What are the differences between DNA and RNA? Mark all that apply 1
A They have different sugars
B They have different phosphate groups
C DNA is double stranded and RNA is single stranded D Uracil is found only in DNA
If tall is dominant to short pea plants, cross the F1 generation and give the genotypic and phenotypic ratios.
2
A GR: 4:0 PR: 0:4:0 B GR: 0:4:0 PR: 4:0 C GR: 1:2:1 PR: 3:1 D GR: 3:1 PR: 1:2:1
Many scientists had some impact on the current theory of evolution - mark all of the ones below that had some contribution
3
A Darwin B Lemarck C Malthus D Mendell E Lyell F Franklin
The enzyme used to cut DNA to create fragments for a DNA fingerprint is called ligase. 4
A True B False
When a restriction enzyme cuts DNA from a plasmid and a gene and the desired gene is inserted into the plasmid the resultant is known as recombinant DNA.
5
A True B False
How will you treat a pink streptobacillus infection? 6
A Penicillin B vaccines C tetracycline
Mark all that are true 7
A This is a karyotype B This is a female C This is a male D No genetic disorders
Name the product(s) of translation. Mark all that apply 8
A messenger RNA B Proteins
C amino acid chain D polypeptide chain
The Law of independent assortment explains that only one allele will come from one parent for each trait.
9
A True B False
An organ that has similar function in different organisms but has different internal structure is known as
10
A a homologous structure B an analogous structure C a vestigial structure D both b and c
What can you tell from the gel picture? Mark all that apply 11
A suspect one is not guilty B suspect 2 is guilty C the victim is guilty
How do bacteria reproduce? Mark all that apply 12
A asexual: conjugation B sexual: conjugation C asexual : binary fission D sexual: binary fission E asexual: mitosis F sexual: pollination
Which of the following are true in regards to viruses? 13
A they are non-living
B the lytic cycle takes over the cell to make it burst quickly C the lytic cycle inserts its DNA into the host's DNA D Vaccines are used to treat viral infections E Antibiotics are used to treat viral infections F you cannot treat a viral infection
Mark all that are true in regards to RNA 14
A mRNA is made in the nucleus B tRNA makes amino acids C mRNA is double stranded D rRNA is also the ribosome
E the A and P sites are found in rRNA
F amino acids are added to a polypeptide chain at the ribosome
A parent has B blood type and the other parent has AB blood. What are the chances of them having a child with A blood?
15
A 0% B 25% C 50%
D a and b can be correct E a and c can be correct
Calculate the frequency of carriers of cystic fibrosis in a population in North America -where one in every 25,000 people have this disease.
16
DNA is negatively charged and the smallest fragments will move the furthest down a gel. 17
Put the following levels of taxonomy in the correct order from the largest group to the smallest.
18
A class B family C genus D kingdom E order F phylum G species
DNA: AGGTACTTCAAAAACCGACCGATC
What is the complimentary strand? How many amino acids are coded for in this protein? 19
A UCCAUGAAGUUUUUGGCUGGCUAG; 8 B TGGATCAACTTTTTCCGTCCGTAC; 8 C TCCATGAAGTTTTTGGCTGGCTAG; 6 D TCCATGAAGTTTTTGGCTGGCTAG; 8
A woman whose dad was a hemophiliac marries a man who does not have hemophilia. What is the likelihood of their child having hemophilia? mark all that apply
20
A girl 0% chance of having it but could be a carrier B boy 0% chance of having it but could be a carrier
C girl 50% chance of having it 50% chance of being a carrier D boy 50% chance of having it 50% chance of being a carrier E boy 50% chance of having it 0% chance of being a carrier F 50% chance of having it does not matter the sex of the child
For a population to be in H-W equilibrium- what must be true? Mark all that apply 21
Use the cladogram to the right- which of the animals have amniotic eggs? Mark all that apply
22
A amphibians B rabbits C dinosaurs D crocodiles E birds
Which of the following are true about fungi? mark all that apply 23
A cell wall made of cellulose B decomposers
C are used to make vaccines D are external heterotrophs
What type of genetic trait is shown in this pedigree?(mark all that apply) 24
A Autosomal B Sex-linked C recessive D dominant
Human blood type is an example of what type of genetic traits? (mark all that apply) 25
A multiple alleles B co dominant traits C polygenetic traits D sex-linked traits
Methionine is the only amino acid that is allowed to go to P site before it bonds with any other amino acid.
26
A codon is 4 nucleotides of mRNA. 27
A True B False
Cross a heterozygous tall, heterozygous yellow kernel corn plant with a short, heterozygous yellow kernel corn plant. How many will be tall and yellow?
28
What type of selection is shown by the graph below? 29
A directional B stabilizing C disruptive
D selects for most common trait
Acer rubrum is also known as a Red maple tree. "Acer" is the 30
A genus name B species name C family name D order name
Put the following in order from largest to smallest! 31
A cell B organ C system D tissue
Which of the following are functions of the circulatory system? (mark all that apply) 32
A bring oxygen to cells
B take metabolic waste to the kidney C take nutrients to all cells
