the polyomavirus A3 strain cloned in pFastBac1 plasmid (GIBCO-BRL) was used as a backbone for the construction of modified VP1 genes. Insertions into the BC (80 or 87), DE (150), EF (200), and HI (293) loops of VP1 (numbers indicate the residues of the VP1 protein prior to the insertion) were made by the following method, as exemplified by the insertion of the FLAG epitope (DWKDDDDK) into the HI loop. Two DNA fragments of the VP1 coding sequence containing the FLAG coding sequence were synthesized by PCR using primer pairs FBac-F/HI-FLAG-R and FBac-R/HI-FLAG-F. The PCR products were purified by agarose gel electrophoresis and isolated with the Compass DNA purification kit (Amer-ican Bioanalytical, Natick, Mass.) and then annealed to make the intact VP1/ HI-FLAG gene. This DNA was amplified by PCR using FBac-F and FBac-R primers, purified, and then cloned into the pFastBac-1 plasmid at theXbaI and
XhoI sites. Essentially the same approach was employed to insert uPA(10-34) and the clone 20 peptide sequence (24) into the HI, BC, DE, and EF loops. The following primers were used to insert these sequences (residues complementary to VP1 are underlined): FBac-F, GATTATTCATACCGTCCCACCATCG;
* Corresponding author. Mailing address: Department of
Biochem-istry, 117 Schweitzer Hall, University of Missouri-Columbia,
Colum-bia, MO 65211. Phone: (573) 882-2841. Fax: (573) 884-4808. E-mail:
† Present address: Tumor Virology Division, New England Regional
Primate Research Center, Southborough, Mass.
11491
on November 8, 2019 by guest
http://jvi.asm.org/
FBac-R, CTGATTATGATCCTCTAGTACTTCT; HI-FLAG-F, AAGGACGA CGATGACAAGCCCGGGAACTATGATGTCCATCACTG; HI-FLAG-R, GTC ATCGTCGTCCTTGTAGTCGAATTCTCTTGTAACTCTCCTGCCCA; BC-uPA(10-34)-F, CAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCC CAAATTTGGCTACATCAGATAC; BC-uPA(10-34)-R, GAGAAGTACTTG TTGGACACACATGTTCCTCCATTTAGACAGTCACAGTTAATCCCTCT GCTCCAACCAT; DE-uPA(10-34)-F, CAACAAGTACTTCTCCAACATTCA CTGGTGCAACTGCCCAACAAAAGTAATTTCCACTCC; DE-uPA(10-34)-R, GAGAAGTACTTGTTGGACACACATGTTCCTCCATTTAGACAGTCAC AGTTGTTTACTGTATCTGTGGGTT; EF-uPA(10-34)-F, CAACAAGTACT TCTCCAACATTCACTGGTGCAACTGCCCAGACATGGTCAACAAAGA CCA; EF-uPA(10-34)-R, GAGAAGTACTTGTTGGACACACATGTTCCTC CATTTAGACAGTCACAGTTCTTCTTTGTGATTGTTTTGA; HI-uPA(10-34)-F, CAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCCCAAAC TATGATGTCCATCACTG; HI-uPA(10-34)-R, GAGAAGTACTTGTTGGA CACACATGTTCCTCCATTTAGACAGTCACAGTTTCTTGTAACTCTCC TGCCCA; BC-clone-20-F, TCTCTGAACTTCTCTCAGTACCTGTGGTACA CCGAGGATTCCCCAGAAAATAAT; BC-clone-20-R, AGAGAAGTTCAG AGAGTGCGGCATCGGTTCCGCTGTATCTGATGTAGCCAAATT; DE-clone-20-F, TCTCTGAACTTCTCTCAGTACCTGTGGTACACCACAAAAG TAATTTCCACTCCA; DE-clone-20-R, AGAGAAGTTCAGAGAGTGCGGC ATCGGTTCCGCGTTTACTGTATCTGTGGGTTT; EF-clone-20-F, TCTCT GAACTTCTCTCAGTACCTGTGGTACACCGACATGGTCAACAAAGAC CAA; EF-clone-20-R, AGAGAAGTTCAGAGAGTGCGGCATCGGTTCCG CCTTCTTTGTGATTGTTTTGAT; HI-clone-20-F, TCTCTGAACTTCTCTC AGTACCTGTGGTACACCAACTATGATGTCCATCACTGG; HI-clone-20-R, AGAGAAGTTCAGAGAGTGCGGCATCGGTTCCGCTCTTGTAACTCTC CTGCCCAT.
For the insertion of longer sequences, such as uPA(1-60) and uPA(1-135), into VP1, restriction enzyme sites forNheI andXmaI were introduced into the coding sequence for each VP1 loop by the same procedure employed to make the FLAG insertion, using the following primers (sequences complementary to VP1 are underlined and sequences of restriction enzymes are boldface): BC-F,GCTAG CAGCCGTCCCGGGGAGGATTCCCCAGAAAATAAT; BC-R, CCCGGGA CGGCTGCTAGCTGTATCTGATGTAGCCAAATT; DE-F,GCTAGCAGCC GTCCCGGGACAAAAGTAATTTCCACTCCA; DE-R,CCCGGGACGGCTG CTAGCGTTTACTGTATCTGTGGGTTT; EF-F,GCTAGCAGCCGTCCCGG GGACATGGTCAACAAAGACCAA; EF-R, CCCGGGACGGCTGCTAGCC TTCTTTGTGATTGTTTTGAT; HI-F, GCTAGCAGCCGTCCCGGGAACT ATGATGTCCATCACTGG; HI-R, CCCGGGACGGCTGCTAGCTCTTGTA ACTCTCCTGCCCAT.
The first cDNA strand of human uPA(1-135) was synthesized by reverse transcription using the uPA(1-135)-R primer by the methods described in the cDNA synthesis system manual (GIBCO-BRL). Total mRNA was purified from cultured PC-3 cells. The first cDNA strand was amplified with the uPA(1-60)-F and uPA(1-60)-R and uPA(1-135)-F and uPA(1-135)-R primer pairs to produce the uPA(1-60) and uPA(1-135) sequences, respectively. The PCR products were inserted into the coding sequence for each loop of VP1 usingNheI andXmaI restriction enzymes. The sequences of primers used for amplification of uPA sequences were as follows (sequences of uPA are underlined, and sequences of restriction enzymes are boldface): uPA(1-60)-F, AGCTGCTAGCAGCAATGA ACTTCATCAAGTT; uPA(1-60)-R, TAATCCCGGGTCCTCGGTAAAAGTG ACCATT; uPA(1-135)-F, CCGGAATTCAGCAATGAACTTCATCAAGTT; uPA(1-135)-R, TCCCCCCGGGTTTTCCATCTGCGCAGTCATG.
Construction of VP1/EF-uPA(1-60)/HI-FLAG was performed by replacing part of the VP1 coding sequence of pFastBac-VP1/HI-FLAG with that of pFast-Bac-VP1/EF-uPA(1-60) by using theXbaI andApaI restriction enzymes.
All of the constructs were confirmed by DNA sequencing.
Insect cell culture and baculovirus infections.Hi-5 insect cells were grown with EX-CELL TM 405 medium (JRH Biosciences, Lenexa, Kans.) supple-mented with 5% fetal calf serum. Baculoviruses expressing wild-type and mod-ified VP1 proteins were prepared according to procedures described in the Bac-to-Bac instruction manual (GIBCO-BRL) and titered by plaque assay. Cells (5⫻106) in T-150 flasks were infected at a multiplicity of infection (MOI) of 10
and harvested 84 h after infection. For the production of heterotypic Py-VLPs, Hi-5 cells were infected as described above by baculoviruses expressing VP1/HI-FLAG together with baculoviruses expressing VP1/EF-uPA(1-60)/HI-VP1/HI-FLAG at a MOI between 2 to 20.
Purification of Py-VLPs.Baculovirus-infected cells were harvested by low-speed centrifugation (900⫻g, 5 min) and suspended in 3 ml of buffer A (10 mM Tris-HCl [pH 7.4], 1 M NaCl, 0.01 mM CaCl2, 0.01% Triton X-100) and
soni-cated for 20 s three times. Proteinase inhibitors (Complete; Roche Diagnostics, Mannheim, Germany) were added to the lysate, which was centrifuged at 12,000
rpm for 30 min in a Beckman JA21 rotor, and the supernatant was saved. The pellet was resuspended with 2 ml of buffer A and sonicated and then centrifuged as described above. The two supernatants were combined and layered on top of sucrose (2 ml of 10% and 2 ml of 20%) in buffer A and centrifuged at 40,000 rpm for 4 h in a Beckman SW40 rotor. The resulting pellet was resuspended in 1 ml of buffer A (150 mM NaCl) and sonicated for 20 s to disrupt aggregates and centrifuged at 14,000⫻gfor 10 min, with the supernatant being saved (desig-nated partially purified Py-VLPs). Py-VLPs were further purified by sedimenta-tion through 10 to 50% sucrose gradients at 40,000 rpm for 4 h in a Beckman SW40 rotor.
For analysis based on sedimentation velocity, Py-VLPs partially purified through 10 to 20% sucrose gradients were treated with DNase I (Promega) for 1 h at 37°C and layered on top of 10 to 40% sucrose gradients, followed by centrifugation at 35,000 rpm for 2 h in a Beckman SW40 rotor. Fractions (0.8 ml) were collected, and the protein content of each fraction was determined by Bio-Rad protein assay.
Immunoprecipitation of Py-VLPs.Partially purified Py-VLPs (20g) were mixed with an anti-uPA monoclonal antibody (0.1 ml, no. 3921; American Di-agnostica) and incubated for 1 h at 4°C with rotary agitation. Protein A-Sepha-rose CL-4B (50%, vol/vol) was added (80l) to the mixture, and the mixture was incubated for another 1 h and centrifuged. The antibody complexes were washed with 1 ml of buffer A (150 mM NaCl), and bound protein was eluted with 100 mM glycine-HCl (pH 3.0) and immediately neutralized with Tris-HCl (1.5 M, pH 8.8) and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting.
Electron microscopy of Py-VLPs.Preparations of partially purified Py-VLPs (0.2 to 0.5 mg/ml) were placed on a carbon-coated copper grid for 5 min and negatively stained with 1% uranyl acetate for 5 min. Transmission electron microscopy was performed with a JEOL 1200EX transmission electron micro-scope operating at 100 kV, and Py-VLPs were photographed with a magnifica-tion factor of 120,000.
Hemagglutination of Py-VLPs.Partially purified Py-VLPs (0.5 mg/ml, 100l) were serially diluted with saline in a 96-well (round-bottom) plate. Equal vol-umes of guinea pig red blood cells (2%, vol/vol) were added to each well and incubated for 3 h at room temperature.
Py-VLP binding to U-937 cells.Human U-937 cells (American Type Culture Collection; CRL 1593) growing in RPMI 1640 medium supplemented with 10% fetal calf serum and gentamicin (20 mg/liter) were harvested and resuspended at a concentration of 5⫻105cells/ml. Induction of uPAR was performed as
described by Stoppelli et al. (61) with slight modifications. Phorbol 12-myristate 13-acetate (PMA) was added at a concentration of 50 nM, and the cells were cultured for 24 h in T-150 flasks. Most of cells were attached by this time. The medium was changed, and the cells were incubated for another 2 days; the cells were detached with phosphate-buffered saline (PBS)–EDTA and incubated in 50 mM glycine–100 mM NaCl (pH 3.0) for 3 min to remove bound endogenous uPA, washed with PBS containing 0.1 mg of bovine serum albumin (PBSA)/ml, and resuspended at 5⫻106cells/ml in PBSA. Expression of uPAR was verified
by Western blot analysis using the anti-uPAR antibody (no. 3931; American Diagnostica). To observe the binding mediated by uPA(1-60), the putative inte-grin-binding sequence (LDV) (6) in VP1/wt, VP1/HI-FLAG, and VP1/EF-uPA(1-60)/HI-FLAG was changed to LAA by site-directed mutagenesis using the GeneEditor kit (Promega), the resulting VP1 genes were expressed in insect cells, and Py-VLPs were partially purified by the procedure described above. Partially purified Py-VLPs (20g) with or without competitor were mixed with 0.1 ml of the cell suspension described above and incubated for 40 min on ice. As a competitor, 30g of full-length uPA (no. 128; American Diagnostica) was added in each reaction. At the end of incubation, unbound Py-VLPs were removed by washing twice with PBSA, and cells were lysed with 100l of SDS-PAGE sample buffer. SDS-PAGE and Western blotting were performed to evaluate the amount of bound Py-VLPs.
RESULTS
Expression of polyomavirus VP1 proteins.
Recombinant
baculoviruses were constructed so as to express the wild-type
polyomavirus VP1 protein and modified VP1 proteins
contain-ing inserts in each of the four surface-exposed loops. The
uPA-related inserts included uPA(10-34), the principal binding
determinant for uPAR (2); uPA(1-135), the amino-terminal
fragment (ATF) whose affinity for uPAR (50% inhibitory
con-centration [IC
50]
⫽
0.12 nM) approximates that of intact uPA
on November 8, 2019 by guest
http://jvi.asm.org/
(2, 47) and which has been widely used in studies of the
uPA-uPAR interaction (2, 33, 61); uPA(1-60), comprising the
more-hydrophilic half of ATF; and a phage display peptide (clone 20,
15 amino acids) with high affinity for uPAR (IC
50⫽
0.01
M)
(24). Additionally, VP1 containing a FLAG epitope in the HI
loop was expressed.
Lysates of baculovirus-infected insect cells were centrifuged
at 12,000 rpm for 30 min, and the distribution of VP1 proteins
between the supernatant and pellet was determined by
SDS-PAGE and Western blotting with the anti-VP1 antibody
(Ta-ble 1). Unmodified VP1 and VP1 modified by insertion of the
FLAG epitope (VP1/HI-FLAG) partitioned primarily into the
supernatants. Approximately two-thirds of the VP1/EF-clone
20, VP1/EF-uPA(10-34), and VP1/EF-uPA(1-60) proteins also
partitioned into the supernatants. However, all other modified
VP1 proteins were pelleted, suggesting that they did not fold
properly or that the hydrophobic inserts caused aggregation.
VP1 with uPA(1-60) and uPA(1-135) inserts in the four
loops were recognized by the anti-uPA antibody (no. 3921;
American Diagnostica), but VP1/EF-uPA(1-60) gave stronger
signals in Western blots than the same insert into the BC, DE,
and HI loops of VP1 (Fig. 1A), suggesting that the
antibody-reactive structure is either more accessible or better retained
when introduced into the EF loop. Also, VP1/EF-uPA(1-60)
migrated somewhat faster on SDS-PAGE, suggesting a more
compact structure. To disrupt VP1/EF-uPA(1-60) binding to
sialic acid, we introduced the FLAG epitope into its HI loop.
VP1/EF-uPA(1-60)/HI-FLAG was expressed as well as the
singly modified VP1/EF-uPA(1-60) and was as reactive with
anti-uPA antibody (data not shown).
Formation of Py-VLPs by modified VP1 proteins.
To
deter-mine whether the VP1 proteins had assembled into Py-VLPs,
samples of the supernatants of cell lysates containing VP1/
wt, VP1/HI-FLAG, VP1/EF-uPA(1-60)/HI-FLAG, and VP1/
EF-uPA(1-60)/HI-FLAG
⫹
VP1/HI-FLAG (cells coexpressing
both proteins) were layered on top of 10 to 20% sucrose and
centrifuged at 40,000 rpm for 4 h. Each of the VP1 proteins
could be pelleted (Fig. 2), suggesting that they self-assembled
into Py-VLPs. Further purification of Py-VLPs by
sedimenta-tion through 10 to 50% sucrose gradients revealed that only a
small portion of VP1/EF-uPA(1-60)/HI-FLAG was pelleted,
while the others were pelleted efficiently. To confirm the
slower sedimentation rate of the VLPs formed by
VP1/EF-uPA(1-60)/HI-FLAG, the Py-VLPs partially purified through
10 to 20% sucrose gradients were layered onto 10 to 40%
[image:3.603.306.535.66.299.2]sucrose gradients and centrifuged, and the VP1 protein in each
fraction was determined. As expected,
VP1/EF-uPA(1-60)/HI-FLAG was observed to sediment more slowly than VP1/wt,
VP1/HI-FLAG, and VP1/EF-uPA(1-60)/HI-FLAG
⫹
VP1/HI-FLAG (Fig. 3), indicating that the Py-VLPs formed by this
VP1 were different from others.
TABLE 1. Partitioning of modified VP1 proteins between
supernatant and pellet following centrifugation of insect cell lysates
Sequence Result
afor loop:
BC DE EF HI
Clone 20
P
P
S/p
P
uPA (10–34)
NE
P
S/p
P
uPA (1–60)
P
P
S/p
P
uPA (1–135)
P
P
P
P
FLAG
NT
NT
NT
S
aS, VP1 proteins partitioned entirely into supernatant (⬎90%) following centrifugation at 12,000 rpm for 30 min; S/p, VP1 proteins predominantly par-titioned into the supernatant (⬎60%); P, VP1 proteins partitioned entirely into the pellet; NE, not expressed; NT, not tested.
[image:3.603.43.286.91.170.2]FIG. 1. Partitioning of VP1/uPA(1-60) proteins between
superna-tant and pellet following centrifugation of insect cell lysates and
de-tection with antibodies. (A) VP1 proteins containing uPA(1-60) in
each loop region were expressed in insect cells, and the whole-cell
lysates (WCL) were evaluated with the VP1 antibody or the
anti-uPA antibody (no. 3921; American Diagnostica). Lane 1,
VP1/BC-uPA(1-60); lane 2, VP1/DE-VP1/BC-uPA(1-60); lane 3, VP1/EF-VP1/BC-uPA(1-60);
lane 4, VP1/HI-uPA(1-60). (B) Partitioning of the modified VP1
pro-teins between supernatant (S) and pellet (P), after centrifugation at
12,000 rpm for 30 min, and evaluation by SDS-PAGE and blotting with
the anti-VP1 antibody. Lanes are the same as for panel A.
FIG. 2. Sedimentation of VP1 proteins. Supernatants after
low-speed centrifugation (lanes 1 to 4) were sedimented through 10 to 20%
sucrose gradients (lanes 5 to 8), and pelleted proteins were analyzed by
SDS–12% PAGE. Circles, VP1 proteins of interest; arrow, protein
migrating around 38 kDa, possibly a degradation product of VP1. Lane
M, molecular weight standard; lanes 1 and 5, VP1/wt; lanes 2 and 6,
VP1/HI-FLAG; lanes 3 and 7, VP1/EF-uPA(1-60)/HI-FLAG; lanes 4
and 8, VP1/EF-uPA(1-60)/HI-FLAG
⫹
VP1/HI-FLAG.
on November 8, 2019 by guest
http://jvi.asm.org/
[image:3.603.315.525.521.650.2]The partially purified Py-VLPs derived from VP1/wt, VP1/
HI-FLAG, VP1/EF-uPA(1-60)/HI-FLAG, and VP1/EF-uPA
(1-60)/HI-FLAG
⫹
VP1/HI-FLAG were examined by
transmis-sion electron microscopy (Fig. 4). The VP1/wt, VP1/HI-FLAG,
and VP1/EF-uPA(1-60)/HI-FLAG
⫹
VP1/HI-FLAG
prepara-tions contained mainly typical 50 nm VLPs, but only smaller
particles approximately 20 nm in diameter were observed with
VP1/EF-uPA(1-60)/HI-FLAG, suggesting that they might be
12-ICOSA structures (56). The partially purified Py-VLP
prep-arations derived from VP1/EF-uPA(1-60)/HI-FLAG
⫹
VP1/
HI-FLAG also contained a small amount of 20-nm particles
(Fig. 4D and E), which increased concomitantly with the
ex-pression of VP1/EF-uPA(1-60)/HI-FLAG (data not shown).
The 20-nm particles were infrequently observed in
prepara-tions of VP1/wt and VP1/HI-FLAG, as for example in the
minor peaks (fraction 10) in Fig. 3.
To determine whether the VP1/HI-FLAG and
VP1/EF-uPA(1-60)/HI-FLAG proteins assemble heterotypic Py-VLPs
when coexpressed, the preparation was immunoprecipitated
with the anti-uPA antibody and analyzed by Western blotting
using the anti-VP1 antibody (Fig. 5). Both VP1/HI-FLAG and
VP1-EF-uPA(1-60)/HI-FLAG were precipitated (Fig. 5B, lane
3), indicating that these two proteins occurred in the same
particles. Immunoprecipitated Py-VLPs were not enriched in
20-nm particles, compared to those purified by sucrose
sedi-mentation (Fig. 4D and E), indicating that the uPA
anti-body bound both 50- and 20-nm particles. This supports the
suggestion that 50-nm particles contain VP1/EF-uPA(1-60)/
HI-FLAG and VP1/HI-FLAG.
Py-VLPs expressed in insect cells frequently contain cellular
[image:4.603.327.514.67.399.2]DNA (1, 20). Analysis of the partially purified Py-VLPs
de-rived from VP1/wt, VP1/HI-FLAG, and VP1/EF-uPA(1-60)/
HI-FLAG
⫹
VP1/HI-FLAG by agarose gel electrophoresis
af-ter DNase I treatment showed that they contained
⬃
5 kb of
FIG. 3. Analysis of VP1 proteins based on sedimentation velocity.
Partially purified VP1 proteins were sedimented through 10 to 40%
sucrose gradients, and fractions (0.8 ml) were collected (fraction 1 is
the bottom). The main peaks of VP1/wt, VP1/HI-FLAG, and
VP1/EF-uPA(1-60)/HI-FLAG
⫹
VP1/HI-FLAG occurred in fractions 4 to 6,
while the main peak of VP1/EF-uPA(1-60)/HI-FLAG occurred in
frac-tions 9 to 11.
[image:4.603.55.270.67.308.2]FIG. 4. Transmission electron micrographs of Py-VLPs. Py-VLPs
purified by sucrose sedimentation (A through D) or
immunoprecipi-tation (E) were photographed with a magnification factor of 120,000.
Bars, 50 (A) and 20 nm (C). (A) VP1/wt; (B) VP1/HI-FLAG; (C) VP1/
EF-uPA(1-60)/HI-FLAG; (D and E) VP1/EF-uPA(1-60)/HI-FLAG
⫹
VP1/HI-FLAG.
FIG. 5. Immunoprecipitation of VLPs. (A) Partially purified
Py-VLPs were resuspended to approximately the same concentration and
detected in Western blots with the anti-VP1 antibody. Lane 1, VP1/wt;
lane 2, VP1/HI-FLAG; lane 3, VP1/EF-uPA(1-60)/HI-FLAG
⫹
VP1/
HI-FLAG. (B) The VLPs from panel A were immunoprecipitated with
the anti-uPA monoclonal antibody and detected by the anti-VP1
an-tibody. The weak signals in lanes 1 and 2 might be due to nonspecific
binding of VP1 proteins to the resin, as we did not observe any
cross-reactivity of the anti-uPA antibody to VP1/wt or VP1/HI-FLAG
in Western blots (data not shown). Lanes are the same as for panel A.
on November 8, 2019 by guest
http://jvi.asm.org/
[image:4.603.317.526.547.631.2]DNA (data not shown), indicating that heterotypic Py-VLPs
are capable of packaging DNA.
Specific binding of heterotypic Py-VLPs to uPAR.
Insertion
of the FLAG epitope into the HI loop of VP1 was predicted to
eliminate binding of the Py-VLPs to sialic acid (58–60) and the
hemagglutination of red blood cells, as has been observed with
the insertion of other foreign sequences (21, 22, 57, 62).
Ac-cordingly, the Py-VLPs derived by the self-assembly of VP1/
HI-FLAG or VP1/EF-uPA(1-60)/HI-FLAG
⫹
VP1/HI-FLAG
did not agglutinate red blood cells, unlike the Py-VLPs derived
from VP1/wt (Fig. 6).
U-937 cells were chosen to assess the affinity of heterotypic
VLPs for uPAR. Normally, these cells express only low levels
of uPAR, but, upon stimulation with PMA, high levels of
uPAR are induced (47, 61). Since VP1/wt binds to sialic acid
expressed on many mammalian cells, Py-VLPs containing
VP1/wt were expected to bind to U-937 cells regardless of
whether they are stimulated by PMA (Fig. 7). VP1/HI-FLAG
did not bind to U-937 cells in either case. Heterotypic VLPs
composed of VP1/EF-uPA(1-60)/HI-FLAG and
VP1/HI-FLAG bound to PMA-stimulated U-937 cells but not to
un-stimulated U-937 cells, and the binding was inhibited by
puri-fied uPA added as a competitor. Mutation of LDV, the
putative integrin-binding motif, did not affect binding (data not
shown). These results indicate that the binding to uPAR is
caused by the uPA(1-60) sequence introduced into VP1 at the
EF loop.
DISCUSSION
The BC, DE, EF, and HI loops of polyomavirus VP1 are
surface-exposed and thus provide sites for the display of
se-quences that might bind to receptors on the surfaces of cells.
Modification of the HI loop is attractive, in that the VP1
protein’s native tropism for sialic acid binding can be disrupted
concomitantly with the insertion of the foreign sequences, as
was done here with the FLAG sequence. However,
introduc-tion of the WW domain into the HI loop prevented its correct
folding and interfered with the formation of VLPs (57). For
this sequence, the DE loop was a better insertion site than the
HI loop. Also, the
E. coli
DHFR inserted into the HI loop
reduced the efficiency of self-assembly and altered the
prop-erties of the VLPs (22).
In this study, four different sequences that bind to uPAR,
the clone 20 peptide, uPA(10-34), uPA(1-60), and uPA(1-135),
were inserted into sites in the four major surface-exposed loops
of the polyomavirus VP1. Except for insertion of uPA(10-34)
into the BC loop, the sequences had little effect on the
[image:5.603.314.528.324.562.2]expres-sion of VP1, but they differed significantly in their effects on
the solubility of VP1. The VP1 proteins that remained in the
supernatant had peptide insertions in the EF loop, indicating
that this loop tolerates greater sequence variability.
Further-more, uPA(1-60) introduced into the EF loop retained greater
reactivity with the antibody than when it was introduced into
the BC, DE, or HI loop. These data suggest that the EF loop,
fairly isolated at the side of the pentamer, might be more
flexible and accommodating of foreign sequences than the BC,
FIG. 6. Hemagglutination assay of Py-VLPs. Doubling dilutions of Py-VLPs (from left to right) mixed with guinea pig red blood cells are
shown.
FIG. 7. Binding of Py-VLPs to uPAR expressed on the surfaces of
U-937 cells. (A) Expression of uPAR by U-937 cells without (
⫺
) and
with (
⫹
) stimulation by PMA was assessed by Western blotting with
the anti-uPAR monoclonal antibody. (B) Partially purified Py-VLPs
resuspended to approximately the same concentration were assessed
by Western blotting with the anti-VP1 antibody. Lane 1, VP1/wt; lane
2, VP1/HI-FLAG; lane 3, VP1/EF-uPA(1-60)/HI-FLAG
⫹
VP1/HI-FLAG. (C and D) Py-VLPs bound to unstimulated (C) or stimulated
(D) U-937 cells were assessed by Western blotting with the anti-VP1
antibody. The Py-VLPs composed of VP1/EF-uPA(1-60)/HI-FLAG
⫹
VP1/HI-FLAG bound to stimulated but not to unstimulated U-937
cells. Binding was reduced by the addition of uPA as a competitor
(lane 4), leaving a weak signal from VP1/HI-FLAG. The signal from
VP1/EF-uPA(1-60)/HI-FLAG was weaker than that from
VP1/HI-FLAG (the relative amount of each protein in SDS-PAGE gel was
shown in lane 8 of Fig. 2) and could hardly be detected. Lanes 1 to 3
are as for panel B; lane 4, VP1/EF-uPA(1-60)/HI-FLAG
⫹
VP1/HI-FLAG plus full-length uPA.
on November 8, 2019 by guest
http://jvi.asm.org/
DE, and HI loops, which are interlocked to form the top
surface of the pentamer (58–60) and hence less flexible.
Our data and that published by others suggest that the size
of a foreign sequence inserted into VP1 is a limiting factor for
self-assembly into VLPs. Since the VLPs are composed of 360
copies of VP1, introduction of this many copies of a foreign
sequence with the mass of
E. coli
DHFR or uPA(1-135) (
⬃
18
and
⬃
15 kDa, respectively) may constrain assembly or proper
folding. On the other hand, relatively small peptides such as
the FLAG sequence, protein Z (
⬃
6.8 kDa), and the WW
domain (
⬃
4 kDa) can be introduced without disrupting the
self-assembly of VP1. A size constraint for insertion of foreign
sequences into the papillomavirus L1 protein, which can
ac-commodate no more than
⬃
60 amino acids without its
self-assembly being affected, had been suggested (41). One way to
overcome such a size constraint is by forming VLPs from two
different modified VP1 proteins, one of which has a small
insert. For example, while VP1/EF-uPA(1-60)/HI-FLAG
could not form normal VLPs, it was able to do so when
ex-pressed with VP1/HI-FLAG.
Another factor to be considered in Py-VLP formation is the
hydrophobicity of the foreign sequence introduced into VP1.
Short anionic sequences on the surface of a VLP have the least
likelihood of interfering with the ionic character of the native
polyomavirus surface, which is mainly negatively charged in
neutral and alkaline solutions (64). The FLAG sequence,
con-taining five negatively charged aspartates, is most likely an
ideal sequence to be displayed on the surface of polyomavirus
VLPs and other virus assemblies (34). The polyanionic adapter
(E8C) is also mainly negatively charged (62) and should be
relatively easy to display on the surfaces of polyomavirus VLPs.
In contrast, hydrophobic sequences derived from or mimicking
uPA caused problems in expression of modified VP1, with
VP1/EF-uPA(1-60) retaining only moderate solubility and
VP1/EF-uPA(1-135) retaining even less. The uPA(1-135)
se-quence alone is expressed in inclusion bodies in
E. coli
(50) and
as an insoluble form in insect cells (data not shown). It might
also be difficult for uPA(1-135) to fold correctly when it is
introduced into the VP1 protein. The solubility of recombinant
adenovirus capsids, which also was dependent on the ligand
introduced into the capsid, was strongly correlated with the
production of viable virus (38).
Binding of Py-VLPs to sialic acid is mediated by the BC1 and
HI loops of VP1, but disruption of the HI loop alone by the
insertion of a foreign peptide sequence resulted in a total loss
of binding. Disruption of the BC1 loop is likely to have a
similar effect. The binding of polyomavirus VLPs to U-937
cells before the mutation of the LDV integrin-binding motif
was not noticeably different from that after the mutation (data
not shown), consistent with the suggestion that the interaction
of the LDV motif and integrin might occur after the initial
binding with sialic acids on the cell surface (6).
Binding of Py-VLPs containing uPA(1-60) to uPAR is the
first example of targeting a polyomavirus to a cellular receptor
expressed on a particular cell type. Polyomavirus virions are
internalized via caveolae (54) or yet-unidentified vesicles (19)
after initial attachment to the sialic acids of an unidentified
protein receptor. The
␣
4

1 integrin is thought to be involved
in this process, facilitating the internalization of virions (6).
VLPs targeted to the erbB-2 receptor, which is not
internal-ized, are still directed to the nucleus for efficient transgene
expression even though they lack sialic acid-binding capacity
(62). This suggests that modified polyomavirus VLPs employ a
specific internalization pathway that is independent of the
pathway(s) normally utilized by the receptors to which they are
directed. It will be interesting to investigate the internalization
process of uPAR-binding polyomavirus VLPs, because both
uPAR and polyomavirus have their own distinctive
internal-ization pathways involving clathrin-coated vesicles (11) and
caveolae (54), respectively.
The formation of heterotypic VLPs affords the opportunity
to develop polyvalent vectors in which multiple ligands can be
displayed simultaneously on one particle. In principle,
employ-ing multiple ligands should combinatorially increase the
spec-ificity for a particular cell or tissue type. Peptide sequences that
can be used to target specific cell types include the epidermal
growth factor (EGF)-like domain of heregulin, composed of 60
amino acids and known to sufficient for the binding to the EGF
receptor (35), which is expressed on many breast cancer cells
(49). Alternatively the C-terminal 21 amino acids of
gastrin-releasing protein have proved their potential in targeting its
receptor (23), which is overexpressed in a variety of carcinomas
and melanomas (40, 44, 67). It is feasible to incorporate these
compact ligands into heterotypic VLPs in combination with
other ligands such as uPA(1-60) to increase the specificity of
targeting certain cell types. The enhanced specificity of
poly-valent VLPs might also be valuable in imaging cancer cells that
express multiple tumor-associated antigens. Efforts to explore
these possibilities are under way.
Another likely use of heterotypic VLPs will be as carriers of
multiple antigenic epitopes. It is known that VLP elicits an
immune response to a virus with inherent adjuvant activity and
thus might be applied to the preparation of vaccines. In fact,
VLPs of the human immunodeficiency virus (HIV) Gag
pro-tein (25), bovine papillomavirus L1 propro-tein (45), and hepatitis
virus surface antigen (65) have proven to be efficient antigen
delivery tools. Especially in the work of Liu et al. (37), multiple
cytotoxic T-lymphocyte epitopes were introduced at the C
ter-minus of the L1 protein to induce simultaneous immune
re-sponses against HIV and human papillomavirus. But the utility
of the L1 protein as a polyvalent carrier is limited, for only up
to 60 amino acids can be introduced without affecting VLP
self-assembly. Even though polyomavirus VLPs exhibited a
similar size limitation, the formation of heterotypic VLPs
might overcome this limitation because such VLPs can be
formed by several kinds of VP1 proteins having different
pep-tide inserts.
ACKNOWLEDGMENTS
We thank the members of the Folk laboratory for their helpful
suggestions during the research and Sarah Scanlon for her invaluable
assistance. We also thank Mark Martin, University of Missouri,
Co-lumbia, for providing the pET-15b-VP1/wt plasmid and Richard A.
Consigli, Kansas State University, Manhattan, for his kind gift of the
anti-VP1 antibody. The electron microscopy was performed with the
assistance of staff in the Molecular Biology Electron Microscopy core
of the University of Missouri-Columbia.
Support was provided by U.S. Army Medical Research and Materiel
Command grant DAMD17-98-1-8321.
on November 8, 2019 by guest
http://jvi.asm.org/
REFERENCES
1. An, K., E. T. Gillock, J. A. Sweat, W. M. Reeves, and R. A. Consigli.1999. Use of the baculovirus system to assemble polyomavirus capsid-like particles with different polyomavirus structural proteins: analysis of the recombinant assembled capsid-like particles. J. Gen. Virol.80:1009–1016.
2. Appella, E., E. A. Robinson, S. J. Ullrich, M. P. Stoppelli, A. Corti, G. Cassani, and F. Blasi.1987. The receptor-binding sequence of urokinase. A biological function for the growth-factor module of proteases. J. Biol. Chem. 262:4437–4440.
3. Bauer, P. H., R. T. Bronson, S. C. Fung, R. Freund, T. Stehle, S. C. Harrison, and T. L. Benjamin.1995. Genetic and structural analysis of a virulence determinant in polyomavirus VP1. J. Virol.69:7925–7931.
4. Braun, H., K. Boller, J. Lower, W. M. Bertling, and A. Zimmer.1999. Oligonucleotide and plasmid DNA packaging into polyoma VP1 virus-like particles expressed inEscherichia coli. Biotechnol. Appl. Biochem.29:31–43. 5. Busso, N., S. K. Masur, D. Lazega, S. Waxman, and L. Ossowski.1994. Induction of cell migration by pro-urokinase binding to its receptor: possible mechanism for signal transduction in human epithelial cells. J. Cell Biol. 126:259–270.
6. Caruso, M., L. Belloni, O. Sthandier, P. Amati, and M. I. Garcia.2003.␣41 integrin acts as a cell receptor for murine polyomavirus at the postattach-ment level. J. Virol.77:3913–3921.
7. Chapman, H. A.1997. Plasminogen activators, integrins, and the coordinated regulation of cell adhesion and migration. Curr. Opin. Cell Biol.9:714–724. 8. Chen, M. H., and T. Benjamin.Roles of N-glycans with alpha2, 6 as well as alpha2, 3 linked sialic acid in infection by polyoma virus. Virology233:440– 442.
9. Chiaradonna, F., L. Fontana, C. Iavarone, M. V. Carriero, G. Scholz, M. V. Barone, and M. P. Stoppelli.1999. Urokinase receptor-dependent and -in-dependent p56/59(hck) activation state is a molecular switch between my-elomonocytic cell motility and adherence. EMBO J.18:3013–3023. 10. Crowley, C. W., R. L. Cohen, B. K. Lucas, G. Liu, M. A. Shuman, and A. D.
Levinson.1993. Prevention of metastasis by inhibition of the urokinase receptor. Proc. Natl. Acad. Sci. USA90:5021–5025.
11. Czekay, R. P., T. A. Kuemmel, R. A. Orlando, and M. G. Farquhar.2001. Direct binding of occupied urokinase receptor (uPAR) to LDL receptor-related protein is required for endocytosis of uPAR and regulation of cell surface urokinase activity. Mol. Biol. Cell12:1467–1479.
12. Drapkin, P. T., C. R. O’Riordan, S. M. Yi, J. A. Chiorini, J. Cardella, J. Zabner, and M. J. Welsh.2000. Targeting the urokinase plasminogen acti-vator receptor enhances gene transfer to human airway epithelia. J. Clin. Investig.105:589–596.
13. Estreicher, A., J. Muhlhauser, J. L. Carpentier, L. Orci, and J. D. Vassalli. 1990. The receptor for urokinase type plasminogen activator polarizes ex-pression of the protease to the leading edge of migrating monocytes and promotes degradation of enzyme inhibitor complexes. J. Cell Biol.111:783– 792.
14. Fazioli, F., M. Resnati, N. Sidenius, Y. Higashimoto, E. Appella, and F. Blasi.1997. A urokinase-sensitive region of the human urokinase receptor is responsible for its chemotactic activity. EMBO J.16:7279–7286.
15. Fibbi, G., M. Ziche, L. Morbidelli, L. Magnelli, and M. Del Rosso.1988. Interaction of urokinase with specific receptors stimulates mobilization of bovine adrenal capillary endothelial cells. Exp. Cell Res.179:385–395. 16. Forstova, J., N. Krauzewicz, V. Sandig, J. Elliott, Z. Palkova, M. Strauss,
and B. E. Griffin.1995. Polyoma virus pseudocapsids as efficient carriers of heterologous DNA into mammalian cells. Hum. Gene Ther.6:297–306. 17. Freund, R., A. Calderone, C. J. Dawe, and T. L. Benjamin.1991.
Polyoma-virus tumor induction in mice: effects of polymorphisms of VP1 and large T antigen. J. Virol.65:335–341.
18. Fried, H., L. D. Cahan, and J. C. Paulson.1981. Polyoma virus recognizes specific sialyligosaccharide receptors on host cells. Virology109:188–192. 19. Gilbert, J. M., and T. L. Benjamin.2000. Early steps of polyomavirus entry
into cells. J. Virol.74:8582–8588.
20. Gillock, E. T., S. Rottinghaus, D. Chang, X. Cai, S. A. Smiley, K. An, and R. A. Consigli.1997. Polyomavirus major capsid protein VP1 is capable of packaging cellular DNA when expressed in the baculovirus system. J. Virol. 71:2857–2865.
21. Gleiter, S., and H. Lilie.2001. Coupling of antibodies via protein Z on modified polyoma virus-like particles. Protein Sci.10:434–444.
22. Gleiter, S., K. Stubenrauch, and H. Lilie.1999. Changing the surface of a virus shell fusion of an enzyme to polyoma VP1. Protein Sci.8:2562–2569. 23. Gollan, T. J., and M. R. Green.2002. Selective targeting and inducible destruction of human cancer cells by retroviruses with envelope proteins bearing short peptide ligands. J. Virol.76:3564–3569.
24. Goodson, R. J., M. V. Doyle, S. E. Kaufman, and S. Rosenberg.1994. High-affinity urokinase receptor antagonists identified with bacteriophage peptide display. Proc. Natl. Acad. Sci. USA91:7129–7133.
25. Griffiths, J. C., S. J. Harris, G. T. Layton, E. L. Berrie, T. J. French, N. R. Burns, S. E. Adams, and A. J. Kingsman.1993. Hybrid human immunode-ficiency virus Gag particles as an antigen carrier system: induction of
cyto-toxic T-cell and humoral responses by a Gag:V3 fusion. J. Virol.67:3191– 3198.
26. Gross, T. J., R. H. Simon, and R. G. Sitrin.1990. Expression of urokinase-type plasminogen activator by rat pulmonary alveolar epithelial cells. Am. J. Respir. Cell Mol. Biol.3:449–456.
27. Gudewicz, P. W., and N. Gilboa.1987. Human urokinase-type plasminogen activator stimulates chemotaxis of human neutrophils. Biochem. Biophys. Res. Commun.147:1176–1181.
28. Gyetko, M. R., R. F. Todd III, C. C. Wilkinson, and R. G. Sitrin.1994. The urokinase receptor is required for human monocyte chemotaxis in vitro. J. Clin. Investig.93:1380–1387.
29. Hearing, V. J., L. W. Law, A. Corti, E. Appella, and F. Blasi.1988. Modu-lation of metastatic potential by cell surface urokinase of murine melanoma cells. Cancer Res.48:1270–1278.
30. Hollas, W., N. Hoosein, L. W. Chung, A. Mazar, J. Henkin, K. Kariko, E. S. Barnathan, and D. Boyd.1992. Expression of urokinase and its receptor in invasive and non-invasive prostate cancer cell lines. Thromb. Haemost.68: 662–666.
31. Hoosein, N. M., D. D. Boyd, W. J. Hollas, A. Mazar, J. Henkin, and L. W. Chung.1991. Involvement of urokinase and its receptor in the invasiveness of human prostatic carcinoma cell lines. Cancer Commun.3:255–264. 32. Jankun, J., H. W. Merrick, and P. J. Goldblatt.1993. Expression and
local-ization of elements of the plasminogen activation system in benign breast disease and breast cancers. J. Cell. Biochem.53:135–144.
33. Kobayashi, H., H. Ohi, H. Shinohara, M. Sugimura, T. Fujii, T. Terao, M. Schmitt, L. Goretzki, N. Chucholowski, and F. Janicke.1993. Saturation of tumour cell surface receptors for urokinase-type plasminogen activator by amino-terminal fragment and subsequent effect on reconstituted basement membranes invasion. Br. J. Cancer67:537–544.
34. Krasnykh, V., I. Dmitriev, G. Mikheeva, C. R. Miller, N. Belousova, and D. T. Curiel.1998. Characterization of an adenovirus vector containing a heterologous peptide epitope in the HI loop of the fiber knob. J. Virol. 72:1844–1852.
35. Landgraf, R., M. Pegram, D. J. Slamon, and D. Eisenberg.1998. Cytotoxicity and specificity of directed toxins composed of diphtheria toxin and the EGF-like domain of heregulin beta1. Biochemistry37:3220–3228. 36. Liddington, R. C., Y. Yan, J. Moulai, R. Sahli, T. L. Benjamin, and S. C.
Harrison.1991. Structure of simian virus 40 at 3.8-A resolution. Nature 354:278–284.
37. Liu, W. J., X. S. Liu, K. N. Zhao, G. R. Leggatt, and I. H. Frazer.2000. Papillomavirus virus-like particles for the delivery of multiple cytotoxic T cell epitopes. Virology273:374–382.
38. Magnusson, M. K., S. S. Hong, P. Henning, P. Boulanger, and L. Lindholm. 2002. Genetic retargeting of adenovirus vectors: functionality of targeting ligands and their influence on virus viability. J. Gene Med.4:356–370. 39. Mezes, B., and P. Amati.1994. Mutations of polyomavirus VP1 allow in vitro
growth in undifferentiated cells and modify in vivo tissue replication speci-ficity. J. Virol.68:1196–1199.
40. Miyazaki, M., N. Lamharzi, A. V. Schally, G. Halmos, K. Szepeshazi, K. Groot, and R. Z. Cai.1998. Inhibition of growth of MDA-MB-231 human breast cancer xenografts in nude mice by bombesin/gastrin-releasing peptide (GRP) antagonists RC-3940-II and RC-3095. Eur. J. Cancer34:710–717. 41. Muller, M., J. Zhou, T. D. Reed, C. Rittmuller, A. Burger, J. Gabelsberger,
J. Braspenning, and L. Gissmann.1997. Chimeric papillomavirus-like par-ticles. Virology234:93–111.
42. Nusrat, A. R., and H. A. Chapman, Jr.1991. An autocrine role for urokinase in phorbol ester-mediated differentiation of myeloid cell lines. J. Clin. In-vestig.87:1091–1097.
43. Ossowski, L.1988. In vivo invasion of modified chorioallantoic membrane by tumor cells: the role of cell surface-bound urokinase. J. Cell Biol.107:2437– 2445.
44. Pansky, A., F. Peng, M. Eberhard, L. Baselgia, W. Siegrist, J. B. Baumann, A. N. Eberle, C. Beglinger, and P. Hildebrand.1997. Identification of func-tional GRP-preferring bombesin receptors on human melanoma cells. Eur. J. Clin. Investig.27:69–76.
45. Peng, S., I. H. Frazer, G. J. Fernando, and J. Zhou.1998. Papillomavirus virus-like particles can deliver defined CTL epitopes to the MHC class I pathway. Virology240:147–157.
46. Pepper, M. S., A. P. Sappino, R. Stocklin, R. Montesano, L. Orci, and J. D. Vassalli.1993. Upregulation of urokinase receptor expression on migrating endothelial cells. J. Cell Biol.122:673–684.
47. Picone, R., E. L. Kajtaniak, L. S. Nielsen, N. Behrendt, M. R. Mastronicola, M. V. Cubellis, M. P. Stoppelli, S. Pedersen, K. Dano, and F. Blasi.1989. Regulation of urokinase receptors in monocytelike U937 cells by phorbol ester phorbol myristate acetate. J. Cell Biol.108:693–702.
48. Plesner, T., M. Ploug, V. Ellis, E. Ronne, G. Hoyer-Hansen, M. Wittrup, T. L. Pedersen, T. Tscherning, K. Dano, and N. E. Hansen.1994. The receptor for urokinase-type plasminogen activator and urokinase is translo-cated from two distinct intracellular compartments to the plasma membrane on stimulation of human neutrophils. Blood83:808–815.
49. Plowman, G. D., J. M. Culouscou, G. S. Whitney, J. M. Green, G. W. Carlton, L. Foy, M. G. Neubauer, and M. Shoyab.1993. Ligand-specific activation of
on November 8, 2019 by guest
http://jvi.asm.org/
HER4/p180erbB4, a fourth member of the epidermal growth factor receptor family. Proc. Natl. Acad. Sci. USA90:1746–1750.
50. Rajagopal, V., and R. J. Kreitman.2000. Recombinant toxins that bind to the urokinase receptor are cytotoxic without requiring binding to the al-pha(2)-macroglobulin receptor. J. Biol. Chem.275:7566–7573.
51. Rayment, I., T. S. Baker, D. L. Caspar, and W. T. Murakami.1982. Polyoma virus capsid structure at 22.5 A resolution. Nature295:110–115.
52. Resnati, M., M. Guttinger, S. Valcamonica, N. Sidenius, F. Blasi, and F. Fazioli.1996. Proteolytic cleavage of the urokinase receptor substitutes for the agonist-induced chemotactic effect. EMBO J.15:1572–1582.
53. Ricci, L., R. Maione, C. Passananti, A. Felsani, and P. Amati.1992. Muta-tions in the VP1 coding region of polyomavirus determine differentiating stage specificity. J. Virol.66:7153–7158.
54. Richterova, Z., D. Liebl, M. Horak, Z. Palkova, J. Stokrova, P. Hozak, J. Korb, and J. Forstova.2001. Caveolae are involved in the trafficking of mouse polyomavirus virions and artificial VP1 pseudocapsids toward cell nuclei. J. Virol.75:10880–10891.
55. Salunke, D. M., D. L. Caspar, and R. L. Garcea.1986. Self-assembly of purified polyomavirus capsid protein VP1. Cell.46:895–904.
56. Salunke, D. M., D. L. Caspar, and R. L. Garcea.1989. Polymorphism in the assembly of polyomavirus capsid protein VP1. Biophys. J.56:887–900. 57. Schmidt, U., R. Rudolph, and G. Bohm.2001. Binding of external ligands
onto an engineered virus capsid. Protein Eng.14:769–774.
58. Stehle, T., and S. C. Harrison.1996. Crystal structures of murine polyoma-virus in complex with straight-chain and branched-chain sialyloligosaccha-ride receptor fragments. Structure4:183–194.
59. Stehle, T., and S. C. Harrison.1997. High-resolution structure of a poly-omavirus VP1-oligosaccharide complex: implications for assembly and re-ceptor binding. EMBO J.16:5139–5148.
60. Stehle, T., Y. Yan, T. L. Benjamin, and S. C. Harrison.1994. Structure of murine polyomavirus complexed with an oligosaccharide receptor fragment. Nature369:160–163.
61. Stoppelli, M. P., A. Corti, A. Soffientini, G. Cassani, F. Blasi, and R. K. Assoian.1985. Differentiation-enhanced binding of the amino-terminal frag-ment of human urokinase plasminogen activator to a specific receptor on U937 monocytes. Proc. Natl. Acad. Sci. USA82:4939–4943.
62. Stubenrauch, K., S. Gleiter, U. Brinkmann, R. Rudolph, and H. Lilie.2001. Conjugation of an antibody Fv fragment to a virus coat protein: cell-specific targeting of recombinant polyoma-virus-like particles. Biochem. J.356:867– 873.
63. Testa, J. E., and J. P. Quigley.1990. The role of urokinase-type plasminogen activator in aggressive tumor cell behavior. Cancer Metastasis Rev.9:353– 367.
64. Thorne, H. V., W. House, and A. L. Kisch.1965. Electrophoretic properties and purification of large and small plaque-forming strains of polyoma virus. Virology27:37–43.
65. Tindle, R. W., K. Herd, P. Londono, G. J. Fernando, S. N. Chatfield, K. Malcolm, and G. Dougan.1994. Chimeric hepatitis B core antigen particles containing B- and Th-epitopes of human papillomavirus type 16 E7 protein induce specific antibody and T-helper responses in immunised mice. Virol-ogy200:547–557.
66. Wei, Y., D. A. Waltz, N. Rao, R. J. Drummond, S. Rosenberg, and H. A. Chapman.1994. Identification of the urokinase receptor as an adhesion receptor for vitronectin. J. Biol. Chem.269:32380–32388.
67. Yano, T., J. Pinski, K. Groot, and A. V. Schally.1992. Stimulation by bomb-esin and inhibition by bombbomb-esin/gastrin-releasing peptide antagonist RC-3095 of growth of human breast cancer cell lines. Cancer Res.52:4545–4547.
on November 8, 2019 by guest
http://jvi.asm.org/
