Site-specific mutations in vectors that express antigenic and temperature-sensitive phenotypes of the M gene of vesicular stomatitis virus.

Copyright ©)1988, AmericanSocietyfor Microbiology

Site-Specific Mutations in

Vectors

That

Express

Antigenic

and

Temperature-Sensitive Phenotypes of

the

M

Gene

of

Vesicular

Stomatitis

Virus

YAN LI, LIZHONG LUO, RUTH M. SNYDER, AND ROBERTR. WAGNER*

Department of Microbiology andCancer Center, UniversityofVirginia School ofMedicine, Charlottesville, Virginia 22908

Received 25 April 1988/Accepted 1July 1988

Full-lengthcDNAcopies of mRNAs coding for the matrix (M) proteins ofvesicular stomatitis virusandits mutantts023(III)werecloned inpBSM13- (BlueScribe). Theauthenticity ofthese cloneswasdemonstrated

by restrictionenzymemapping,DNA sequencing, and in vitro transcription and translationtoidentify thetwo M proteins by Western immunoblotting with epitope-specific monoclonal antibodies. Site-directed mutants

wereconstructedbyprimerextension of synthetic oligodeoxynucleotides withone ortwonucleotide changesto alter theglycineatamino acid21of the wild-type(wt) Mgenetoglutamic acid, alanine, orproline. Similarly,

a revertant wascreated inthe M gene ofmutant ts023 bya Glu-21->Gly substitution. A series ofwt- and mutant-M-gene chimeras was also constructed to create mutant and revertant clones with Leu-*Phe and His--Tyr alterationsatamino acids 111 and 227, respectively. We then movedthewtand ts023 Mgenesand

their site-specific mutants and chimeras cloned in pBSM13- into the eucaryotic expression vector pTF7 directedby the T7 bacteriophage RNA polymerase of the vaccinia virus recombinant vTF1-6,2. Western blot analysisof the Mproteins transientlyexpressed inCV-1cells byplasmids carrying M genesalteredatamino acid 21 revealed thatthe critical antigenicdeterminant (epitope 1) is expressed only by the Gly-21 M protein and notby Glu-21, Ala-21,orPro-21Mproteins. Of particularinterest isanapparentconformational change,

evidenced by slightly but significantly retarded electrophoretic migration, in plasmid-expressed M proteins

with amino acids substituted for glycine at position 21. The glutamic acid at position 21 of tsO23 is not responsible for its temperature-sensitivephenotype, becauseatsO23revertantplasmid with glycine substituted atposition 21 failstorescuetsO23 virus incells infected atthe restrictivetemperature; conversely,plasmids

expressing wt M protein with substitutions ofglutamic acid, alanine, orproline at position 21 arejust as

effective in markerrescue oftsO23 asis theGly-21 wtMprotein. Markerrescue experimentswith wt- and

mutant-M-gene chimerassupportthe hypothesisofK.Morita,R.Vanderoef,andJ.Lenard (J.Virol.

61:256-263, 1987) thatthetemperature-sensitive phenotypeof tsO23is duetoaphenylalaninesubstituted for leucine

at amino acid 111, rather than the His-227-*Tyr substitution or the Gly-21--*Glu substitution, which

independentlyaccountsfor the loss of epitope 1inthemutantMprotein oftsO23. Vectors expressinggreater amounts of M protein are necessary to locate the region of the tsO23 M gene responsible for loss of the

transcription inhibitionphenotype.

Thematrix(M)protein of vesicular stomatitisvirus(VSV) plays importantroles in virusassembly(22, 27, 28) and down regulation of viral transcription (2, 4, 29). Monoclonal

anti-body (MAb) directed to oneof four antigenic determinants

(epitope 1) specificallyreversestranscription inhibition byM

protein (17).EnzymaticandchemicalcleavagesofMprotein localized much ofthetranscriptioninhibitionactivitywithin thefirst43 N-terminal amino acidsandepitope1 inaregion

between amino acids 18 and 43(15). Studies with synthetic oligopeptides corresponding to M-protein amino acid se-quences indicate that epitope 1 is located between amino acids 17 through 31, whereas the

transcription-inhibitory

activity is located, at least partially, within the first 20

N-terminal amino acids (24).

Ofconsiderable interest are

early

studies which indicate

thatvarious temperature-sensitive mutantsof VSV in

com-plementation group IIIcontain M protein which exhibits a

nonconditional loss in the phenotypefor inhibition of VSV

transcription (2, 29). Moritaetal.(14)have

sequenced

some

of these mutants and many revertants

by

primer

cDNA extension and found spontaneous nucleotidechanges leading

*Correspondingauthor.

to amino acid substitutions widely distributed throughout 60% ofthe Mgene. Ofparticularinterest to usis the group III mutant ts023, the M protein of which completely loses both epitope 1 and its transcription inhibition activity (17).

The M gene ofmutant ts023 has been foundtodiffer from thatof the wild type (wt)(Orsay strain) bythreenucleotide changes leading to three amino acid

substitutions,

as fol-lows:

Gly-*Glu

atposition 21,Leu->Pheat

position

111,and

His--Tyr at position 227 (14). We have confirmed the

Gly-21-->Glu

substitutionbydirect amino acid

sequencing

of

wt andts023 Mproteins (J. B. Shipley and R. R. Wagner, unpublished data). Moreover, substitution of

glutamic

acid for

glycine

at

position

21 in a

synthetic pentadecapeptide

corresponding

to

M-protein

amino acids 17

through

31 was found to have lost its antigenic specificity and its

unique

,B-bend structure(24).

Thecurrent experiments representanattempt to

identify

thespecificnucleotidechangesin theMgeneand amino acid substitutions in theM

protein

ofwtVSV

(Orsay

strain)

that resultinconversionto the

temperature-sensitive

phenotype

orthelossofan

antigenic

determinant inthe mutanttsO23.

Theseexperiments were

performed by

molecular

cloning

of

full-lengthcDNA

copies

of the entire

coding region

for the M

3729

on November 10, 2019 by guest

http://jvi.asm.org/

proteins

of wt Orsay VSV and mutant ts023 in

pBSM13-and by introducing site-directed mutations and wt-mutant chimeras intothese clones. The wt, ts mutant, chimeras, and

site-specific mutant clones were transferred to the vaccinia

virus T7-polymerase vector of Fuerst et al. (6) and tran-siently expressed in CV-1 cells by previously

described

methods (11).

MATERIALS AND METHODS

Cells, viruses, and plasmids. wt VSV (Orsay strain,

Indi-anaserotype) and the temperature-sensitive Orsay group III

mutant tsO23 were kindly provided by A. Flamand,

Faculte

des Sciences, Universite de Paris-Sud, Orsay, France. All stockswereplaque purified. Viruses were grown in BHK-21 cells and isolated and purified as described previously (17,

18). Purified virions were stored at -70°Cuntil further use.

Recombinant vaccinia virus vTF1-6,2 that expresses T7 RNApolymeraseandvaccinia expression vectorpTF7IHB1 were both designed by Fuerst et al. (6) and kindly provided

by

B. Moss. Plasmid pBSM13- (BlueScribe M13-) was obtained from Stratagene Cloning Systems, San Diego,

Calif.).

Preparation of VSV Orsay wt and tsO23 mutant mRNA.

VSVmRNAs were synthesizedby in vitro transcription in a 20-ml reaction mixture exactly as described by Rose and

Gallione (20). After virion transcription for 3 h, the reaction

was stopped by addition of sodium dodecyl sulfate (SDS) andsodium acetate to final concentrations of1%and 0.5 M,

respectively. Theentire mixture was then passed through a column containing 0.25 g of oligo(dT)-cellulose (type 3;

CollaborativeResearch, Inc., Waltham, Mass.); the column

was then washed with 15 ml of 0.4 M sodium acetate. The

bound polyadenylated mRNA was eluted with distilled wa-ter, precipitated withethanol, dissolved in H20, and stored at -80°C.Approximately 250,ug of mRNA was obtained for each reaction.

Synthesis and cloning of cDNA. Reverse transcription of cDNAs from wt VSV Orsay and tsO23 mutant RNA was

performed

by usingacDNA synthesis kit (Amersham Corp.,

Arlington Heights, Ill.), exactly following the manufactur-er'sprotocol, except that 10

pLg

of mRNA was heated at

70°C

for 1 min and rapidly chilled on ice prior to cDNA synthesis. After transcribing the first and second strand, the

double-stranded cDNA was purified by phenol-chloroform (1:1),

ethanolprecipitated, and then subjected to 1.5% agarose gel

electrophoresis. A cDNA band which is similar in size to that expected forMand NS mRNA was isolated by

electro-blotting onto NA-45 DEAE membranes (Schleicher &

Schuell, Inc., Keene, N.H.).

Plasmid vector pBSM13- was digested to completion

withSmaIanddephosphorylated withcalf intestinal alkaline

phosphatase.

The purified M and NS cDNAs (which have blunt ends) were ligated to the SmaI site of pBSM13- at

26°C for 4 h and used to transform competent Escherichia coli JM109 cells (9). The transformed cells were plated on LBmedium containing 100 ,ug of ampicillin per ml, 40

,g

of X-Gal

(5-bromo-4-chloro-3-indolyl-3-D-galactopyranoside)

per ml, and 1 mM IPTG

(isopropyl-p-D-thiogalactopy-ranoside). The colonies containing the desired recombinant

plasmid were identified by the method of Grunstein and

Hogness (7). Theplasmids were prepared from the isolated colonies by a rapid isolation procedure and analyzed for their size, partial restriction maps, and orientation of in-serted DNA (13).

Site-directedmutagenesis. Theprocedure described in the

Stratagene kit was used to prepare single-stranded DNA

isolated from E. coli

JM101

cells containing

pBSM13-plasmids withwtM or

ts023

McDNAinserts after infection

with helper bacteriophage R408. Site-specific mutations

were produced by in vitro primer extension of

complemen-tary synthetic oligodeoxynucleotides with

single-base

sub-stitutions by usingthe protocol described in the Amersham

kit with the following modifications. (i) Primer

oligodeoxy-nucleotide (6pmol) washybridizedto5

,ug

of

single-stranded

templateDNA in a total volumeof34

,ul.

(ii) Digestion with exonuclease III was performed at

37°C

for5

min,

instead of

30

min.

(iii)Afterligation ofDNA gaps, 3,ul ofeach reaction

mixture was used to transform competent

JM109

cells.

Screening mutant M-gene clones. Certain mutant

plasmid

clones(created byprimer extension) were directly identified

by

PvuI

restriction mapping ofDNA isolated from

JM109

mini-preps; these twooligonucleotideprimerswere

designed

to createthe new

PvuI

restriction site. For screening other mutantclones, colonies ofeach werepicked and then grown overnight at

37°C

in 5 ml ofLB medium containing 50 p.g of ampicillin per ml without IPTG. Cells from overnight cul-tures were lysed in a buffer containing 2% SDS, 62.5 mM

Tris hydrochloride (pH 6.8), 10% glycerol,5% mercaptoeth-anol, and 0.01% bromphenol blue and heated at

100°C

for 3

min.

The contents were then applied to 12.5%

polyacryl-amide-SDS gels (10). After separation, the proteins were

transferred by electroblotting to nitrocellulose sheets (26) andvisualizedby binding the indicated monoclonalantibody

and then

125I-labeled

staphylococcal protein A, followed by

autoradiography (18). All single-base mutants had the ex-pected mutations verified by DNA sequencing.

Subcloning into vaccinia virus transient-expression system and immunoblot analysis. cDNA inserts of wt,

ts023,

and their corresponding mutated M genes were excised from pBSM13- clones with

BamHI

and

KpnI,

blunt-ended with Klenow polymerase and T4 DNA polymerase, and recloned into the

BamHI

site of the vaccinia virus expression vector pTF7 blunt-ended with Klenow polymerase, as described previously (11). The resulting recombinant plasmids, with the appropriate M cDNA insert in the correct orientation,

were selected by

XbaI

and

BglII

digestions. Transient-expression assays and immunoblot analyses of the synthe-sized M proteins were performed exactly as described by Li et al. (11).

Marker rescue. These experiments were performed as describedby Li et al. (11). Briefly, CV-1 cells were grown to 80% confluence in 35-mm-diameter plates and infected with the VSV

tsO23

mutant at a multiplicity of 1 PFU per cell for 30

min

at room temperature. The inoculum was then re-moved, and 2 ml of minimal essential medium containing5% fetal bovine serum was added to each plate. The infected cells were incubated at

39°C

for 2 h. At 2.5 h after infection, the cells were reinfected with vaccinia virus vTF1-6,2 at a multiplicity of 30 PFU per cell at

39°C

for 1 h and then transfected with 15

,ug

of calcium phosphate-precipitated plasmid DNA. The plates were further incubated at

39°C

for 14 h, the medium was harvested, and virus yield was titrated by plaque assay on L-cell monolayers at both 31 and

39°C.

RESULTS

Cloning M genes in pBSM13-. In order to compare the genotypes and phenotypes of wt and mutant VSVM genes, it was necessary to clone them in a vector suitable for their sequencing, expression, and induction of site-specific base changes. For these purposes, we chose pBSM13- (Blue-Scribe), similar to the plasmid designed by Dente et al. (5),

on November 10, 2019 by guest

http://jvi.asm.org/

10 42 48 103 374

pYL-OM79

5'-CACAATCTAAGTGTTATCCCAATCCATTCATCATG---CCC---GGG---TTG---Pro Gly Leu

pYL-tsM23

pYL-OM79 pYL-tsM23

pYL-OM79

5'-GTTATCCCAATCCATTCATCATG---TCC---GAG---TTT---Ser Glu Phe

720 731 778

--CAC---TGAGCTAGTCTAACTTCTAGCTTCTGAACAATCCCCGGTTTACTCAGTCT His

--TAC---TGAGCTAGTCTAACTTCTAGCTTCTGAACAATCCCCGGTTTACTCAGTCT Tyr

779 839

CTCCTAATTCCAGCCTCTCGAACAACTAATATCCTGTCTTTTCTATCCCTATGAAAAAAAA-3

pYL-tsM23 CTCCTAATTCCAGCCTCTCGAACAACTAATATCCTGTCTTTTCTATCCCTATGAAAAAA-3

FIG. 1. Comparative nucleotide sequences of VSV Orsay wt and tsO23 M genes cloned in pYL-OM79 and pYL-tsM23. Only the noncoding sequences are shown for both the wt M gene and for homologous noncoding regions of thetsO23 M gene. The coding sequences of thewtandtsO23 M genes are not shown but were found to be identical to thecorrespondingconsensussequences for the M-gene region ofOrsay wt andts023 virion RNAs reported by Morita et al. (14), except for a C rather than a T at nucleotide 48. Also shown here are nucleotides in the coding region that differ for the cDNAs of the wt and tsO23 M-gene inserts. The nucleotide numbers correspond to the numerical system used by Rose and Gallione (20).

which possesses all these properties. In order to obtain

full-length cDNAcopies of the mRNA that translates com-plete M protein, we produced in vitro VSV transcripts as

described in Materials and Methods. These intact viral mRNAs provided templates for reverse transcriptase

syn-thesis of cDNA, representing the M gene and other VSV genes, as described by Gubler and Hoffman (8) and further

developed byAmersham. Aftersecond-strand DNA

synthe-sisand treatment withT4 polymerase to remove any small

remaining 3' overhangs, the blunt-ended, double-stranded DNAs were subjected to electrophoresis on 1.5% agarose

gelstodetermine their sizes.

The M and NS DNAs were isolated by electroblotting

onto NA-45 DEAE membranes and inserted into the SmaI site ofpBSM13-. E.coli JM109 cells were thentransformed

withthese pBSM13-recombinants, and ampicillin-resistant white colonies were selected for analysis by colony

hybrid-ization. The plasmid DNAs from these hybridization-posi-tiveE. coli colonies were analyzed for size and orientation by BamHI and KpnI excision and then by XbaI andBglII partial restriction mapping. By comparing these restriction

maps with previous data (14, 20), we were able to assign

each recombinant cloneunambiguously to either theOrsay wt M gene orthe mutant tsO23 M gene (data not shown).

Subsequent research was performed with one clone each

from the wt M-gene or tsO23 M-gene pBSM13- recombi-nantsdesignated,respectively,pYL-OM79 and pYL-tsM23. Nucleotide sequence and expression ofMgenes in E. coli. Thenucleotide sequencesofwtand tsO23 M genes inserted inplasmidspYL-OM79 andpYL-tsM23, respectively, were

determined by primerextension and the dideoxy-chain ter-mination method (3, 21). Synthetic

oligodeoxynucleotides

homologous to the T7 and T3 regions ofpBSM13- were

obtained from Stratagene and were used as primers for

sequencing the nucleotides

corresponding

to the 5'- and

3'-noncoding regions of each M gene. In

addition,

four

synthetic

oligodeoxynucleotides homologous

to M-gene nu-cleotide sequences 36 through 50, 195

through

208,

392

through406, and 545through 559,asnumbered

by

Roseand

Gallione (20), were used to sequence the coding regions of the two M genes.

Figure 1 shows the entire noncoding sequences flanking the M-genecoding regions of the wt plasmid pYL-OM79 and themutantplasmidpYL-tsM23,aswellasthosenucleotides

inthecoding region whicharedifferent forthe wt and tsO23

M genes. The wt M-gene DNA inserted in pYL-OM79

consists of 830 nucleotides extending from positions 10 through 839, whereas the tsO23 M-gene DNA inserted in pYL-tsM23 consists of816nucleotides extending from nu-cleotides 22through837,accordingtothenumbering system

ofRose and Gallione (20). Comparison ofthe pYL-OM79 andpYL-tsM23 M-gene sequences reveals three nucleotide

changesin thets023 M genecompared withthe wt M gene,

as follows: G--A at nucleotide 103, leading to a Gly--Glu substitution at amino acid 21; G-T at nucleotide 374,

leadingto aLeu--Phesubstitutionat amino acid 111; anda

C-*T

atnucleotide720,leadingto aHis--Tyrsubstitutionat amino acid227.

These M-gene sequences in pYL-OM79 and pYL-tsM23 are identical to the corresponding consensus sequences

reported by Moritaetal. (14)for therespective M genesof wtVSVOrsay and tsO23 withonlyoneexception. OurwtM genehas aC, rather thanaT, at nucleotide48, as

reported

byMoritaetal.(14),resultingina

Ser-*Pro

changeinamino acid 3;ourtsO23 M gene hasaTat nucleotide48asdidthe tsO23MgenesequencedbyMoritaetal. (14).Five separate clonesofour wtOrsay strainallrevealedaCat

position

48. Thisdifferencein thetwoOrsaywtstrains inour

laboratory

and thatof JohnLenardisattributabletothe

high degree

of

spontaneous mutability of the VSV genome (23, 25). To verify this C--T difference at nucleotide 48 between our sequence and that of Moritaet al.

(14),

we

sequenced

the entire M-gene

region

of VSV

Orsay

wt

genomic

RNA

by

primer extensionas

previously

described for the G gene

(12).

Thesegenomicsequenceresults confirmedlocationofaCat nucleotide48, rather than theTfound

by

Moritaetal.

(14)

for theirOrsay wt strain. In

addition,

the sequencesin the

noncoding

regions

ofour

Orsay

wtandtsO23McDNAsare

on November 10, 2019 by guest

http://jvi.asm.org/

[image:3.612.79.518.70.265.2]

* 11b_

FIG. 2. Westernblotanalysisof wt andts023fusion Mproteins expressed in E. coli cells on reaction with three epitope-specific

MAbs. E.coliJM109cells transformed withplasmidspYL-OM79or

pYL-tsM23 were grown in the presence ofampicillin (50 jig/ml), pelleted, solubilized, and subjected toelectrophoresison a 12.5%

polyacrylamide-SDSslabgel alongwith marker Mprotein(150ng)

extracted from VSV virions. The proteins were transferred to a

nitrocellulose sheet by electroblotting and exposed to individual

MAbs,MAb2(specificforepitope 1),MAb3(specificforepitope 2),

andMAb25(specificforepitope 3). Autoradiographswereprepared

after exposureto 251I-labeled staphylococcal protein A. Lanes: 1, purifiedVSV virion Mprotein;2,extract of cells transformed with

pYL-OM79;3, extract of cells transformed withpYL-tsM23.

thesame asthosereported byRoseandGallione(20)forthe SanJuanstrain Mgenecloned inpM309, exceptfor theeight

and six extraadenylic acids at the respective 3' ends; also, there is an A, rather thanaG, at nucleotide 13.

The sequence data for

pYL-OM79

and pYL-tsM23 also

revealedthat the wt andtsO23 M-geneinsertsarepositioned

in the same readingframeas that of the lacZgene. There-fore, it was possible to express both the wt and tsO23 M genesin

pYL-OM79

andpYL-tsM23 plasmid-transformedE. coliand to detecttherespectiveMproteins bytheir reactiv-itywith MAbs. Figure 2 shows Western blot (immunoblot) autoradiogramsof the Mproteinsof the VSV virion andof M proteins expressedin E. colibypYL-OM79andpYL-tsM23 followingreaction with threeepitope-specificMAbs. The wt

Mprotein expressed bypYL-OM79 wasreadily recognized

byMAbs to all three epitopes, butepitope 1-specific MAb2

failed to react with tsO23 M protein expressed by

pYL-tsM23. This loss ofepitope 1 inthe M proteinoftsO23 was

originallydescribed byPalet al. (17)andwasattributedtoa

Gly-+Glu substitution in amino acid 21 of the mutant M protein. MAb2 (but not MAb3 or MAb25) also reacted nonspecificallywithahigher-molecular-weight proteinin the

pYL-OM79

and pYL-tsM23 expression systems (Fig. 2), which was also present in extracts of E. coli cells trans-formed with control pBSM13- not containing any M gene (data not shown). The slower migration of the fusion M proteinisclearlyattributableto its 40additionalaminoacids, which adds -4.8 kilodaltons to its estimated molecular

mass. As noted, the M protein expressed by pYL-tsM23

differed slightly in its mobilityfrom that ofpYL-OM79 M

protein. By far the strongest affinity for both

pYL-OM79-and pYL-tsM23-expressed M proteins was exhibited by epitope 2-specific MAb3, which also reacted with

lower-molecular-weight proteins, presumably cleavage products.

For unknown reasons, the binding of epitope 3-specific

MAb25toMproteins expressed by plasmidspYL-OM79and

pYL-tsM23 was weak in a manner not unlike that of M protein expressed by vaccinia virus vectors in mammalian CV-1 cells(11). Despite theseunexplainedaberrations,these findings provide a convenient meansfor screening the anti-genic determinants of M protein expressed in E. coli

by

clonedgenes with site-directed mutations as recounted be-low.

Construction of M-gene vectors and wt-tsO23 chimeras coding for amino acid substitutions atpositions 21, 111, and 227. It was of interest to determine whether amino acids other than glycine at position 21 of thepBSM13- M-gene

recombinant would affect theantigenic and otherproperties

of the expressed M protein. Predictions made by Brandt-Rauf et al. (1) on the basis of energy minimizationcomputer modeling of the dodecapeptide from Lys-15 to Pro-26 of the M protein revealed marked conformational changes when glutamic acid, alanine, or proline was substituted forglycine

at position 21 of the wt M protein; these amino acid substitutions, leading to altered conformations, could

ex-plain the loss of epitope 1 and transcription-inhibitory activ-ity resulting from the Gly-21-*Glu substitution (17). In order to test some of these predictions, we set out to construct

altered pYL-OM79 and pYL-tsM23 expression vectors by

making site-directed mutations in inserted wt and tsO23 M genes by oligodeoxynucleotide primer extension at the N-terminal regions.

Four synthetic oligonucleotide primers were used to

cre-ate one revertantand three site-directed mutants at nucleo-tides 103 and 102(Fig. 1). The revertant pYL-tsM23(R1)was

created by using primer 5'-GAAATTAGGGATCGCAC CAC-3', which is complementary to the tsO23 M-gene nucleotides 95 through 114 of pYL-tsM23 except for a

mismatch (G for A) at nucleotide 103, resulting in a Gly, ratherthan aGlu, at residue 21. Theprimer 5'-GAAATTA

GAGATCGCACCAC-3', complementary to nucleotides 95 through 114 of thepYL-OM79 M gene except foramismatch (A for G) at nucleotide 103, was used to create mutant pYL-OM79(Glu2l). The primer 5'-GAAATTAGCGATCG

CACCAC-3', complementary topYL-OM79 M gene nucde-otides 95 through 114 except for a C at position 103, was

used to create mutant pYL-OM79(Ala2l). Lastly, mutant pYL-OM79(Pro2l) was created by use of primer

5'-AGAAATTACCGATCGCACCACCCC-3', complementary

topYL-OM79M-genenucleotides94through 117 except for

twomismatchedbasesatnucleotides102and 103, giving rise

to aproline atresidue 21.

These site-directed mutant plasmids constructed by

primer extension werescreened by Western blotting and/or by restriction mappingas described in Materials and Meth-ods. One clone from each Glu-21, Ala-21, and Pro-21

site-directed mutant plasmid and the Glu-21->Gly revertant

plasmid were used fortransient expression in the vaccinia virus vectors.

The question arises whether antigenic and temperature-sensitive phenotypes of the mutant ts023 M protein are affected byits other amino acid substitutions: Leu-*Phe at

position 111 and His->Tyr at position 227, as well as the

Gly--Glu substitution at position 21. For this purpose, we constructedfour chimeras of the M genes of wt and tsO23

viruses,by using a strategy outlined in Fig. 3. The DNAs of the four wt-mutant chimeras and the aforementioned four

site-directed mutants were sequenced and were found to have theexpected nucleotide changes in the correct reading frame.

Transientexpression of wt and mutant M genes cloned in a

vaccinia virus vector. We previously reported (11) ample

on November 10, 2019 by guest

http://jvi.asm.org/

[image:4.612.63.304.75.232.2]

A.

pYL-OM79 Gly

21 Leu111

A A

Bgg Bg \

258 358 pYL-tsM23

Glu Phe

21 1

Bgg BgU 258 358

His 227

stut

652

ConstructChknresi M Tyr

227 _

Stul

652

pYL-OM79 pYL-OM79(Tyr227)

Gly Leu Tyr

21_111

227

pYL-tsM23(R3)

Glu Phe His

21 111 227

- - - %_I _

I

[image:5.612.74.543.76.346.2]

Stul KprI 652

FIG. 3. Construction of wt-ts023 M-gene chimeras pYL-OM79(Phelll), pYL-tsM23(R2), pYL-OM79(Tyr227),and pYL-tsM23(R3). (A) Restrictionfragments,generated byexposureseparately ofpYL-OM79and pYL-tsM23toBglIland StuI,wereseparated by electrophoresis

on 1.5% agarose gels, electroblotted onto DEAE membranes, and purified by phenol-chloroform extraction, followed by ethanol precipitation. Thetwosmall pYL-tsM23 restriction fragments containing the Phe-111 sitewereligated by T4 ligasetothelargepYL-OM79 restrictionfragmentmissing the Leu-111 sitetoform pYL-OM79(Phelll). Conversely, thetwosmallpYL-OM79restriction fragmentswere

religated with T4 ligase to the large BglII-StuI fragment to form plasmid pYL-tsM23(R2) with a Leu-111 revertant site. (B) Plasmids pYL-OM79and pYL-tsM23werealso separately restricted by StuI andKpnI,and eachwasfractionatedandpurifiedby thesametechniques

before ligating the small pYL-tsM23 restriction fragment to the large pYL-OM79 restriction fragment to form pYL-OM79(Tyr227). Conversely, thesmall StuI-KpnI restriction fragment of pYL-OM79 containing the His-227 site wasreligated withT4ligase to the large pYL-tsM23 restriction fragment toform the revertant pYL-tsM23(R3). The DNAs ofall resulting chimeric plasmids were sequenced to

confirmthevalidity of each of the fourconstructsthatwereselected forexperimentation.Themulticloning sites of pBSM13- (- )are

shown.

expression of authentic, unfused M proteins by M genes

cloned in the pTF7 plasmid in cells coinfected with the

vaccinia virusrecombinant vTF1-6,2 described by Fuerstet al. (6). By methods previously described (11), the M-gene

sequences in pYL-OM79 (wt), pYL-tsM23 (tsO23 mutant),

and the four site-directed revertants or mutants pYL-tsM23(R1), pYL-OM79(Glu21), pYL-OM79(Ala2l), and

pYL-OM79(Pro2l), as well as the chimeric plasmids

pYL-OM79(Phelll), pYL-OM79(Tyr227), pYL-tsM23(R2), and

pYL-tsM23(R3), were recloned into the BamHI site of

pTF7IHB1flankedby the 410promoterandT4X terminator.

These M-gene plasmids are designated pTF7-OM79(wt),

pTF7-tsM23(tsO23), pTF7-tsM23(R1), pTF7-OM79(Glu21), pTF7-OM79(Ala21), pTF7-OM79(Pro21), pTF7-OM79(Phe-111), pTF7-OM79(Tyr227), pTF7-tsM23(R2), and pTF7-tsM23(R3), correspondingtothepYL plasmids. Under

con-ditions previously established (11), wt and mutant M pro-teins were synthesized in vTF1-6,2-infected and

plasmid-cotransfected CV-1 cells and detected by Western blotting

withM-proteinepitope-specific MAbs.

Figure 4 illustrates the Western blot autoradiograms of pTF7plasmid-expressedwt, mutant,revertant,andchimeric M proteins after exposure to MAbs specific for epitope 1 (Fig.4A andC)orepitope2(Fig.4B andD).Theclonedwt

protein expressed bypTF7-OM79 (Fig. 4A and B, lanes 5)

exhibited exactly the same electrophoretic mobility as did

the authentic virion 26-kilodalton M protein used as the

marker (lanes 1). wt Gly-21 M protein expressed by pTF7-OM79 (Fig. 4A,lane5)reactedwithepitope1-specificMAb2 but the tsO23 Glu-21 M protein expressed by pTF7-tsM23

did not(lane 2), injust thesame manner as the M proteins

presentinwtandtsO23virions(17). Similarly,theMprotein expressed by pTF7-OM79(Glu2l), with its Gly-21--Glu

amino acid substitution, failed to react with MAb2 but

stronglyreacted withMAb3(Fig.4AandB,lanes4).These

Glu-21-*Gly andGly-21---Glu substitutions clearly reaffirm theevidence thatglycine21 determines theantigenic speci-ficityofepitope 1,rather than leucine 111orhistidine227 of wtMprotein,whichalsoundergoaminoacid substitutions in the Mprotein oftsO23 (14).

We also tested pTF7-OM79(Ala2l) and pTF7-OM79

(Pro2l) for the capacity of their expressed M proteins to react with MAb2 (epitope 1) and MAb3 (epitope 2). These site-directed mutations in the wt M gene (Gly-21->Ala and Gly-21--Pro)were prompted bythe studies ofBrandt-Rauf et al. (1), who predicted, on the basis of computerized

minimal energy conformation, that alanine at position 21 shouldprovideaconformationsimilar to that of thetsO23M

pYL-OM79(Phe1

11)

Gly 21

B.

Phe

1.-i

Leu

11l pYL-tsM23(R2)

GkI 21

His 227

Tyr 227

I

on November 10, 2019 by guest

http://jvi.asm.org/

3734 LI ET AL.

/ j *

/i

1 2 3 4 5 6 7 8 9

A. MAb2 ( Epitope 1 )

1 2 3 4 5 6 7 8 9

1 2 3 4 5 6 7

MM

t

Am- d

C. MAb2 ( Epitope 1 )

1 2 3 4 6 6 7 8

B. MAb3 ( Epitope 2

)

D. MAb3 ( Epitope 2

)

FIG. 4. Western blot analysis of M proteins transiently expressed in CV-1 cells transfected with T7 polymerase-directed plasmid

recombinants ofMgenesfromwt, tsO23, site-directed mutants,andchimericplasmids.CV-1 cellswereinfected with 30 PFU ofvTF1-6,2

(recombinant vaccinia virus expressingT7 RNApolymerase)percell and transfectedwith 15,ugof eachplasmid,asindicated. Cellsincubated at37°Cwerelysed24 hafterinfection; thelysatesweresubjectedtoelectrophoresison12.5%polyacrylamide-SDSslabgelsandtransferred tonitrocellulose sheetsbyelectroblotting.InpanelsAandC,Mproteinswerereactedwith MAb2(specificforepitope 1),and inpanelsB and D, M proteins were reacted with MAb3 (specific for epitope 2) before exposure to 125I-labeled staphylococcal protein A and autoradiography. Lanes 1containpurifiedVSV(SanJuanstrain)virionMprotein (arrow). (AandB)Lanes 2through8were loadedwith extractsof cells transfected withwtortsO23plasmids withorwithoutsite-directedmutations,asindicated.(CandD)Lanes 2through8were

loaded withextractsof cells transfected withwtorts023plasmids,orwt-mutantchimeras,asindicated. Theplasmid pTF7-M3showninlane 8(A and B)referstotheVSV IndianawtM-geneconstructaspreviouslydescribed (11).

proteinwithglutamic acidatposition21. On the otherhand,

it was also predicted that proline at position 21 should

provide a global minimumconformation notat all like that for the Glu-21 or Ala-21 peptides but somewhat more like

that of the wt Gly-21 peptide, atleast to some degree (1).

Figure 4A reveals that neither alanine (lane 6) nor proline (lane 7)substitutedfor glycine atposition21wascapable of

restoring epitope 1 to wt M protein expressed by pTF7-OM79(Ala2l) orpTF7-OM79(Pro2l), both of which reacted

strongly with MAb3 (Fig. 4B), assuring the presence of epitope 2 in the M protein. It appears, therefore, that the presenceof glycineat position 21 is essential for conferring

on M protein the conformation required for expressing epitope 1.

Ofconsiderable interest inFig. 4Bwasthe consistentand

reproducible findingthat expressed mutantM proteins with

glutamic acidatposition 21 always migrated slightly slower thanGly-21 wtMprotein(comparelanes 2 and 4 with lanes

1, 3, and 5 in Fig. 4B). Not only the ts023 M protein

expressed by pTF7-tsM23 but also the Gly-21--Glu

substi-tution in wt M protein expressed by pTF7-OM79(Glu2l) exhibited the slower mobility, indicating that the hindered

migration was not due to amino acid substitutions Leu-111->Phe or His-227-*Tyr in the tsO23 M protein. More-over, the site-directed Glu-21-*Gly revertant

pTF7-tsM23(R1) resulted in expression of an M protein that

migrated identically to that of wt Orsay or San Juan M

protein (comparelanes3, 5,and 8 inFig. 4B). It should also be noted that these plasmid-expressed M proteins contain the identical number of amino acidsand, hence,should have the same molecular weight. Of further interest is the evi-dence that the site-directed mutant plasmids pTF7-OM79(Ala2l)andpTF7-OM79(Pro2l),identical in molecular sizeto pTF7-OM79(Glu2l), expressed M proteins that

mi-gratedtoapositionsomewhatintermediatetothat of thewt M protein of pTF7-OM79 and mutant Glu-21 M protein (comparelanes4, 5, 6,and 7 inFig. 4B).These datastrongly

suggest that the presence ofglutamic acid in position 21,

rather thanglycine, alanine,orproline, results in retardation

ofM-protein electrophoretic migration. This retarded

migra-tion of the Glu-21 M protein could be due to the negative charge ofglutamic acid. An alternative explanation for the

retardedmigrationof theGlu-21 M protein is altered confor-mation, predicted by Brandt-Raufetal. (1) tobe anot-helix

intheregionof the Glu-21peptide,a 3-bend in the region of

theGly-21 peptide,andana-helixdisruption in the region of a Pro-21 peptide. However, they also predict an Ala-21

peptidestructuresimilartothatof the Glu-21peptide, which

isnotconsistent with the migration ofthe Ala-21Mprotein

faster than that of the Glu-21 mutantMprotein. Completely

8

almoks- ..am

400

J. VIROL.

AN

'~

,

0

on November 10, 2019 by guest

http://jvi.asm.org/

[image:6.612.119.506.72.375.2]

[image:7.612.60.561.95.274.2]

TABLE 1. Comparativerescueof M-proteinmutant ts023bytransfecting plasmidsexpressingsite-mutated Mgenes or wt-mutant chimeric M genes with different amino acidsubstitutionsa

Expressed M gene and Yield of virus (PFU/ml) Amino acid atpositionb

transfecting plasmid 310C 39°C 21 111 227

Site-mutated M genes

None 5.0 x 102 <101

pTF7-tsM23 3.2 x 102 1.0 x 102 Glu Phe Tyr

pTF7-tsM23(Rl) 2.0 x 103 <lo Gly Phe Tyr

pTF7-OM79 3.5 x 104 5.0 x 101 Gly Leu His

pTF7-OM79(Glu2l) 3.2 x 104 1.5 X 102 Glu Leu His

pTF7-0M79(Ala2l) 6.7 x 104 1.0 x 102 Ala Leu His

pTF7-OM79(Pro2l) 8.0 x 104 5.0 x 101 Pro Leu His

wt-mutantchimeras

None 6.5 x 103 2.7 x 103

pTF7-tsM23 4.6 x 103 1.1 X 103 Glu Phe Tyr

pTF7-tsM23(R2) 7.8 x 105 2.4 x 103 Glu Leu Tyr

pTF7-tsM23(R3) 7.9 x 103 5.7 x 102 Glu Phe His

pTF7-OM79 8.5 x 105 1.7 x 103 Gly Leu His

pTF7-OM79(Phelll) 5.9 x 103 2.8 x 103 Gly Phe His

pTF7-OM79(Tyr227) 7.9 x 105 6.8 x 102 Gly Leu Tyr

aCV-1 cells were infected withts023virus(multiplicity of infection ofapproximately1PFUper cell)at roomtemperature for30min.Then,thevirus inoculum wasreplaced with 2 ml of minimal essential medium containing5%fetalbovine serum and incubated at 39°C for 2 h. At 2.5 h after infection, the cells were infected withvTFl-6,2(recombinant vaccinia virus that expresses T7 RNA polymerase) at a multiplicity of 30 PFU per cell at 39°C for1 handtransfected with15,ug of eachplasmidDNAasindicated. The cells were incubated furtherat39°C for14h.Supernatant culture fluidswerethencollected,andts023 progeny viruswas

titrated by plaque assay onL-cell monolayersat31and39°C.

bTheseamino acid substitutionsatposition 21, 111,or 227 weremadeby extension of mismatchedoligodeoxynucleotide primers homologoustots023or

wild-type M genes, or by constructing chimeras of wt andts023Mgenes. Eachimputed amino acid sequencewascorroboratedbyplasmid DNAsequencing.

analogous results to those with epitope 2-specific MAb3 were obtained with epitope 3-specific MAb25 (data not shown).

Figure 4C and D, illustrating Western blot analysis of M proteinsexpressed in CV-1 cellstransfected withwt-mutant

chimeric plasmids, confirms the requirement of glycine at position 21 for epitope 1 antigenic specificity. Chimeric plasmids pTF7-OM79(Phelll) and pTF7-OM79(Tyr227)

with glycine at position 21 synthesized M proteins that recognized MAb2 despite the presence ofts023 M-protein amino acids phenyalanine at position 111 or tyrosine at position 227 (lanes 4 and 6). Conversely, chimeras pTF7-tsM23(R2) and pTF7-tsM23(R3) withts023glutamic acid at position 21 expressed M proteins that did not recognize MAb2 (epitope 1), despite the presence of wt amino acids Leu-111 and His-227 (lanes 5 and 7). It is also of interest that the M proteins expressed by pTF7-tsM23(R2) and pTF7-tsM23(R3) migrated more slowly on the polyacrylamide gel (Fig. 4D, lanes 5 and 7), emphasizingthepoint that glutamic acid at position 21 results in retarded mobility of the M protein.

Marker rescue of thetemperature-sensitive phenotype of M protein. Although the glycine at position 21 of wt M protein clearlyimparts epitope 1 antigenic specificity, this may not bethe genotypic site responsible for temperature sensitivity

ofmutant tsO23. In fact, Morita et al. (14) have provided evidence, based on sequencing a large series of M-gene mutants and revertants, that the nature of the amino acid at position 111, or sequences in its vicinity, determines their temperature-sensitivephenotype. It is their contention that a

Leu-111->Phe M-protein substitution, rather than the Gly-21-+Glu or His-227--Tyr substitution, is the reason why ts023 does not grow at 39°C. We had previously shown(11)

that the wt M gene expressed by plasmid pTF7-M3 could rescue by-100-fold theinfectivity oftsO23 in CV-1 cells at the restrictive temperature of 39°C. Now that we have available wt Orsay and mutants, tsO23 M-gene mutants, with amino acids substituted at position 21, as well as

wt-mutantchimeras with single amino acid substitutions at positions 111 and227, itwaspossibletodeterminewhether

M proteins expressed by these pTF plasmids could rescue

tsO23 in cells infected atthe restrictive temperature. Aspreviously described (11), marker rescue experiments

were performed by infecting CV-1 cells with tsO23 at a multiplicity of1PFU per cellandincubatingat 39°C for2.5 hbeforecoinfectingthese cellswithvacciniavirusvTF1-6,2

at 30PFU per cell. After furtherincubationat39°C for1 h,

these cells were transfected with 15 ,u.g of calcium phos-phate-precipitated plasmid DNA pTF7-tsM23, pTF7-tsM23 (Rl), pTF7-OM79, pTF7-OM79(Glu2l), pTF7-OM79

(Ala2l), and pTF7-OM79(Pro2l), or chimeric plasmids

pTF7-tsM23(R2), pTF7-tsM23(R3), pTF7-OM79(Phelll),

and pTF7-OM79(Tyr227). After further incubation at

39°C

for 14h, supernatant fluidsof these cell culturesweretested

for release of progeny virions

by plaque

assays on L-cell

monolayers atboth 39 and

31°C.

Table 1 summarizes the results ofduplicate

experiments,

illustrating the degree of

complementation

ofmutant tsO23

by transfection with plasmids

expressing

M

proteins

with

amino acids substituted at

position

21, 111, and 227. As noted previously (11), most of the progeny virions in all

experiments were tsO23 that

replicates only

at

31°C,

but a

certain small proportion were spontaneous revertants that grew at39°C. Also as

expected

from

previous

experiments,

mock-transfected cells or cells transfected with mutant

tsO23 recombinant

pTF7-tsM23

produced

only

small

amounts of

tsO23,

which is

quite

leaky,

as well as

having

a high reversion frequency (19). By

comparison,

tsO23-in-fected cells transfected with

Orsay

wt

M-gene

plasmid

pTF7-OM79yielded3.5 x 104or8.5 x

105

PFUoftsO23per ml, about 100 times morethan thatfrom the controls. When

tsO23-infected cells were transfected with

plasmids

pTF7-OM79(Glu2l),

pTF7-OM79(Ala2l),

or

pTF7-OM79(Pro2l),

each of which expresses wt M

protein

with the

respective

proteins substituted at

position 21,

the

yields

oftsO23 virus were as great as or even

slightly

greater than that of cells

on November 10, 2019 by guest

http://jvi.asm.org/

transfected with thewt M-geneplasmid pTF7-OM79 (Table 1). In sharp contrast, tsO23-infected cells transfected with

the Glu-21---Glyrevertant ts023 M-gene recombinant plas-mid pTF7-tsM23(R1) resulted in

production

of tsO23 virus

onlysix times greater than that in cells transfected with the

Glu-21 tsO23M-gene recombinant

pTF7-tsM23

andatleast

20-fold less than cells transfected with those

plasmids

ex-pressingwtM genes

regardless

oftheaminoacidat

position

21 (Table 1).

Also shown in Table 1 are marker rescue experiments

using

ts023-infected cells transfected with wt-mutant chi-meric

plasmids

with

single

aminoacid substitutionsat

posi-tions 21, 111, or227.

Clearly,

those

plasmids

with

phenylal-anine at

position

111 [pTF7-tsM23,

pTF7-tsM23(R3),

and

pTF7-0M79(Phelll)]

failed to rescue tsO23 mutants,

regardless oftheamino acidat

positions

21and 227. In

sharp

contrast, allM-gene

plasmids

containing

leucine at

position

111 [pTF7-tsM23(R2),

pTF-OM79,

and

pTF7-OM79

(Tyr227)]

all increased

yields

ofthe ts023 mutant

by

titers

morethan 100-foldgreaterthan thatofcontrolsor

plasmids

with phenylalanine at position 21.

These dataindicate that the

ability

of

plasmid-expressed

wt M protein to rescue tsO23 at therestrictive temperature haslittleornothingtodowiththe presence ofglycineorany otheramino acidat

position

21,

suggesting

thatthe

glutamic

acid at

position

21 is not

responsible

for the

nonpermis-sivenessof ts023. These resultsclearlyconfirm the

hypoth-esis of Morita et al. (14) that the

temperature-restricted

phenotype

ofts023 isduetothe presenceof

phenylalanine,

rather than

leucine,

at

position

111 ofthe M

protein.

No

specific phenotype

can be

assigned

tothe

Tyr->His

substi-tutionat

position

227 ofts023.

DISCUSSION

Bymeansof site-directedmutations

leading

to

expression

ofM

protein

withaminoacid substitutionsat

position 21,

we were able to testsome of thepredictions made by Brandt-Rauf et al. (1)

concerning

conformational changes in this

region

that could alter MAb2 recognition ofepitope 1. A

Gly-21--Glu

substitution in M

protein

cloned in and

ex-pressed by

pTF7-OM79(Glu2l)

led todisappearance of

epi-tope

1,

as did expressed M proteins with alanine orproline substituted for

glycine

at

position

21.Glu-21-*Gly

substitu-tion inmutantM

protein

expressed bytherevertantplasmid

pTF7-tsM23(R1)

restoredepitope 1,asevidenced bybinding

of MAb2. These data support the hypothesis, based on

computerized

minimalenergy conformations ofthe M-pro-tein

peptides

from Lys-15 to Pro-26, that predicts that

glycine

at

position

21results ina

p-bend,

possiblycritical for

expressing epitope

1, whereas glutamic acid or alanine at

position

21 would beexpectedtoloseepitope 1becausethe

global

minimal energy of such apeptide should assume the

shape of an ox-helix (1). The prediction that proline at

position

21

might

result in a peptide much like that of the

Gly-21 peptide

and wouldperhapsrecognize MAb2 was not borne outby ourexperiments.

Somewhat unexpectedly, amino acid substitutions at

po-sition 21 ofplasmid-expressed M proteins resulted in their altered mobility on electrophoresis in polyacrylamide-SDS

gels (Fig.

4B), a difference that had been noted previously

betweenthevirionMproteinsof VSV wt and

ts023

(14). All

plasmid-expressedMproteins with glutamic acid at position 21

migrated

slower than M proteins expressed by

pTF7-tsM23(R1)

or pTF7-OM79withglycine at position 21. This couldbe due todifference in charge of the two amino acids

but is also likely to result from the more compact

P-bend

conformation of the Gly-21 M protein than the extended a-helix of the Glu-21 M protein, whose gel migration would beexpected to be retarded.

Recent studies by Ono et al. (16) have shown that M proteins produced in cells infected withtwoother group III mutants,tsG31ortsG33, aggregateattheperinuclear region at nonpermissive temperatures but diffuse throughout the cytoplasmatpermissive temperatures. Althoughwehave no direct evidence for thesetemperature-dependent phenomena for mutant ts023 M protein, it may well be that this observation explains the failure of group III mutant M proteins to promote VSV maturationatrestrictive

tempera-tures. We were able to demonstrate in the experiments presented here thatwtMprotein expressed in CV-1 cells by pTF7-OM79 was able to rescue ts023 at the restrictive temperature but thatmutant Mprotein expressedby pTF7-tsM23 could not. These experiments indicate that the plas-mid-expressedwtandmutantMproteinsarephenotypically similarto theirrespective virion wt and ts023 M proteins. Our studies also support the conclusion advancedby Ono et al. (16) that the normal functions of M protein in VSV

maturationdonotappeartobedependentonthe activities of other VSV proteins.

Our studies clearly indicate that the Gly-21-*Glu

substi-tution in the M protein of ts023 is not responsible for the

temperature-sensitive phenotype that results in abortive

maturation ofVSVmutantvirionsattherestrictive

temper-ature. Clearly, plasmids expressing M genes that are

geno-typically wt, except for glutamic acid, alanine, or proline

substitutedforglycine atposition 21, all complementts023

at the restrictive temperature. Also, the revertant plasmid

pTF7-tsM23(R1), inwhich theGlu-21---Gly substitution re-stores epitope 1, fails to rescue coinfecting ts023 at the

nonpermissive temperature. Further marker rescue experi-mentswithwt-mutantchimericplasmids clearlyshow thata Leu-*Phe substitution at amino acid 111, rather than the

Gly-*Glu substitution at amino acid 21 or the His--Tyr substitution at amino acid 227, confers the temperature-sensitive phenotype on mutant ts023. These data lend credence to the hypothesis advanced by Moritaet al. (14) that the temperature-sensitive phenotype of ts023, and

perhaps other group III mutants, is due to the Leu-*Phe

substitutionataminoacid111. Thecommondenominatorin all of ourmarker rescue experiments was successful

com-plementation oftsO23 when the plasmid-expressed M pro-tein contained a leucine and not a phenylalanine at amino

acidposition 111.

At this stage of our studies, we have not been able to

identify conclusively the genotype of M protein which endows it with the phenotype fordown regulation of VSV

transcription(2, 4, 29).Moritaetal. (14) haveidentified three mutations in the M gene of tsO23 and at different sites in other group IIImutantMproteinsrestricted intranscription

inhibition;quite a few revertants, with amino acid substitu-tions at sitesfar distant from the original mutational sites,

partially restore transcription-inhibitory activity to mutant M proteins. However, in no case is transcription inhibition

or its loss by mutation a temperature-dependent event. In

fact, there is no good correlation between reversion of

temperature-sensitive phenotype and restoration of

M-pro-teintranscription-inhibitory activity. Our earlier studies, in which M-protein transcription inhibition is reversed by a MAb specific for epitope 1, suggest that the transcription

inhibition site ofMprotein is located at its amino-terminal end (15). Studies by Shipley et al. (24) indicate that a

on November 10, 2019 by guest

http://jvi.asm.org/

synthetic oligopeptide corresponding to the first 20 amino acids of wt M protein inhibits VSV transcription in vitro, whereas a synthetic oligopeptide representing epitope 1 and corresponding to M-protein amino acids 17 through 31 does not inhibit transcription. These preliminary data provide reasonable sites on the M-protein gene for site-directed mutagenesis and expressing products that can be tested for defects in transcription inhibition activity. However, further refinements in our techniques are required to construct vectors that express wt and mutant M proteins in sufficient quantities and purity to assay reliably their transcription-inhibitory activity.

ACKNOWLEDGMENTS

This research was supported by Public Health Service grants AI-11112 and AI-21652 from the National Institute of Allergy and Infectious Diseasesand by grant MV-9 from the American Cancer Society.

We again express our gratitude to Bernard Moss and Thomas Fuerstforgraciously supplying the vaccinia virus vectors.

LITERATURE CITED

1. Brandt-Rauf, P. W., M. R. Pincus, J. Maizel, R. P. Carty, J. Lubowsky, M. Avitable, J. B. Shipley, and R. R. Wagner. 1987. Structural effects of amino acid substitutions on the matrix protein of vesicular stomatitis virus. J. Protein Chem. 6:463-472.

2. Carroll, A. R., and R. R. Wagner. 1979. Role of the membrane (M) proteininendogenous inhibition of invitrotranscriptionby vesicular stomatitis virus.J. Virol.29:134-142.

3. Chen, E. Y., and P. H. Seeburg. 1985. Supercoil sequencing: a fast andsimple method for sequencing plasmid DNA. DNA 4: 165-170.

4. Clinton,G. M., S. P. Little, F. S. Hagen, and A. S.Huang. 1978. The matrix (M) protein of vesicular stomatitis virus regulates transcription. Cell 15:1455-1462.

5. Dente, L., G. Cesaren, and R. Cortese. 1983. pEMBL: a new family of single-stranded plasmids. Nucleic AcidsRes. 11:1645-1655.

6. Fuerst, T. R., E. G. Niles, F. W. Studier, and B. Moss. 1986. Eukaryotic transient expressionsystem based onrecombinant vaccinia virusthat synthesizesbacteriophageT7 RNA polymer-ase. Proc. Natl. Acad. Sci. USA83:8122-8126.

7. Grunstein, M.,and D.S.Hogness. 1975.Colonyhybridization:a method for the isolation of cloned DNA'sthatcontainaspecific gene. Proc. Natl. Acad. Sci. USA72:3961-3965.

8. Gubler, U., and B. J. Hoffman.1983.Asimple andveryefficient methodforgenerating cDNA libraries. Gene25:263-269. 9. King, P. V., and R. W. Blakesley. 1986. Optimizing DNA

ligations for transformation. Focus(BRL) 8:1-3.

10. Laemmli,U. K.1970.Cleavage of structuralproteins duringthe assembly of the head ofbacteriophage T4. Nature (London)

227:680-685.

11. Li, Y., L. Luo, R. M. Snyder, and R. R. Wagner. 1988. Expression ofthe M geneof vesicular stomatitisvirusclonedin various vaccinia virusvectors.J. Virol. 62:776-782.

12. Luo, L., Y. Li, R. M. Snyder,andR. R. Wagner. 1988. Point mutations in glycoprotein gene of vesicular stomatitis virus (NewJersey serotype) selected by resistancetoneutralization

by epitope-specific monoclonal antibodies. Virology 163:341-348.

13. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

14. Morita, K., R. Vanderoef, and J. Lenard. 1987. Phenotypic revertantsof temperature-sensitive M protein mutants of vesic-ular stomatitis virus: sequence analysis and functional charac-terization. J.Virol.61:256-263.

15. Ogden, J. R., R. Pal, and R. R. Wagner. 1986. Mapping regions of the matrixprotein of vesicular stomatitis virus which bind to ribonucleocapsids, liposomes, and monoclonal antibodies. J. Virol. 58:860-868.

16. Ono,K., M. E. Dubois-Dalcq, M. Schubert, and R. A. Lazzarini. 1987. Amutated membraneprotein of vesicular stomatitis virus has anabnormaldistribution withinthe infected cell and causes defectivebudding.J. Virol.61:1332-1341.

17. Pal, R., B. W. Grinnell, R. M. Snyder, and R. R. Wagner.1985. Regulation of viral transcriptionby the matrixprotein of vesic-ular stomatitis virus probed by monoclonal antibodies and temperature-sensitivemutants.J. Virol.56:386-394.

18. Pal, R., B. W. Grinnell, R. M. Snyder, J. R. Wiener, W. A. Volk, and R. R. Wagner. 1985. Monoclonal antibodies to the M protein of vesicular stomatitis virus (Indianaserotype)andto a cDNA M geneexpression product. J. Virol. 55:298-306. 19. Pringle, C. R. 1987. Rhabdovirusgenetics,p. 167-243. In R. R.

Wagner (ed.), The rhabdoviruses. Plenum Publishing Corp., NewYork.

20. Rose, J. K., and C. J.Gallione. 1981. Nucleotidesequencesof the mRNA's encoding the vesicular stomatitis virus G and M proteins determinedfrom cDNA clonescontainingthecomplete coding regions. J.Virol. 39:519-528.

21. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA74:5463-5467.

22. Schnitzer, T. J., and H. F. Lodish. 1979.Noninfectious vesicular stomatitis virusparticles deficient inthe viralnucleocapsid. J. Virol.29:443-447.

23. Schubert, M., G. Harmison, and E. Meier. 1984. Primary structureof thevesicular stomatitis viruspolymerase (L)gene: evidence for a high frequency of mutations. J. Virol. 51:505-514.

24. Shipley, J. B., R. Pal, and R. R. Wagner. 1988. Antigenicity, function, and conformation of synthetic oligopeptides corre-spondingtoamino-terminal sequencesofwild-typeandmutant matrixproteins ofvesicularstomatitis virus.J.Virol. 62:2569-2577.

25. Steinhauer,D. A., andJ. J. Holland. 1986. Direct method for quantitation of extreme polymerase error frequencies at se-lectedsinglebase sitesin viral RNA. J. Virol. 57:219-228. 26. Towbin,H., T.Staehelin,andJ.Gordon. 1979.Electrophoretic

transfer ofprotein from polyacrylamide gels to nitrocellulose sheets:procedure andsomeapplications.Proc.Natl. Acad.Sci. USA 76:4350-4354.

27. Wagner, R. R. 1987. Rhabdovirus biology and infection: an overview, p. 9-74. In R. R. Wagner(ed.),The rhabdoviruses. PlenumPublishing Corp.,NewYork.

28. Weiss,R. A.,and R. L. R. Bennett. 1980. Assembly of mem-braneglycoprotein studied by phenotypic mixingbetween

mu-tantsof vesicular stomatitis virusand retrovirus.Virology100: 252-274.

29. Wilson, T., andJ. Lenard. 1981. Interaction ofwild-type and mutantM proteinofvesicularstomatitisvirus with

nucleocap-sidsin vitro. Biochemistry20:1349-1354.

on November 10, 2019 by guest

http://jvi.asm.org/